ID: 914828724

View in Genome Browser
Species Human (GRCh38)
Location 1:151155148-151155170
Sequence TACAGGACGTTCTCAGGAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 107}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914828724_914828729 23 Left 914828724 1:151155148-151155170 CCACTTCCTGAGAACGTCCTGTA 0: 1
1: 0
2: 0
3: 11
4: 107
Right 914828729 1:151155194-151155216 TTATGCCGTCCCCATCATCTGGG 0: 1
1: 0
2: 0
3: 3
4: 61
914828724_914828728 22 Left 914828724 1:151155148-151155170 CCACTTCCTGAGAACGTCCTGTA 0: 1
1: 0
2: 0
3: 11
4: 107
Right 914828728 1:151155193-151155215 CTTATGCCGTCCCCATCATCTGG 0: 1
1: 0
2: 0
3: 8
4: 57

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914828724 Original CRISPR TACAGGACGTTCTCAGGAAG TGG (reversed) Intergenic
900197292 1:1382900-1382922 TACAGGACTTTCTGCGAAAGAGG - Intergenic
900527917 1:3138135-3138157 AGCAGGAAGTTCTCTGGAAGAGG - Intronic
902406010 1:16184037-16184059 TGCAGGACGTGCTCAAGAAATGG - Intergenic
903257965 1:22115247-22115269 GACTGGTTGTTCTCAGGAAGAGG + Intergenic
904263270 1:29303475-29303497 TCCAGGTTGTTCTCTGGAAGAGG + Intronic
904835137 1:33330931-33330953 CACAGCAGGTTCTCAGGAAATGG + Intronic
911635864 1:100235585-100235607 TAGAGAATGTTCTCAGGCAGAGG + Intronic
914828724 1:151155148-151155170 TACAGGACGTTCTCAGGAAGTGG - Intergenic
914863464 1:151405845-151405867 AATAGGACGTTCTTTGGAAGGGG - Exonic
915296055 1:154922698-154922720 CACAGCAGGTGCTCAGGAAGTGG + Intergenic
915978720 1:160407341-160407363 AACAGGAGGTTCTCAGGATGGGG + Intronic
920233926 1:204490189-204490211 TACAGAGAGTTCTCAGGAAGAGG + Exonic
920591180 1:207220568-207220590 TACAGGACGATTTCAGAAACGGG + Intergenic
920939574 1:210469023-210469045 TATAGTAGGTCCTCAGGAAGTGG + Intronic
924669456 1:246108671-246108693 TACAGGAGGTTTTCAAGAAAGGG - Intronic
1063424024 10:5937384-5937406 CACAGCACTTTCTGAGGAAGAGG + Exonic
1073156428 10:101350795-101350817 TATAGGACGAGCACAGGAAGAGG - Intergenic
1075411329 10:122230464-122230486 CACATGACATTCTCAGGAGGTGG - Intronic
1075694378 10:124422747-124422769 GACAGGAAGTGCTCAGGAAGAGG - Intergenic
1076891145 10:133284090-133284112 TGGAGGACGTTCTCTGGACGTGG + Intronic
1078846208 11:15120489-15120511 AACAGGAAGTTGCCAGGAAGAGG + Intronic
1079771321 11:24463171-24463193 TAGAAGATGTTCTAAGGAAGCGG + Intergenic
1082648183 11:55754215-55754237 CAAAGCACATTCTCAGGAAGCGG + Intergenic
1083004723 11:59332606-59332628 TACAGTACAATCTCAGGGAGTGG + Intergenic
1084677725 11:70646025-70646047 TACAGTAAGTGCTCAAGAAGTGG + Intronic
1085844319 11:80048402-80048424 GACCGTATGTTCTCAGGAAGTGG + Intergenic
1089034403 11:115371056-115371078 TAAAGGAAGTTATCAGGCAGAGG + Intronic
1091011653 11:132006854-132006876 CACAGGAAGTGCTCAGGAAGTGG - Intronic
1091139412 11:133222412-133222434 AACAGGACGAGCTGAGGAAGGGG + Intronic
1091246234 11:134097383-134097405 TACAGCACTTGCTCAGGAACAGG + Intronic
1095261330 12:40103263-40103285 GAAAGGACGTTCTAAGCAAGGGG - Intronic
1095442910 12:42255805-42255827 TACAAGAGGATCTAAGGAAGAGG - Intronic
1097156167 12:57013747-57013769 TTCAGGATGGGCTCAGGAAGAGG - Intronic
1101679545 12:106951984-106952006 AACAGGATATTGTCAGGAAGTGG + Intergenic
1101913037 12:108874933-108874955 TACAGGGCGTTCTGGGGAGGTGG + Intronic
1105533336 13:21240755-21240777 CACAGGAAGTGCTCAGTAAGTGG + Intergenic
1107030911 13:35852974-35852996 GACAGAATGTTCTCAGAAAGAGG + Intronic
1109283919 13:60389318-60389340 TAAAGGTCATTCTCAAGAAGTGG + Intergenic
1111502109 13:89135002-89135024 TACATGATATTTTCAGGAAGCGG + Intergenic
1114238680 14:20846252-20846274 TACAGCACAGTCTCAGGAACTGG + Intergenic
1121251251 14:92500902-92500924 TACAGGAGTTGCTAAGGAAGGGG + Exonic
1122327764 14:100892692-100892714 TACAGGACCTTCCCCGGGAGGGG + Intergenic
1124830921 15:33148523-33148545 TAGAGGAGGTTTACAGGAAGTGG + Intronic
1127868931 15:63054105-63054127 TACAGGGCCTCCTCAGGAAGGGG + Intronic
1128451613 15:67809038-67809060 TGATGGACTTTCTCAGGAAGAGG + Intergenic
1130069143 15:80631670-80631692 TACAGGACGTTCTGGGGTAGGGG - Intergenic
1133639001 16:7698805-7698827 TACAGAAGGTTCTCAATAAGTGG - Intronic
1136556800 16:31011655-31011677 GACAGGAGGGTTTCAGGAAGAGG - Intergenic
1137231183 16:46569265-46569287 TTCAGGACATTCCCCGGAAGGGG + Intergenic
1138591083 16:58000223-58000245 TACAGGCCGGGCCCAGGAAGCGG + Intronic
1138694378 16:58798008-58798030 TACAGGAATTTTTCAGGGAGGGG + Intergenic
1140588544 16:76323677-76323699 TGCAGCATGTTCTAAGGAAGGGG - Intronic
1141232011 16:82176852-82176874 TGGAGGAGGTTCTCAGAAAGAGG + Intergenic
1141257865 16:82419854-82419876 TTCAGGAGGTTTTCTGGAAGAGG + Intergenic
1143268786 17:5660186-5660208 AACAGGAGGTTCCCAGGACGGGG - Intergenic
1152189697 17:78880982-78881004 TACGGGACGTGCTCAGGCAGCGG + Intronic
1155444056 18:25892301-25892323 TTCTGGACGTTCTCAGGATTAGG + Intergenic
1156633267 18:38995807-38995829 CTCAGGAAGCTCTCAGGAAGGGG - Intergenic
1157699489 18:49751911-49751933 TGTAGCAGGTTCTCAGGAAGTGG + Intergenic
1157714426 18:49873669-49873691 TACATTACATTCTCAGAAAGTGG + Intronic
1158803560 18:60943005-60943027 TCCAAGAGGTTCTCAGGAGGAGG + Intergenic
1158962771 18:62600495-62600517 TACAGCATGTTCTGAGGCAGAGG + Intergenic
1161433972 19:4250846-4250868 AACACGAAGTTCTCAGGTAGAGG + Intronic
1162230490 19:9261941-9261963 TACAAGACATTCTCAGAAGGTGG + Intergenic
1164255925 19:23528199-23528221 TGCATGACGTTCTCTGAAAGGGG - Intronic
1168681327 19:58318100-58318122 TGCAGGAGGTGCTCAGGAAAGGG + Intergenic
1168681424 19:58318675-58318697 TGCAGGAGGTGCTCAGGAAAGGG - Intergenic
931161219 2:59692621-59692643 AACAGAAAGTTCTCTGGAAGAGG - Intergenic
931899081 2:66767948-66767970 TTCAGGAGGGTCTCAGGAAAGGG + Intergenic
935973483 2:108554735-108554757 GACATGACGCTCTCAGGAGGCGG + Intronic
940249228 2:151655951-151655973 TCCAGCAGGTTCTCTGGAAGTGG - Exonic
941586201 2:167362661-167362683 AACAGAAGGTCCTCAGGAAGGGG - Intergenic
942432456 2:175927100-175927122 TACAGGACGTTGAGAGCAAGAGG + Exonic
948080426 2:235200992-235201014 TGCAGGCTGTTCTCAGGCAGAGG - Intergenic
1173474470 20:43349276-43349298 GACAGCACGTCCCCAGGAAGGGG + Intergenic
1173581268 20:44148539-44148561 TCCAGGACGTTGTCAGCAGGTGG - Intronic
1174994314 20:55548520-55548542 TACAGCACTTTCTTAGGAAGTGG + Intergenic
1177850565 21:26342503-26342525 TCCAGGATGTTCTCAGTTAGAGG - Intergenic
1178200678 21:30400472-30400494 TACAGGACCTTCTAAGGACCTGG + Intronic
1182432135 22:30305605-30305627 CAGAGGAGGTTCTCAGGAACAGG + Intronic
950465757 3:13152945-13152967 TACAGGACTTGCTTAGGGAGTGG - Intergenic
951449831 3:22824947-22824969 TAATGGAAGGTCTCAGGAAGTGG - Intergenic
953710532 3:45265990-45266012 TAGAGGACATCCTCATGAAGCGG - Intergenic
954906309 3:54066193-54066215 CACAGCACGTTCTGAGGAAAGGG + Intergenic
958435622 3:94092234-94092256 TACAGAGCCTTCTCAGGAACTGG - Intronic
961792451 3:129385925-129385947 TTCAGTAGGTTCTCAGGAACTGG + Intergenic
961806421 3:129492491-129492513 TTCAGTAGGTTCTCAGGAACTGG + Intronic
961979280 3:131059754-131059776 TACAGTAAGTTCTCTGAAAGAGG - Intronic
962431724 3:135326378-135326400 TACAGGGCATACACAGGAAGGGG + Intergenic
963482063 3:145888696-145888718 TTCAGGAGGTTCTAAGGAAATGG - Intergenic
966605247 3:181815019-181815041 TAAAGGAGGATTTCAGGAAGAGG - Intergenic
967526143 3:190495120-190495142 CACAGGAAGTGCTCAGCAAGTGG + Intergenic
968585229 4:1413250-1413272 TGCAGCACGTTCTCATGGAGGGG - Intergenic
972376432 4:38476242-38476264 TCCAGGAAGATCTCTGGAAGGGG - Intergenic
974313833 4:60250708-60250730 TACATGAAGTTCTGAGGAAGAGG + Intergenic
977147192 4:93458585-93458607 TCCAGGATGTTCTCTGCAAGAGG - Intronic
983343689 4:166500185-166500207 AACTGGGTGTTCTCAGGAAGAGG - Intergenic
985917966 5:2940905-2940927 TGCAGGATGTTCTCATTAAGTGG - Intergenic
988332750 5:29863890-29863912 TCCAGGGCATTCTCAGGCAGTGG + Intergenic
991528407 5:67589521-67589543 TACAGTACATGCTCAGTAAGTGG + Intergenic
996021332 5:118593938-118593960 GACAGGACATTCTCAAGGAGAGG + Intergenic
998810084 5:145957778-145957800 TGCAGGATGTTTTCAGGCAGGGG + Intronic
1004650534 6:17603224-17603246 TATAGAAAGTACTCAGGAAGTGG - Intronic
1008032538 6:46713278-46713300 TACAGGACCTTTTCAAGAGGGGG + Intronic
1008685959 6:53926622-53926644 TAAAACACGCTCTCAGGAAGTGG + Intergenic
1014015087 6:116520598-116520620 TACATCAGGTTCTCAGGAAATGG - Exonic
1015490770 6:133823199-133823221 TACAGTCCGTTTACAGGAAGAGG - Intergenic
1015560128 6:134505489-134505511 TACAGCCCTTTCTCAGGAAGTGG + Intergenic
1020430300 7:8111313-8111335 TACAGGAAGTGTACAGGAAGAGG + Intergenic
1028457052 7:91049917-91049939 TTCAGGAAGTTCTGAGAAAGGGG + Intronic
1033628559 7:143134702-143134724 TGTAGGATGTTATCAGGAAGTGG + Intronic
1038114667 8:24539980-24540002 TAGAGGATGTGCTCAGAAAGTGG + Intergenic
1044350494 8:91159273-91159295 TAAAGGACGTTATCTGGAACTGG + Intronic
1044543322 8:93431727-93431749 TACAGGAGGTCCTGAGGAAGAGG - Intergenic
1056852302 9:90094803-90094825 TGCAGGCCGTTCTCAGGCACAGG - Intergenic
1058746999 9:108001424-108001446 TCCAGGACTTCCTCAGGCAGGGG + Intergenic
1059597907 9:115743353-115743375 TACAATAGGTTCTCAGAAAGTGG + Intergenic
1185822910 X:3221844-3221866 TACAGGACACTCTGAGGCAGGGG + Intergenic
1195636230 X:107118655-107118677 TATTGCACGTTCTCAGGATGCGG - Intronic