ID: 914829380

View in Genome Browser
Species Human (GRCh38)
Location 1:151159559-151159581
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 153}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914829380_914829396 27 Left 914829380 1:151159559-151159581 CCCTCCCATGTGAACCAAGGAAA 0: 1
1: 0
2: 1
3: 15
4: 153
Right 914829396 1:151159609-151159631 GGGATACTAAAGACAGAAGAGGG 0: 1
1: 0
2: 0
3: 21
4: 270
914829380_914829389 7 Left 914829380 1:151159559-151159581 CCCTCCCATGTGAACCAAGGAAA 0: 1
1: 0
2: 1
3: 15
4: 153
Right 914829389 1:151159589-151159611 CAGCCCAGAGAACCCCTTTGGGG 0: 1
1: 0
2: 1
3: 17
4: 151
914829380_914829387 5 Left 914829380 1:151159559-151159581 CCCTCCCATGTGAACCAAGGAAA 0: 1
1: 0
2: 1
3: 15
4: 153
Right 914829387 1:151159587-151159609 CACAGCCCAGAGAACCCCTTTGG 0: 1
1: 0
2: 3
3: 24
4: 173
914829380_914829397 28 Left 914829380 1:151159559-151159581 CCCTCCCATGTGAACCAAGGAAA 0: 1
1: 0
2: 1
3: 15
4: 153
Right 914829397 1:151159610-151159632 GGATACTAAAGACAGAAGAGGGG 0: 1
1: 1
2: 0
3: 20
4: 318
914829380_914829395 26 Left 914829380 1:151159559-151159581 CCCTCCCATGTGAACCAAGGAAA 0: 1
1: 0
2: 1
3: 15
4: 153
Right 914829395 1:151159608-151159630 GGGGATACTAAAGACAGAAGAGG 0: 1
1: 0
2: 3
3: 19
4: 252
914829380_914829388 6 Left 914829380 1:151159559-151159581 CCCTCCCATGTGAACCAAGGAAA 0: 1
1: 0
2: 1
3: 15
4: 153
Right 914829388 1:151159588-151159610 ACAGCCCAGAGAACCCCTTTGGG 0: 1
1: 0
2: 1
3: 14
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914829380 Original CRISPR TTTCCTTGGTTCACATGGGA GGG (reversed) Exonic