ID: 914829383

View in Genome Browser
Species Human (GRCh38)
Location 1:151159563-151159585
Sequence CTCCTTTCCTTGGTTCACAT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 4, 3: 21, 4: 200}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914829383_914829389 3 Left 914829383 1:151159563-151159585 CCCATGTGAACCAAGGAAAGGAG 0: 1
1: 0
2: 4
3: 21
4: 200
Right 914829389 1:151159589-151159611 CAGCCCAGAGAACCCCTTTGGGG 0: 1
1: 0
2: 1
3: 17
4: 151
914829383_914829387 1 Left 914829383 1:151159563-151159585 CCCATGTGAACCAAGGAAAGGAG 0: 1
1: 0
2: 4
3: 21
4: 200
Right 914829387 1:151159587-151159609 CACAGCCCAGAGAACCCCTTTGG 0: 1
1: 0
2: 3
3: 24
4: 173
914829383_914829398 28 Left 914829383 1:151159563-151159585 CCCATGTGAACCAAGGAAAGGAG 0: 1
1: 0
2: 4
3: 21
4: 200
Right 914829398 1:151159614-151159636 ACTAAAGACAGAAGAGGGGAAGG 0: 1
1: 1
2: 4
3: 64
4: 626
914829383_914829395 22 Left 914829383 1:151159563-151159585 CCCATGTGAACCAAGGAAAGGAG 0: 1
1: 0
2: 4
3: 21
4: 200
Right 914829395 1:151159608-151159630 GGGGATACTAAAGACAGAAGAGG 0: 1
1: 0
2: 3
3: 19
4: 252
914829383_914829388 2 Left 914829383 1:151159563-151159585 CCCATGTGAACCAAGGAAAGGAG 0: 1
1: 0
2: 4
3: 21
4: 200
Right 914829388 1:151159588-151159610 ACAGCCCAGAGAACCCCTTTGGG 0: 1
1: 0
2: 1
3: 14
4: 147
914829383_914829396 23 Left 914829383 1:151159563-151159585 CCCATGTGAACCAAGGAAAGGAG 0: 1
1: 0
2: 4
3: 21
4: 200
Right 914829396 1:151159609-151159631 GGGATACTAAAGACAGAAGAGGG 0: 1
1: 0
2: 0
3: 21
4: 270
914829383_914829397 24 Left 914829383 1:151159563-151159585 CCCATGTGAACCAAGGAAAGGAG 0: 1
1: 0
2: 4
3: 21
4: 200
Right 914829397 1:151159610-151159632 GGATACTAAAGACAGAAGAGGGG 0: 1
1: 1
2: 0
3: 20
4: 318

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914829383 Original CRISPR CTCCTTTCCTTGGTTCACAT GGG (reversed) Exonic