ID: 914829386

View in Genome Browser
Species Human (GRCh38)
Location 1:151159573-151159595
Sequence TGGGCTGTGCCTCCTTTCCT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 352
Summary {0: 1, 1: 0, 2: 4, 3: 26, 4: 321}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914829386_914829387 -9 Left 914829386 1:151159573-151159595 CCAAGGAAAGGAGGCACAGCCCA 0: 1
1: 0
2: 4
3: 26
4: 321
Right 914829387 1:151159587-151159609 CACAGCCCAGAGAACCCCTTTGG 0: 1
1: 0
2: 3
3: 24
4: 173
914829386_914829389 -7 Left 914829386 1:151159573-151159595 CCAAGGAAAGGAGGCACAGCCCA 0: 1
1: 0
2: 4
3: 26
4: 321
Right 914829389 1:151159589-151159611 CAGCCCAGAGAACCCCTTTGGGG 0: 1
1: 0
2: 1
3: 17
4: 151
914829386_914829396 13 Left 914829386 1:151159573-151159595 CCAAGGAAAGGAGGCACAGCCCA 0: 1
1: 0
2: 4
3: 26
4: 321
Right 914829396 1:151159609-151159631 GGGATACTAAAGACAGAAGAGGG 0: 1
1: 0
2: 0
3: 21
4: 270
914829386_914829397 14 Left 914829386 1:151159573-151159595 CCAAGGAAAGGAGGCACAGCCCA 0: 1
1: 0
2: 4
3: 26
4: 321
Right 914829397 1:151159610-151159632 GGATACTAAAGACAGAAGAGGGG 0: 1
1: 1
2: 0
3: 20
4: 318
914829386_914829399 21 Left 914829386 1:151159573-151159595 CCAAGGAAAGGAGGCACAGCCCA 0: 1
1: 0
2: 4
3: 26
4: 321
Right 914829399 1:151159617-151159639 AAAGACAGAAGAGGGGAAGGTGG 0: 1
1: 1
2: 27
3: 260
4: 2103
914829386_914829395 12 Left 914829386 1:151159573-151159595 CCAAGGAAAGGAGGCACAGCCCA 0: 1
1: 0
2: 4
3: 26
4: 321
Right 914829395 1:151159608-151159630 GGGGATACTAAAGACAGAAGAGG 0: 1
1: 0
2: 3
3: 19
4: 252
914829386_914829398 18 Left 914829386 1:151159573-151159595 CCAAGGAAAGGAGGCACAGCCCA 0: 1
1: 0
2: 4
3: 26
4: 321
Right 914829398 1:151159614-151159636 ACTAAAGACAGAAGAGGGGAAGG 0: 1
1: 1
2: 4
3: 64
4: 626
914829386_914829388 -8 Left 914829386 1:151159573-151159595 CCAAGGAAAGGAGGCACAGCCCA 0: 1
1: 0
2: 4
3: 26
4: 321
Right 914829388 1:151159588-151159610 ACAGCCCAGAGAACCCCTTTGGG 0: 1
1: 0
2: 1
3: 14
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914829386 Original CRISPR TGGGCTGTGCCTCCTTTCCT TGG (reversed) Exonic