ID: 914829387

View in Genome Browser
Species Human (GRCh38)
Location 1:151159587-151159609
Sequence CACAGCCCAGAGAACCCCTT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 3, 3: 24, 4: 173}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914829386_914829387 -9 Left 914829386 1:151159573-151159595 CCAAGGAAAGGAGGCACAGCCCA 0: 1
1: 0
2: 4
3: 26
4: 321
Right 914829387 1:151159587-151159609 CACAGCCCAGAGAACCCCTTTGG 0: 1
1: 0
2: 3
3: 24
4: 173
914829381_914829387 4 Left 914829381 1:151159560-151159582 CCTCCCATGTGAACCAAGGAAAG 0: 1
1: 0
2: 0
3: 13
4: 131
Right 914829387 1:151159587-151159609 CACAGCCCAGAGAACCCCTTTGG 0: 1
1: 0
2: 3
3: 24
4: 173
914829380_914829387 5 Left 914829380 1:151159559-151159581 CCCTCCCATGTGAACCAAGGAAA 0: 1
1: 0
2: 1
3: 15
4: 153
Right 914829387 1:151159587-151159609 CACAGCCCAGAGAACCCCTTTGG 0: 1
1: 0
2: 3
3: 24
4: 173
914829379_914829387 6 Left 914829379 1:151159558-151159580 CCCCTCCCATGTGAACCAAGGAA 0: 1
1: 0
2: 1
3: 14
4: 143
Right 914829387 1:151159587-151159609 CACAGCCCAGAGAACCCCTTTGG 0: 1
1: 0
2: 3
3: 24
4: 173
914829378_914829387 7 Left 914829378 1:151159557-151159579 CCCCCTCCCATGTGAACCAAGGA 0: 1
1: 1
2: 0
3: 9
4: 177
Right 914829387 1:151159587-151159609 CACAGCCCAGAGAACCCCTTTGG 0: 1
1: 0
2: 3
3: 24
4: 173
914829383_914829387 1 Left 914829383 1:151159563-151159585 CCCATGTGAACCAAGGAAAGGAG 0: 1
1: 0
2: 4
3: 21
4: 200
Right 914829387 1:151159587-151159609 CACAGCCCAGAGAACCCCTTTGG 0: 1
1: 0
2: 3
3: 24
4: 173
914829384_914829387 0 Left 914829384 1:151159564-151159586 CCATGTGAACCAAGGAAAGGAGG 0: 1
1: 0
2: 3
3: 32
4: 295
Right 914829387 1:151159587-151159609 CACAGCCCAGAGAACCCCTTTGG 0: 1
1: 0
2: 3
3: 24
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914829387 Original CRISPR CACAGCCCAGAGAACCCCTT TGG Exonic