ID: 914829391

View in Genome Browser
Species Human (GRCh38)
Location 1:151159593-151159615
Sequence GTATCCCCAAAGGGGTTCTC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 82}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914829391_914829397 -6 Left 914829391 1:151159593-151159615 CCAGAGAACCCCTTTGGGGATAC 0: 1
1: 0
2: 0
3: 6
4: 82
Right 914829397 1:151159610-151159632 GGATACTAAAGACAGAAGAGGGG 0: 1
1: 1
2: 0
3: 20
4: 318
914829391_914829399 1 Left 914829391 1:151159593-151159615 CCAGAGAACCCCTTTGGGGATAC 0: 1
1: 0
2: 0
3: 6
4: 82
Right 914829399 1:151159617-151159639 AAAGACAGAAGAGGGGAAGGTGG 0: 1
1: 1
2: 27
3: 260
4: 2103
914829391_914829396 -7 Left 914829391 1:151159593-151159615 CCAGAGAACCCCTTTGGGGATAC 0: 1
1: 0
2: 0
3: 6
4: 82
Right 914829396 1:151159609-151159631 GGGATACTAAAGACAGAAGAGGG 0: 1
1: 0
2: 0
3: 21
4: 270
914829391_914829400 21 Left 914829391 1:151159593-151159615 CCAGAGAACCCCTTTGGGGATAC 0: 1
1: 0
2: 0
3: 6
4: 82
Right 914829400 1:151159637-151159659 TGGCCCTTAGAGACAGAGCTTGG 0: 1
1: 0
2: 1
3: 18
4: 225
914829391_914829395 -8 Left 914829391 1:151159593-151159615 CCAGAGAACCCCTTTGGGGATAC 0: 1
1: 0
2: 0
3: 6
4: 82
Right 914829395 1:151159608-151159630 GGGGATACTAAAGACAGAAGAGG 0: 1
1: 0
2: 3
3: 19
4: 252
914829391_914829398 -2 Left 914829391 1:151159593-151159615 CCAGAGAACCCCTTTGGGGATAC 0: 1
1: 0
2: 0
3: 6
4: 82
Right 914829398 1:151159614-151159636 ACTAAAGACAGAAGAGGGGAAGG 0: 1
1: 1
2: 4
3: 64
4: 626

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914829391 Original CRISPR GTATCCCCAAAGGGGTTCTC TGG (reversed) Exonic