ID: 914829397

View in Genome Browser
Species Human (GRCh38)
Location 1:151159610-151159632
Sequence GGATACTAAAGACAGAAGAG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 340
Summary {0: 1, 1: 1, 2: 0, 3: 20, 4: 318}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914829386_914829397 14 Left 914829386 1:151159573-151159595 CCAAGGAAAGGAGGCACAGCCCA 0: 1
1: 0
2: 4
3: 26
4: 321
Right 914829397 1:151159610-151159632 GGATACTAAAGACAGAAGAGGGG 0: 1
1: 1
2: 0
3: 20
4: 318
914829378_914829397 30 Left 914829378 1:151159557-151159579 CCCCCTCCCATGTGAACCAAGGA 0: 1
1: 1
2: 0
3: 9
4: 177
Right 914829397 1:151159610-151159632 GGATACTAAAGACAGAAGAGGGG 0: 1
1: 1
2: 0
3: 20
4: 318
914829390_914829397 -5 Left 914829390 1:151159592-151159614 CCCAGAGAACCCCTTTGGGGATA 0: 1
1: 0
2: 0
3: 6
4: 100
Right 914829397 1:151159610-151159632 GGATACTAAAGACAGAAGAGGGG 0: 1
1: 1
2: 0
3: 20
4: 318
914829384_914829397 23 Left 914829384 1:151159564-151159586 CCATGTGAACCAAGGAAAGGAGG 0: 1
1: 0
2: 3
3: 32
4: 295
Right 914829397 1:151159610-151159632 GGATACTAAAGACAGAAGAGGGG 0: 1
1: 1
2: 0
3: 20
4: 318
914829380_914829397 28 Left 914829380 1:151159559-151159581 CCCTCCCATGTGAACCAAGGAAA 0: 1
1: 0
2: 1
3: 15
4: 153
Right 914829397 1:151159610-151159632 GGATACTAAAGACAGAAGAGGGG 0: 1
1: 1
2: 0
3: 20
4: 318
914829381_914829397 27 Left 914829381 1:151159560-151159582 CCTCCCATGTGAACCAAGGAAAG 0: 1
1: 0
2: 0
3: 13
4: 131
Right 914829397 1:151159610-151159632 GGATACTAAAGACAGAAGAGGGG 0: 1
1: 1
2: 0
3: 20
4: 318
914829391_914829397 -6 Left 914829391 1:151159593-151159615 CCAGAGAACCCCTTTGGGGATAC 0: 1
1: 0
2: 0
3: 6
4: 82
Right 914829397 1:151159610-151159632 GGATACTAAAGACAGAAGAGGGG 0: 1
1: 1
2: 0
3: 20
4: 318
914829383_914829397 24 Left 914829383 1:151159563-151159585 CCCATGTGAACCAAGGAAAGGAG 0: 1
1: 0
2: 4
3: 21
4: 200
Right 914829397 1:151159610-151159632 GGATACTAAAGACAGAAGAGGGG 0: 1
1: 1
2: 0
3: 20
4: 318
914829379_914829397 29 Left 914829379 1:151159558-151159580 CCCCTCCCATGTGAACCAAGGAA 0: 1
1: 0
2: 1
3: 14
4: 143
Right 914829397 1:151159610-151159632 GGATACTAAAGACAGAAGAGGGG 0: 1
1: 1
2: 0
3: 20
4: 318

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914829397 Original CRISPR GGATACTAAAGACAGAAGAG GGG Exonic