ID: 914829398

View in Genome Browser
Species Human (GRCh38)
Location 1:151159614-151159636
Sequence ACTAAAGACAGAAGAGGGGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 696
Summary {0: 1, 1: 1, 2: 4, 3: 64, 4: 626}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914829390_914829398 -1 Left 914829390 1:151159592-151159614 CCCAGAGAACCCCTTTGGGGATA 0: 1
1: 0
2: 0
3: 6
4: 100
Right 914829398 1:151159614-151159636 ACTAAAGACAGAAGAGGGGAAGG 0: 1
1: 1
2: 4
3: 64
4: 626
914829391_914829398 -2 Left 914829391 1:151159593-151159615 CCAGAGAACCCCTTTGGGGATAC 0: 1
1: 0
2: 0
3: 6
4: 82
Right 914829398 1:151159614-151159636 ACTAAAGACAGAAGAGGGGAAGG 0: 1
1: 1
2: 4
3: 64
4: 626
914829386_914829398 18 Left 914829386 1:151159573-151159595 CCAAGGAAAGGAGGCACAGCCCA 0: 1
1: 0
2: 4
3: 26
4: 321
Right 914829398 1:151159614-151159636 ACTAAAGACAGAAGAGGGGAAGG 0: 1
1: 1
2: 4
3: 64
4: 626
914829383_914829398 28 Left 914829383 1:151159563-151159585 CCCATGTGAACCAAGGAAAGGAG 0: 1
1: 0
2: 4
3: 21
4: 200
Right 914829398 1:151159614-151159636 ACTAAAGACAGAAGAGGGGAAGG 0: 1
1: 1
2: 4
3: 64
4: 626
914829384_914829398 27 Left 914829384 1:151159564-151159586 CCATGTGAACCAAGGAAAGGAGG 0: 1
1: 0
2: 3
3: 32
4: 295
Right 914829398 1:151159614-151159636 ACTAAAGACAGAAGAGGGGAAGG 0: 1
1: 1
2: 4
3: 64
4: 626
914829392_914829398 -10 Left 914829392 1:151159601-151159623 CCCCTTTGGGGATACTAAAGACA 0: 1
1: 0
2: 0
3: 13
4: 119
Right 914829398 1:151159614-151159636 ACTAAAGACAGAAGAGGGGAAGG 0: 1
1: 1
2: 4
3: 64
4: 626

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914829398 Original CRISPR ACTAAAGACAGAAGAGGGGA AGG Exonic