ID: 914829400

View in Genome Browser
Species Human (GRCh38)
Location 1:151159637-151159659
Sequence TGGCCCTTAGAGACAGAGCT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 245
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 225}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914829393_914829400 12 Left 914829393 1:151159602-151159624 CCCTTTGGGGATACTAAAGACAG 0: 1
1: 0
2: 1
3: 24
4: 1098
Right 914829400 1:151159637-151159659 TGGCCCTTAGAGACAGAGCTTGG 0: 1
1: 0
2: 1
3: 18
4: 225
914829394_914829400 11 Left 914829394 1:151159603-151159625 CCTTTGGGGATACTAAAGACAGA 0: 1
1: 0
2: 4
3: 18
4: 189
Right 914829400 1:151159637-151159659 TGGCCCTTAGAGACAGAGCTTGG 0: 1
1: 0
2: 1
3: 18
4: 225
914829392_914829400 13 Left 914829392 1:151159601-151159623 CCCCTTTGGGGATACTAAAGACA 0: 1
1: 0
2: 0
3: 13
4: 119
Right 914829400 1:151159637-151159659 TGGCCCTTAGAGACAGAGCTTGG 0: 1
1: 0
2: 1
3: 18
4: 225
914829391_914829400 21 Left 914829391 1:151159593-151159615 CCAGAGAACCCCTTTGGGGATAC 0: 1
1: 0
2: 0
3: 6
4: 82
Right 914829400 1:151159637-151159659 TGGCCCTTAGAGACAGAGCTTGG 0: 1
1: 0
2: 1
3: 18
4: 225
914829390_914829400 22 Left 914829390 1:151159592-151159614 CCCAGAGAACCCCTTTGGGGATA 0: 1
1: 0
2: 0
3: 6
4: 100
Right 914829400 1:151159637-151159659 TGGCCCTTAGAGACAGAGCTTGG 0: 1
1: 0
2: 1
3: 18
4: 225

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914829400 Original CRISPR TGGCCCTTAGAGACAGAGCT TGG Exonic