ID: 914830180

View in Genome Browser
Species Human (GRCh38)
Location 1:151165431-151165453
Sequence TTGTGGATAAGTAGCTTGGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 106}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914830180 Original CRISPR TTGTGGATAAGTAGCTTGGA GGG (reversed) Exonic
903020728 1:20391997-20392019 TTCTGGATAAGTAACCTGTAGGG - Intergenic
904479557 1:30785445-30785467 TGGTGGAGAAGAGGCTTGGAAGG - Intergenic
905546323 1:38803019-38803041 GTGGGGATAAGGAGCTTGCAGGG + Intergenic
913501743 1:119478131-119478153 TGGTGAATAAGGAGCTGGGAAGG - Intergenic
913513499 1:119583257-119583279 TGGTGAATAAGGAGCTGGGAAGG - Intergenic
913517125 1:119614200-119614222 TGGTGAATAAGGAGCTGGGAAGG - Intergenic
914830180 1:151165431-151165453 TTGTGGATAAGTAGCTTGGAGGG - Exonic
918852935 1:189715877-189715899 TAGTGAATAATTAGCTTGCAGGG - Intergenic
920772999 1:208907301-208907323 TTGTGTAGAAGCAGCTGGGAAGG + Intergenic
924245763 1:242082900-242082922 TCGTTTTTAAGTAGCTTGGAAGG - Intergenic
1064868441 10:19908987-19909009 TAGTGTATAAGTTCCTTGGACGG - Intronic
1071401900 10:85280952-85280974 TTGTGAATAAGTAAGTTTGATGG + Intergenic
1071747763 10:88441313-88441335 TTGTGTATACGTAGGTGGGAAGG - Intronic
1073833465 10:107413660-107413682 TTTGGGATAAAGAGCTTGGAGGG + Intergenic
1080960415 11:37151375-37151397 TTGTGTGTCAGTAACTTGGATGG - Intergenic
1083030864 11:59590823-59590845 TTTTGGCTCAGTGGCTTGGAAGG - Intronic
1085796802 11:79548877-79548899 TTGTGGATCAGTTGATTTGAGGG + Intergenic
1088682709 11:112257753-112257775 CTGTGTATAAGTGGCTTGGCAGG - Intronic
1090680186 11:129047418-129047440 GTGGGGATAAGTACCTTGGGGGG - Intronic
1092380680 12:7994356-7994378 TTGTGTTTAAGTAGCTTCCAGGG - Intergenic
1092489135 12:8929377-8929399 CTGTGGATAAGGAGGTAGGAAGG - Intronic
1092609891 12:10160912-10160934 TTGCGGACAAGGAGCTGGGAAGG + Exonic
1098771104 12:74554003-74554025 ATGTGGATAAGTAGGTTGCGTGG + Intergenic
1098816748 12:75175274-75175296 TTTGGGATAAGAAGCTTGAAAGG - Intronic
1098939281 12:76516340-76516362 TTGTGGAGAAGAGGCTAGGAAGG - Intronic
1099960397 12:89391614-89391636 TTCTGGGTAAGTGGTTTGGATGG - Intergenic
1102435817 12:112922392-112922414 TAGTGGATGAGTATCTTGAAAGG - Intronic
1109982882 13:69933670-69933692 TTGTTCATAAGTAGCTTTGAAGG - Intronic
1115406327 14:33021117-33021139 TTGTTGATAAGTGGCTTGAAGGG + Intronic
1118907094 14:70031066-70031088 TTGTGGATAATTTGCTCCGAGGG - Intronic
1121885104 14:97535631-97535653 TTGTGAACAAGGAGCCTGGAGGG + Intergenic
1122847621 14:104509337-104509359 CTTTGGATAAATAGCTAGGAGGG - Intronic
1125112834 15:36053448-36053470 GTGTGGATAAATTGTTTGGAAGG + Intergenic
1130144071 15:81259304-81259326 ATGTGGATAGGGAGCCTGGAAGG - Intronic
1135476747 16:22783442-22783464 TTGTGGATAAGTTGCCTTGGAGG + Intergenic
1135704788 16:24665814-24665836 TTGTGGAAAATTTGCTTGCAGGG + Intergenic
1135818782 16:25660455-25660477 TTGTGGAGTAGGAGGTTGGAAGG - Intergenic
1137262206 16:46840766-46840788 CTGTGGAGAAGTACGTTGGATGG - Intergenic
1137966780 16:52942496-52942518 TTGAGGGTAAGTCTCTTGGAGGG - Intergenic
1137999283 16:53257577-53257599 TTTTGCTTAAGTAGCTAGGAGGG + Intronic
1145252539 17:21304434-21304456 TTGTTGATAAGGACATTGGAGGG - Exonic
1148663111 17:49352623-49352645 TTGTGGGTAAATACCTAGGAGGG - Intronic
1150415644 17:64986336-64986358 TTGTGGGAAAGAAGCTTTGAGGG - Intergenic
1152449309 17:80366246-80366268 TTTTGGATATGTACCTTGAAGGG + Intronic
1153742465 18:8143050-8143072 TTGTGAATAAATTGCTTAGAAGG + Intronic
1155589023 18:27403433-27403455 TTGTGTATAAGTAGGGTGAAGGG - Intergenic
1155713001 18:28905660-28905682 TTGTGGTTAGGCAGCTAGGATGG + Intergenic
1164310665 19:24042917-24042939 TTATGAATGAGTATCTTGGAGGG + Intronic
1168431256 19:56282698-56282720 TTCTGGACAAGTGGCTTTGAGGG - Intronic
930876740 2:56227416-56227438 TTGTGGAAAAATAGCCTGGAGGG + Intronic
932586446 2:73032691-73032713 GTTTGGAGAAGCAGCTTGGAAGG - Intronic
936228468 2:110679328-110679350 TGGTGGAGAAGAAGCTGGGAGGG - Intergenic
937668265 2:124511832-124511854 TTGTGGATGAGTTGCTTGCATGG + Intronic
943095792 2:183427945-183427967 TTGTGGACAAGTGCCCTGGATGG - Intergenic
944016680 2:195048626-195048648 TTTTGGCTAAATAGCTGGGAAGG - Intergenic
945324573 2:208467612-208467634 TTGTGGCTAAGTAGCTTTATTGG + Intronic
948578911 2:238971065-238971087 TTGTGGATAACTAGCGGGGGTGG - Intergenic
1172514417 20:35523161-35523183 TTCTGGAAAAGTTGCTGGGATGG + Intergenic
1173185156 20:40834774-40834796 TTGTGAATCAGGAACTTGGATGG - Intergenic
1174209153 20:48863442-48863464 TTGTGGAGAAGGAGCGGGGAGGG - Intergenic
1184745124 22:46451650-46451672 TTGTGGAGAAGGAGGTTGTAGGG - Intronic
950825059 3:15809964-15809986 TTGTGGATGAGGAGGTGGGAGGG - Intronic
957870946 3:86090054-86090076 ATGGGGATAAGTAACTTGGTGGG - Intergenic
963194122 3:142507412-142507434 TTGTGGAGGAGGAGTTTGGAAGG - Intronic
966642378 3:182205132-182205154 TTGATGACAAGTGGCTTGGATGG - Intergenic
971470585 4:27021664-27021686 GTGTAGAGAAGTAGCTGGGAGGG + Intronic
973142509 4:46786155-46786177 TTATGACTAAGTAGCTTGGTTGG - Intronic
973194742 4:47426808-47426830 TTGAGAATAAGGAGCTTGGAAGG + Intergenic
974210809 4:58772948-58772970 TTGTTAATAAGTAGCTTTAAAGG + Intergenic
978803426 4:112776393-112776415 TGGTGGAAAAGTAACTAGGAAGG + Intergenic
982030639 4:151297234-151297256 TTGAGGATAATTATCCTGGAAGG - Intronic
984518981 4:180777350-180777372 TTGTGGAGAAGCTGCTTAGAAGG + Intergenic
987960595 5:24803576-24803598 TTGAGGGTAAGGAACTTGGAAGG + Intergenic
988528251 5:32005043-32005065 ATGTGGATGAGGACCTTGGATGG - Intronic
993511553 5:88777370-88777392 TTGTGGAAGAGTAGCTTGTGAGG - Intronic
995006150 5:107198293-107198315 TAGTGGAGAAATGGCTTGGAAGG + Intergenic
996163867 5:120200727-120200749 TTGGGGGTAAGTAGCTTTGACGG + Intergenic
996582750 5:125049454-125049476 TTGTGGAAAAGTTGCTTAGATGG + Intergenic
997699673 5:135888218-135888240 TTGGGGATCAGAACCTTGGAGGG - Exonic
1005068546 6:21842849-21842871 TTGTAAATATGTAGGTTGGATGG + Intergenic
1007743214 6:44025321-44025343 TTGTGGATACGCAGCCTGGGAGG + Intergenic
1008773046 6:55002667-55002689 TTGGGGATAAATAGGTTTGAGGG - Intergenic
1011876561 6:91969346-91969368 TTGTGGAAAAGTTACTTGGAGGG + Intergenic
1012929680 6:105303801-105303823 TAGTTGATAATTAGCTTGCAAGG - Intronic
1015296169 6:131595803-131595825 TTGAGGATAAGTACTATGGATGG - Intronic
1017219833 6:151953189-151953211 TTGGGGATAAATAGCTTCCAGGG - Intronic
1018418578 6:163622373-163622395 TTGTGTATAAGTAACTGGTAAGG - Intergenic
1018449523 6:163894142-163894164 TCCTGGATAAATAGCTTGAATGG + Intergenic
1020655001 7:10918360-10918382 TTGTGGAAAAGTGGCTGGGGAGG - Intergenic
1020757589 7:12222977-12222999 TTTTGTATAAGTAGATTGTAAGG + Intronic
1021406343 7:20271530-20271552 TTGAGAATAAGAGGCTTGGAAGG + Intergenic
1022987611 7:35674232-35674254 TAATGGTTAAGTATCTTGGAAGG - Intronic
1027758843 7:82251788-82251810 TAGTGGTTACATAGCTTGGAAGG + Intronic
1028476637 7:91261012-91261034 ATGTGGATAATTAGCAGGGATGG - Intergenic
1029262312 7:99311680-99311702 ATGTGGAGCATTAGCTTGGATGG - Intergenic
1030330155 7:108262080-108262102 TTGTGCATAAGTAGCTTGTTTGG - Intronic
1033021895 7:137733901-137733923 TAATGGAGAAGTAGATTGGAGGG - Intronic
1035455344 7:159005390-159005412 TAGTGGAGATGAAGCTTGGAGGG - Intergenic
1041421476 8:57671717-57671739 GGGTGGAGAAGCAGCTTGGAGGG + Intergenic
1041847585 8:62349198-62349220 TTGTGGCACAGTTGCTTGGAGGG + Intronic
1042508704 8:69589225-69589247 TTGTGGATACGCAGGGTGGAAGG - Intronic
1042537598 8:69874231-69874253 TAGGGGATAACTCGCTTGGATGG - Intergenic
1043427777 8:80165679-80165701 TTGTGGAAAAGTAACTAGGAAGG - Intronic
1043996063 8:86817972-86817994 ATGTGGATAAGAAGCAGGGAAGG + Intergenic
1044031877 8:87248557-87248579 ATGTGGAGAAGCAGCTTTGAAGG + Intronic
1045051473 8:98331033-98331055 TTGTGGATAAGTAATTTAAATGG - Intergenic
1050470310 9:5981573-5981595 TTGATGATAAATAGATTGGATGG - Intronic
1053157289 9:35790562-35790584 TTCTGGAGAAATAGCTTGAAGGG + Intergenic
1055431634 9:76249932-76249954 TGGTGGATAAGTAAATAGGAAGG + Intronic
1061440320 9:130598667-130598689 TTTTGGATAAGTAGTTTAAATGG + Intronic
1186180762 X:6970693-6970715 TTATGGATAAAAAGCTTGGCTGG - Intergenic
1186667421 X:11732111-11732133 TTGTGGATAAATAGGCTTGACGG + Intergenic
1187066759 X:15847956-15847978 CTGTGGATAAGGAGCGAGGATGG - Intronic
1190599942 X:52080741-52080763 TTTTTGATGAGTAGCTTGGCTGG - Intergenic
1191724328 X:64263183-64263205 TTGTGGAGAAGGAGGTGGGAAGG - Intergenic
1196580590 X:117374673-117374695 TTGTGGACAGGTAGATTGGGGGG - Intergenic
1196692057 X:118570493-118570515 TTGTAGATAAATAGATTGAAAGG + Intronic