ID: 914830381

View in Genome Browser
Species Human (GRCh38)
Location 1:151166675-151166697
Sequence AATCGCGACGCTGAGGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 351
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 339}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914830381_914830386 11 Left 914830381 1:151166675-151166697 CCTGCCTCCTCAGCGTCGCGATT 0: 1
1: 0
2: 0
3: 11
4: 339
Right 914830386 1:151166709-151166731 CAAGCGCATGCCACCACGCCTGG 0: 27
1: 825
2: 9933
3: 46062
4: 107964

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914830381 Original CRISPR AATCGCGACGCTGAGGAGGC AGG (reversed) Intronic
900024619 1:260178-260200 AATCAGGAGGCTGAGGAGGGAGG + Intergenic
900028227 1:349583-349605 AATCAGGAGGCTGAGGAGGGAGG + Intergenic
900571190 1:3359146-3359168 ACTCGGGAGGCTGAGGAGGGAGG - Intronic
900635319 1:3661948-3661970 ACTCGGGAGGCTGAGGTGGCAGG + Intronic
900773371 1:4563407-4563429 ACTCGGGAGGCTGAGGAGGGAGG - Intergenic
901368825 1:8778725-8778747 ACTCGGGAGGCTGAGGAGGGAGG + Intronic
901592480 1:10356986-10357008 ATTCGGGAGGCTGAGGAGGGAGG - Intronic
902247615 1:15131622-15131644 ACTCGGGAGGCTGAGGCGGCAGG - Intergenic
902772999 1:18656881-18656903 ACTCGGGAGGCTGAGGAGGGAGG + Intronic
903902201 1:26655681-26655703 ACTCGAGAGGCTGAGGAGGGAGG + Intergenic
904214632 1:28909689-28909711 ACTCAGGAGGCTGAGGAGGCAGG + Intronic
905057145 1:35105712-35105734 ACTCGGGACGCTGAGGTGGGAGG - Intronic
905574817 1:39035567-39035589 ACTCGCGAGGCTGAGGAGGAAGG - Intergenic
906331911 1:44892469-44892491 ACTCGGGAGGCTGAGGAGGGAGG + Intronic
906454299 1:45980641-45980663 AATCGGGAGGCTGAGGTGGGAGG - Intronic
908142918 1:61206022-61206044 ACTCGGGAGGCTGAGGAGGGAGG - Intronic
909707618 1:78605908-78605930 CTTCGGGAGGCTGAGGAGGCTGG + Intergenic
909912020 1:81272130-81272152 ACTCGCGAGGCTGAGGTGGAAGG + Intergenic
910882555 1:91935307-91935329 ACTCGGGAGGCTGAGGAGGGAGG + Intergenic
910900220 1:92112293-92112315 AATCGGGAGGCTGAGGTGGGAGG + Intronic
911168859 1:94749727-94749749 CTTCGGGAGGCTGAGGAGGCAGG + Intergenic
912305070 1:108559391-108559413 ACTCGGGAGGCTGAGGAGGGAGG - Intergenic
912891027 1:113530805-113530827 ACTCGCGAAGCTGAGGTGGGAGG + Intronic
913555288 1:119960780-119960802 AATCGGGAGGCTGAGGTGGGGGG - Intronic
914804074 1:150979979-150980001 AATCCCGACTCTGAGAAGTCTGG + Intergenic
914830381 1:151166675-151166697 AATCGCGACGCTGAGGAGGCAGG - Intronic
916150678 1:161786082-161786104 ACTCGGGAGGCTGAGGAGGCAGG - Intronic
918120284 1:181532110-181532132 GATCAGGACTCTGAGGAGGCTGG + Intronic
918282280 1:183018928-183018950 ACTCGGGAGGCTGAGGAGGGAGG + Intergenic
919352431 1:196475369-196475391 CTTCGGGAGGCTGAGGAGGCAGG + Intronic
920664171 1:207948085-207948107 ACTCGGGAGGCTGAGGAGGGAGG + Intergenic
921705465 1:218317842-218317864 ACTCGCGAGGCTGAGGAGGGAGG - Intronic
922111770 1:222565751-222565773 ACTCGGGAGGCTGAGGTGGCAGG + Intronic
922474243 1:225896044-225896066 ACTCGGGAGGCTGAGGTGGCAGG + Intronic
922803465 1:228374301-228374323 AATGTCGGCGCTGAGGAGGGAGG - Exonic
922932046 1:229397457-229397479 ACTCGGGAGGCTGAGGAGGGAGG - Intergenic
923818228 1:237404143-237404165 AATCGGGAGGCTGAGGTGGGAGG + Intronic
924464731 1:244289960-244289982 ACTCGGGAGGCTGAGGAGGGAGG - Intergenic
924480055 1:244421863-244421885 ACTCGGGAGGCTGAGGAGGGAGG + Intronic
1062872537 10:918523-918545 ACTCGGGAGGCTGAGGAGGGAGG + Intronic
1064052412 10:12069629-12069651 ACTCGGGACGCTGAGGTGGAAGG - Intronic
1064200738 10:13282899-13282921 AATCCTGACCCTGATGAGGCTGG + Intronic
1064412044 10:15113958-15113980 AATCGTGCGGCTGAAGAGGCTGG + Intronic
1065223020 10:23515240-23515262 ACTCGGGAGGCTGAGGAGGAAGG - Intergenic
1065714320 10:28550055-28550077 ACTCGGGAGGCTGATGAGGCAGG + Intronic
1068989439 10:63135076-63135098 ACTCGGGAGGCTGAGGTGGCAGG + Intronic
1069405190 10:68091501-68091523 AATCGAGAGGCTGAGGTGGGAGG - Intergenic
1069931864 10:71888276-71888298 ATTCGGGAAGCTGAGGAGGGAGG + Intergenic
1070013050 10:72496073-72496095 AATTGCGAGGCTGAGGTGGGAGG - Intronic
1070220078 10:74432083-74432105 ACTCGAGACGCTGAGGTGGGAGG + Intronic
1070248080 10:74750338-74750360 ACTCGGGAAGCTGAGGAGGGAGG + Intergenic
1070301773 10:75209510-75209532 AATTGGGAGGCTGAGGAGGGAGG - Intergenic
1070342580 10:75511224-75511246 ACTCGCGAGGCTGAGGTGGGAGG + Intronic
1071133117 10:82418707-82418729 ACTCAGGAGGCTGAGGAGGCAGG - Intronic
1071540482 10:86478318-86478340 ACTCGAGACGCTGAGGTGGGAGG + Intronic
1072157480 10:92737050-92737072 ACTCAAGAGGCTGAGGAGGCAGG + Intergenic
1073040984 10:100605327-100605349 ACTCGGGAGGCTGAGGTGGCAGG + Intergenic
1074050694 10:109878765-109878787 AATCGGGAGGCTGAGGTGGGAGG + Intronic
1074173897 10:110976418-110976440 ACTCGGGAGGCTGAGGAGGAAGG - Intronic
1076787621 10:132758871-132758893 AAACCCGACGCTCAGGAGACAGG - Intronic
1076962420 10:133775309-133775331 AATCAGGAGGCTGAGGAGGGAGG - Intergenic
1077327738 11:1971004-1971026 GATCGGGATGCTCAGGAGGCTGG - Intronic
1077662261 11:4080135-4080157 ACTCGGGAGGCTGAGGAGGGAGG + Intronic
1077897226 11:6462514-6462536 AATCGGGAGGCTGAGGTGGGAGG - Intronic
1078228922 11:9421068-9421090 ACTCGGGAGGCTGATGAGGCAGG - Intronic
1082042036 11:47694087-47694109 ACTCGGGATGCTGAGGCGGCAGG + Intronic
1082863434 11:57876541-57876563 ATTCAAGACGGTGAGGAGGCAGG - Intergenic
1088152876 11:106768229-106768251 ACTCGAGAAGCTGAGGAGGGAGG - Intronic
1089537353 11:119168931-119168953 AAGCGCCACGCCGAGGAGCCGGG + Exonic
1090633433 11:128670558-128670580 ATTCGAGAGGCTGAGGAGGGAGG + Intergenic
1202810720 11_KI270721v1_random:26184-26206 GATCGGGATGCTCAGGAGGCTGG - Intergenic
1093981794 12:25483313-25483335 ACTCGGGAGGCTGAGGAGGGAGG + Intronic
1100044380 12:90360779-90360801 ACTCGGGAGGCTGAGGAGGAGGG + Intergenic
1100454364 12:94737946-94737968 ACTCGGGAGGCTGAGGAGGGAGG - Intergenic
1100595479 12:96068241-96068263 ACTCGGGAGGCTGAGGAGGGAGG - Intergenic
1100969588 12:100053294-100053316 ATTCAGGAGGCTGAGGAGGCAGG + Intronic
1101746123 12:107543225-107543247 ACTCAAGAGGCTGAGGAGGCAGG + Intronic
1102949670 12:117022544-117022566 ATTCGGGACGCTGAGGTGGGAGG + Intronic
1104595574 12:130118084-130118106 ACTCGGGAGGCTGAGGAGGGAGG - Intergenic
1105544231 13:21340113-21340135 AACGGGGACGCTGAGGAGGTGGG - Intergenic
1107936037 13:45346100-45346122 ACTCGGGAGGCTGAGGAGGGAGG - Intergenic
1110857081 13:80308850-80308872 ACTCGGGAGGCTGAGGTGGCAGG - Intergenic
1111382620 13:87478532-87478554 ACTCGAGACGCTGAGGCGGGAGG + Intergenic
1112497234 13:99914950-99914972 ACTCGGGAGGCTGAGGAGGGAGG - Intergenic
1113493823 13:110713143-110713165 AATCACGATGAAGAGGAGGCGGG - Intronic
1113988929 13:114343218-114343240 AATCAGGAGGCTGAGGAGGGAGG - Intergenic
1115241478 14:31254563-31254585 AATTGGGAGGCTGAGGAGGGAGG - Intergenic
1115467997 14:33737232-33737254 AAAGGTCACGCTGAGGAGGCGGG + Intronic
1115749074 14:36470153-36470175 ACTCGGGAGGCTGAGGAGGGAGG - Intergenic
1118218329 14:63830550-63830572 ACTCGTGAGGCTGAGGAGGGAGG + Intergenic
1120200290 14:81531661-81531683 ACTCGGGAGGCTGAGGTGGCAGG - Intronic
1121558563 14:94857216-94857238 AATGGCGACACTGAGTAGACAGG - Intergenic
1122555729 14:102578838-102578860 ACTCGGGAAGCTGAGGAGGGAGG + Intergenic
1123043153 14:105498811-105498833 GATCAGGACGCTGAGGAGCCAGG + Exonic
1124243233 15:28048895-28048917 ATTTGAGACGCTGAGGAGGATGG + Intronic
1125582539 15:40796861-40796883 ACTCGGGAGGCTGAGGAGGGAGG - Intronic
1125739064 15:41948917-41948939 AATCGGGAAGCTGAGGTGGGAGG + Intronic
1127466193 15:59247085-59247107 ACTCGCGAGGCTGAGGTGGGAGG + Intronic
1129561687 15:76577336-76577358 ACTCAGGAGGCTGAGGAGGCAGG + Intronic
1131161247 15:90106387-90106409 ACTCGGGAAGCTGAGGAGGGAGG - Intergenic
1131443214 15:92474332-92474354 AGTCAGGAAGCTGAGGAGGCAGG - Intronic
1131516368 15:93080305-93080327 ACTCGGGAGGCTGAGGAGGAAGG - Intronic
1131791761 15:95972998-95973020 AAGTGCGACGGAGAGGAGGCAGG + Intergenic
1132560114 16:589762-589784 AATGGCGACGGCGATGAGGCAGG + Intronic
1132590087 16:722755-722777 AATCCTGAGGCTGAGGAAGCTGG - Exonic
1132633366 16:930450-930472 AATCGGGAGGCTGAGGCGGGAGG + Intronic
1134073865 16:11277075-11277097 ACTCGGGAGGCTGAGGTGGCAGG - Intronic
1134619482 16:15676770-15676792 ACTCGCGAGGCTGAGGTGGGAGG - Intronic
1134668228 16:16035597-16035619 ACTCGGGAGGCTGAGGTGGCAGG - Intronic
1135592433 16:23713806-23713828 ACTCGCGAGGCTGAGGTGGGAGG + Intergenic
1136381075 16:29896069-29896091 ACTCGGGAGGCTGAGGAGGGAGG - Intronic
1137293519 16:47068548-47068570 ACTCGGGAGGCTGAGGTGGCGGG + Intergenic
1137293533 16:47068614-47068636 ACTCGGGAGGCTGAGGTGGCGGG + Intergenic
1137638769 16:50010195-50010217 ACTCGGGAGGCTGAGGAGGGAGG + Intergenic
1137878099 16:52016978-52017000 ACTCGGGAGGCTAAGGAGGCAGG - Intronic
1137989571 16:53139988-53140010 ACTCGAGAGGCTGAGGTGGCAGG + Intronic
1139913466 16:70413305-70413327 ACTCGGGAAGCTGAGGGGGCAGG + Intronic
1140080116 16:71738157-71738179 ACTCGGGAGGCTGATGAGGCAGG - Intronic
1141596463 16:85100006-85100028 AAATGGGAGGCTGAGGAGGCAGG - Intronic
1141598698 16:85112556-85112578 CAACGCGAGGCTGGGGAGGCCGG - Intergenic
1141749651 16:85949721-85949743 AATTGGGAGGCTGAGGTGGCAGG + Intergenic
1142184446 16:88687802-88687824 ACTCAGGACGCTGAGGAGGGAGG + Intergenic
1142384600 16:89755320-89755342 ACTCGGGAGGCTGAGGCGGCAGG - Intronic
1143343802 17:6234555-6234577 ACTCGGGAGGCTGAGGTGGCAGG - Intergenic
1143616154 17:8051064-8051086 ATTCGGGAGGCTGAGGAGGGAGG + Intergenic
1143850488 17:9807946-9807968 ACTCGGGAGGCTGAGGAGGGAGG + Intronic
1144026287 17:11278865-11278887 AATGGGGCCTCTGAGGAGGCGGG + Intronic
1144446403 17:15333869-15333891 ACTCGGGAGGCTGAGGAGGCAGG - Intronic
1144940719 17:18938175-18938197 ACTCGGGAGGCTGAGGAGGGAGG - Intergenic
1146367485 17:32240182-32240204 ACTCGGGAGGCTGAGGAGGCAGG + Intronic
1147888746 17:43702334-43702356 ACTCGGGAGGCTGAGGTGGCAGG - Intergenic
1148290769 17:46446648-46446670 ACTCGGGAGGCTGAGGCGGCAGG + Intergenic
1148312959 17:46664353-46664375 ACTCGGGAGGCTGAGGCGGCAGG + Intronic
1148412589 17:47480782-47480804 AATAGTAACGCTGAGGAGGGCGG + Intergenic
1151599148 17:75095604-75095626 ACTCGGGAGGCTGAGGTGGCAGG - Intronic
1151742760 17:75995110-75995132 ACTTGAGACGCTGAGGTGGCAGG + Intronic
1152346419 17:79755078-79755100 ACTCGGGAGGCTGAGGAGGGAGG + Intergenic
1152395012 17:80027163-80027185 GATAGAGAAGCTGAGGAGGCTGG + Intronic
1152533514 17:80936864-80936886 AATCGCCAAGCTGTGGAGGGGGG - Intronic
1152951534 17:83236975-83236997 AATCAGGAGGCTGAGGAGGGAGG - Intergenic
1153699994 18:7683276-7683298 ACTCGAGAGGCTGAGGAGGGAGG - Intronic
1153868936 18:9298468-9298490 ACTCGGGAGGCTGAGGTGGCAGG + Intergenic
1153932434 18:9889957-9889979 ACTCAGGAGGCTGAGGAGGCAGG + Intergenic
1155079367 18:22392496-22392518 ACTCGAGAGGCTGAGGAGGGAGG + Intergenic
1156007565 18:32461584-32461606 ACTCGGGAAGCTGAGGTGGCAGG + Intronic
1157452084 18:47796312-47796334 ACTCGGGAGGCTGAGGAGGGAGG + Intergenic
1160633045 18:80259794-80259816 AATCAGGAGGCTGAGGAGGGAGG - Intergenic
1160797248 19:951446-951468 AATCGGGAGGCTGAGGTGGGAGG + Intronic
1160836169 19:1125559-1125581 ACTAGGGAGGCTGAGGAGGCAGG + Intronic
1161436969 19:4269280-4269302 ACTCGCGAGGCTGAGGTGGGAGG - Intergenic
1162065076 19:8120595-8120617 ACTCGGGAGGCTGAGGAGGGAGG - Intronic
1162307164 19:9882128-9882150 ACTCGGGAGGCTGAGGAGGGAGG + Intronic
1162444887 19:10716777-10716799 ACTCGGGACGCTGAGGCGGGAGG + Intergenic
1162775450 19:12976156-12976178 ACTCGGGAGGCTGAGGAGGGAGG - Intergenic
1164048703 19:21565377-21565399 ACTCAGGAGGCTGAGGAGGCAGG - Intergenic
1165709008 19:37996332-37996354 ACTCGGGAGGCTGAGGAGGAAGG - Intronic
1165784700 19:38454146-38454168 ACTTGGGAGGCTGAGGAGGCAGG - Intronic
1166459578 19:42974387-42974409 CATCCCCATGCTGAGGAGGCTGG + Intronic
1166476896 19:43134423-43134445 CATCCCCATGCTGAGGAGGCTGG + Intronic
1166527709 19:43523383-43523405 ACTCAGGAGGCTGAGGAGGCAGG - Intronic
1166871842 19:45876058-45876080 ACTCGAGAGGCTGAGGAGGGAGG - Intergenic
1167079550 19:47270075-47270097 ACTCGGGAGGCTGAGGAGGGAGG - Intronic
1167352316 19:48983093-48983115 ACTCGGGAGGCTGAGGAGGGAGG - Intronic
1168727565 19:58596013-58596035 AATCAGGAGGCTGAGGAGGGAGG - Intergenic
924958584 2:12578-12600 AATCAGGAGGCTGAGGAGGGAGG + Intergenic
929231060 2:39560683-39560705 ATTCGGGAGGCTGAGGAGGGTGG - Intergenic
929517788 2:42620599-42620621 AATTGGGAGGCTGAGGTGGCAGG - Intronic
930120441 2:47756442-47756464 AATCGGGAGGCTGAGGTGGGAGG - Intronic
930703510 2:54483023-54483045 AAATGTGACCCTGAGGAGGCCGG + Intronic
932194448 2:69770983-69771005 ACTCGGGAGGCTGAGGCGGCAGG + Intronic
933900375 2:86845537-86845559 ACTCGAGAGGCTGAGGAGGGAGG - Intronic
934060516 2:88288320-88288342 ACTCGGGAGGCTGAGGAGGGAGG - Intergenic
936442539 2:112567486-112567508 AATCGGGAGGCTGAGGTGGGAGG - Intronic
936570989 2:113615181-113615203 AATCAGGAGGCTGAGGAGGGAGG + Intergenic
937912675 2:127083192-127083214 ACTCGGGACGCTGAGGTGGGCGG - Intronic
941898734 2:170657301-170657323 ACTTGGGAGGCTGAGGAGGCAGG - Intergenic
942926779 2:181442768-181442790 ACTCGGGAGGCTGAGGAGGGAGG - Intergenic
944081451 2:195793036-195793058 ACTCGAGAGGCTGAGGAGGGAGG - Intronic
944559452 2:200921266-200921288 AATCGAGAGGCTGAGGTGGGAGG - Intronic
945135745 2:206625931-206625953 ACTCGGGAAGCTGAGGTGGCGGG - Intergenic
947596104 2:231412555-231412577 CATCGTGACGCTGAGGTGGATGG + Intergenic
947684879 2:232074691-232074713 ACTCGGGAGGCTGAGGAGGAAGG - Intronic
947736940 2:232459966-232459988 AATGGAGACCTTGAGGAGGCAGG - Exonic
947985642 2:234445517-234445539 ACTTGGGAGGCTGAGGAGGCAGG - Intergenic
948715118 2:239856230-239856252 AATTGAGAGGCTGAGGAAGCTGG - Intergenic
949088025 2:242173994-242174016 AATCAGGAGGCTGAGGAGGGAGG - Intergenic
1169165697 20:3421680-3421702 AATTGGGACGCTGAGGTGGGAGG + Intergenic
1169268588 20:4182338-4182360 AATCACGACACTGGGGAGGGTGG + Exonic
1172073275 20:32274625-32274647 ACTCGGGAGGCTGAGGTGGCAGG + Intergenic
1172481163 20:35272345-35272367 ACTCGGGAGGCTGATGAGGCAGG - Intronic
1173193641 20:40895877-40895899 ACTCGGGACGCTGAGGTGGGAGG + Intergenic
1173242024 20:41305382-41305404 ACTCGGGAGGCTGAGGAGGGAGG + Intronic
1173255040 20:41388167-41388189 AATTGGGAGGCTGAGGTGGCAGG + Intergenic
1174043533 20:47716899-47716921 ACTCGAGAGGCTGAGGTGGCAGG + Intronic
1174208373 20:48857662-48857684 ACTCGGGAGGCTGAGGTGGCAGG + Intergenic
1174365846 20:50055773-50055795 ACTCGCGAGGCTGAGGTGGGAGG - Intergenic
1174440051 20:50544257-50544279 ACTCGGGACGCTGAGGTGGGAGG - Intronic
1174917499 20:54668870-54668892 ACTCCAGAGGCTGAGGAGGCAGG + Intergenic
1175236501 20:57516426-57516448 ACTCGAGAGGCTGAGGTGGCAGG + Intronic
1175747300 20:61466740-61466762 AATCAGGACGCTGAGGCGGGAGG + Intronic
1178168626 21:30011646-30011668 ACTCGTGAGGCTGAGGAGGGAGG + Intergenic
1178938560 21:36885397-36885419 ACTCGGGACGCTGAGGTGGGAGG + Intronic
1179014463 21:37583818-37583840 ACTCAGGAGGCTGAGGAGGCAGG - Intergenic
1179145108 21:38761279-38761301 ACTCGCGAGGCTGAGGTGGGAGG - Intergenic
1179565086 21:42242587-42242609 AGTGGTGACGCTGAGGAGGGCGG + Intronic
1180263005 21:46687815-46687837 AATCAGGAGGCTGAGGAGGGAGG - Intergenic
1181530934 22:23516974-23516996 ACTCGGGAAGCTGAGGAGGGAGG + Intergenic
1181655992 22:24299326-24299348 ATTCGGGAGGCTGAGGTGGCAGG + Intronic
1181719457 22:24762773-24762795 AAACGAGAAACTGAGGAGGCCGG + Intronic
1183821193 22:40346929-40346951 GTTCGAGACGCGGAGGAGGCTGG + Intronic
1183935528 22:41259895-41259917 AATCGGGAGGCTGAGGTGGGAGG + Intronic
1184771848 22:46601685-46601707 ACTCGGGAGGCTGAGGAGGGAGG + Intronic
1185240184 22:49738292-49738314 AATCACCCCACTGAGGAGGCAGG - Intergenic
1185429206 22:50795689-50795711 AATCAGGAGGCTGAGGAGGGAGG - Intergenic
949214312 3:1546967-1546989 AATCGAGAGGCTGAGGTGGGAGG - Intergenic
949470602 3:4391935-4391957 ACTTGGGACGCTGAGGTGGCAGG - Intronic
950034366 3:9874405-9874427 AGTCGGGAGGCTGAGGTGGCAGG + Intronic
951702030 3:25506505-25506527 AATCGGGAGGCTGAGGAAGGAGG + Intronic
953999680 3:47546301-47546323 ACTCGGGACGCTGAGGTGGGAGG - Intergenic
955138778 3:56248199-56248221 ATTCGGGAGGCTGAGGAGGTGGG - Intronic
955206633 3:56901690-56901712 ACTCGAGAGGCTGAGGAGGAAGG - Intronic
956184381 3:66548651-66548673 ACTCGGGACGCTGAGGTGGGAGG - Intergenic
956819746 3:72943483-72943505 ACTCGGGAGGCTGAGGAGGGAGG - Intronic
957079871 3:75628081-75628103 AATCAGGAGGCTGAGGAGGGAGG + Intergenic
960605391 3:119499200-119499222 AATCGGGAGGCTGAGGTGGGAGG - Intronic
961157901 3:124696377-124696399 AATCGGGAGGCTGAGGTGGTTGG - Intronic
961391351 3:126554121-126554143 ACTCGGGAGGCTGAGGTGGCAGG - Intronic
963849229 3:150193383-150193405 ACTCGGGAGGCTGAGGTGGCAGG - Intergenic
966154288 3:176899161-176899183 AATCGAGAGGCTGAGGTGGGAGG + Intergenic
966375701 3:179293041-179293063 ATTTGGGAGGCTGAGGAGGCCGG + Intergenic
966805699 3:183805678-183805700 ATTCGGGAAGCTGAGGAGGGAGG + Intronic
967710586 3:192702681-192702703 ACTCGGGAGGCTGAGGTGGCAGG + Intronic
967734150 3:192934649-192934671 AGTCGGGAGGCTGAGGTGGCAGG - Intergenic
968071873 3:195789190-195789212 GTTCGTGACCCTGAGGAGGCCGG + Exonic
968716747 4:2165883-2165905 ATTCGTGAGGCTGAGGTGGCAGG - Intronic
968851543 4:3083410-3083432 ACTCAGGAGGCTGAGGAGGCTGG + Intronic
972791809 4:42379600-42379622 ACTCGGGAGGCTGAGGAGGGAGG + Intergenic
973247430 4:48024385-48024407 ACTCGGGAGGCTGAGGAGGGAGG - Intronic
975679758 4:76865061-76865083 ACTCGTGAGGCTGAGGAGGGAGG + Intergenic
975759909 4:77609419-77609441 ACTCGGGAGGCTGAGGAGGGAGG - Intronic
977257576 4:94758026-94758048 GACCGCGGCGCTGAGGACGCGGG + Intronic
977681688 4:99804883-99804905 AATCAAGACGCTGAGGTGGGAGG + Intergenic
977926998 4:102712625-102712647 ACTCGAGAGGCTGAGGTGGCAGG - Intronic
981622227 4:146714939-146714961 ACTTGGGAGGCTGAGGAGGCAGG - Intronic
982013414 4:151128747-151128769 ACTCGGGAGGCTGAGGAGGGAGG - Intronic
983246371 4:165292439-165292461 ACTTGGGAGGCTGAGGAGGCAGG - Intronic
984452394 4:179919274-179919296 ACTCGGGAGGCTGAGGAGGCAGG + Intergenic
984636011 4:182110431-182110453 ACTCGGGAGGCTGAGGAGGGAGG - Intergenic
984677205 4:182563319-182563341 ACTTGGGATGCTGAGGAGGCAGG + Intronic
985465653 4:190192789-190192811 AATCAGGAGGCTGAGGAGGGAGG - Intergenic
988869469 5:35373057-35373079 ACTCAGGAGGCTGAGGAGGCAGG - Intergenic
990431053 5:55736145-55736167 ATTCGGGAGGCTGAGGTGGCAGG + Intronic
990955823 5:61337159-61337181 AATCCCGCCGCTCGGGAGGCTGG + Intronic
992793061 5:80230919-80230941 ACTCGGGAGGCTGAGGAGGAAGG - Intronic
993706577 5:91178212-91178234 ATTCGCGAGGCTGAGGTGGGAGG + Intergenic
998419356 5:141969358-141969380 CTTCGGGACGCTGAGGAGGAAGG + Intronic
998729334 5:145056245-145056267 AATAGCGAAGCAGAGGAGGGAGG - Intergenic
999156776 5:149463899-149463921 ACTCGAGAGGCTGAGGAGGGAGG - Intergenic
999225762 5:150022917-150022939 ACTCGAGAGGCTGAGGTGGCAGG - Intronic
1001892046 5:175347774-175347796 ACTCGGGAGGCTGAGGTGGCAGG - Intergenic
1001907991 5:175488785-175488807 AATCGGGAGGCTGAGGTGGGAGG + Intronic
1002393475 5:178935101-178935123 ACTCGGGAGGCTGAGGAGGCAGG + Intergenic
1002682077 5:180973808-180973830 AATGGGGAGGCTGAGGAGGGAGG + Intergenic
1002745763 5:181470788-181470810 AATCAGGAGGCTGAGGAGGGAGG - Intergenic
1003407848 6:5838269-5838291 AACGGGGACGCTGAGGAGGTGGG + Intergenic
1004378829 6:15114830-15114852 ACTCCCGAGGCTGAGGAGGAAGG + Intergenic
1005742559 6:28805751-28805773 ACTCGGGAAGCTGAGGCGGCAGG + Intergenic
1006199529 6:32275456-32275478 ACTCGGGAGGCTGAGGTGGCAGG - Intergenic
1006354514 6:33546897-33546919 ACTCCTGAAGCTGAGGAGGCAGG - Intergenic
1006682839 6:35809610-35809632 ACTCGGGAGGCTGAGGAGGGAGG - Intronic
1007576706 6:42929712-42929734 AAATGCGAAGGTGAGGAGGCGGG + Exonic
1007727494 6:43925330-43925352 ACTCGAGACGCTGAGGTGGGAGG - Intergenic
1008627350 6:53330628-53330650 ACTCGGGAGGCTGAAGAGGCAGG - Intronic
1008765055 6:54902295-54902317 ACTCGGGAGGCTGAGGAGGGAGG - Intronic
1010199960 6:73273705-73273727 ACTCGGGAGGCTGAGGAGGCAGG + Intronic
1011660627 6:89591210-89591232 ACTCAGGAGGCTGAGGAGGCTGG - Intronic
1011788892 6:90876761-90876783 ACTCGGGAGGCTGAGGAGGGAGG - Intergenic
1013037405 6:106399763-106399785 ACTCGGGAGGCTGAGGTGGCAGG - Intergenic
1013468589 6:110440246-110440268 ACTCGGGAGGCTGAGGAGGGAGG - Intronic
1014532323 6:122573411-122573433 ACTCGCGAGGCTGAGGTGGAAGG + Intronic
1016368083 6:143340570-143340592 ACTCGGGAGGCTGAGAAGGCAGG - Intergenic
1019234676 6:170600521-170600543 AATCAGGAGGCTGAGGAGGGAGG - Intergenic
1019250680 6:170744343-170744365 AATCAGGAGGCTGAGGAGGGAGG - Intergenic
1019358435 7:592925-592947 ACTCGGGAGGCTGAGGAGGGAGG + Intronic
1019859043 7:3639953-3639975 ACTCGGGAGGCTGAGGAGGGAGG - Intronic
1020041220 7:5003219-5003241 ACTCGGGAAGCTGAGGAGGGAGG + Intronic
1022729394 7:33008306-33008328 ACTTGGGAGGCTGAGGAGGCAGG + Intergenic
1024424572 7:49211057-49211079 ACTCGGGAGGCTGAGGTGGCAGG + Intergenic
1024880822 7:54083308-54083330 ACTCGGGAGGCTGAGGAGGAAGG + Intergenic
1025794232 7:64723236-64723258 ACTCGGGAGGCTGAGGAGGGAGG - Intergenic
1026988639 7:74570543-74570565 ACTCGGGAGGCTGAGGAGGGAGG + Intronic
1027341934 7:77218813-77218835 CATTGGGAGGCTGAGGAGGCAGG - Intronic
1029367591 7:100126698-100126720 ACTCGGGACGCTGAGGCGGGAGG + Exonic
1029461468 7:100696333-100696355 ACTCGGGAGGCTGAGGAGGGAGG - Intergenic
1029661278 7:101963758-101963780 AATCGGGAGGCTGAGGTGGGAGG - Intronic
1032551180 7:132786067-132786089 ACTCGAGACGCTGAGGTGGGAGG + Intronic
1032577584 7:133072059-133072081 ACTCGGGAGGCTGAGGAGGGAGG + Intronic
1033231446 7:139601133-139601155 ACTCGGGAGGCTGAGGTGGCAGG + Intronic
1034615061 7:152409111-152409133 AATCGGGAGGCTGAGGTGGAAGG - Intronic
1035175985 7:157051330-157051352 AATCGGGAGGCTGAGGTGGGAGG + Intergenic
1036485414 8:9174681-9174703 ACTCAGGAGGCTGAGGAGGCAGG - Intergenic
1037828296 8:22173203-22173225 ACTGGAGAGGCTGAGGAGGCTGG + Intronic
1038451268 8:27640621-27640643 AATCGGGAGGCTGAGGAGGGAGG - Intronic
1039535057 8:38302741-38302763 ACTCGAGAGGCTGAGGAGGGAGG - Intronic
1040012779 8:42676178-42676200 ACTCGGGAGGCTGAGGTGGCAGG - Intergenic
1044354889 8:91209318-91209340 ACTCGGGAGACTGAGGAGGCAGG + Intronic
1045331613 8:101160184-101160206 AATCGGGAGGCTGAGGTGGGAGG + Intergenic
1045463780 8:102450339-102450361 ACTCGAGAGGCTGAGGAGGGAGG - Intergenic
1046017892 8:108627944-108627966 ACTCACGAGGCTGATGAGGCAGG + Intronic
1047985608 8:130229954-130229976 ACTCGGGAGGCTGAGGAGGGAGG + Intronic
1048555204 8:135469394-135469416 ACTCGGGAGGCTGAGGAGGCAGG - Intronic
1051641459 9:19228608-19228630 ATTCGGGAGGCTGAGGTGGCAGG + Intergenic
1053372033 9:37570200-37570222 ACTTGGGAGGCTGAGGAGGCAGG + Intronic
1053386177 9:37691793-37691815 ACTCGGGAGGCTGAGGAGGCAGG + Intronic
1054862373 9:69967170-69967192 ACTCGAGAAGCTGAGGAGGTGGG - Intergenic
1055309960 9:74968352-74968374 AATCTGGAGGCTGAGGAGGGAGG + Intergenic
1056333717 9:85544522-85544544 ACTTGCGACGCTGAGGTGGGAGG + Intergenic
1056731603 9:89170534-89170556 ATTCGGGAGGCTGAGGAGGGAGG + Intronic
1056967568 9:91177953-91177975 AATCTCTACGGTGAGCAGGCAGG + Intergenic
1057107883 9:92437914-92437936 ACTCGAGATGCTGAGGAGGGAGG - Intronic
1057718932 9:97517239-97517261 ACTCGAGAGGCTGAGGAGGGAGG + Intronic
1059096175 9:111417128-111417150 TATCGGGAGGCTGAGGAGGGTGG + Intronic
1059102449 9:111483691-111483713 GCTCGCGACGCGGAGGACGCAGG - Intronic
1060514341 9:124256797-124256819 ACTCGGGACGCTGAGGCGGGAGG - Intergenic
1061013724 9:127970223-127970245 ACTCAGGAGGCTGAGGAGGCAGG - Intronic
1061638510 9:131931134-131931156 ACTCGGGAGGCTGAGGAGGGAGG + Intronic
1061676974 9:132223003-132223025 ACTCGGGAGGCTGAGGAGGGAGG + Intronic
1203580235 Un_KI270745v1:36940-36962 AATCAGGAGGCTGAGGAGGGAGG - Intergenic
1185458276 X:321234-321256 ACTCGGGACGCTGAGGTGGGAGG + Intergenic
1186148416 X:6648711-6648733 ACTCGAGACGCTGAGGTGGGAGG - Intergenic
1186186951 X:7030025-7030047 CATCCCCATGCTGAGGAGGCTGG + Intergenic
1187160959 X:16764801-16764823 ACTCGGGAGGCTGAGGAGGGAGG - Exonic
1187973958 X:24686750-24686772 AATCAGGACGCTGAGGTGGGAGG + Intergenic
1188660008 X:32747594-32747616 ATTCGGGACGCTGAGGCGGGAGG - Intronic
1190073240 X:47296019-47296041 ACTCAGGAGGCTGAGGAGGCAGG - Intergenic
1190342063 X:49304495-49304517 ACTCGGGACGCTGAGGTGGGAGG + Intronic
1190401394 X:50039183-50039205 ACTTGGGACGCTGAGGTGGCAGG + Intronic
1192485420 X:71520571-71520593 ACTCGGGAGGCTGGGGAGGCAGG + Intronic
1192485495 X:71521404-71521426 ACTCGGGAGGCTGGGGAGGCAGG + Intronic
1192485570 X:71522237-71522259 ACTCGGGAGGCTGGGGAGGCAGG + Intronic
1192609373 X:72552500-72552522 ACTCGGGAGGCTGAGGCGGCAGG + Intronic
1193119266 X:77806513-77806535 AATCAGGAGGCTGAGGAGGGTGG - Intergenic
1196790545 X:119460256-119460278 AATCGAGAGGCTGAGGTGGGAGG + Intergenic
1196790670 X:119461424-119461446 AATCGAGAGGCTGAGGTGGGAGG + Intergenic
1197731849 X:129817341-129817363 AATCACGAGGCTGAGGTGGGGGG + Intronic
1197999539 X:132418880-132418902 ACTCGGGACGCTGAGGTGGGAGG - Intronic
1198851572 X:140970022-140970044 AATGGTGAGGCTGAGGAGGGGGG - Intergenic
1199474578 X:148231393-148231415 ACTCGCGAGGCTGAGGTGGGAGG - Intergenic
1199930566 X:152514999-152515021 AATCGGGAAGCTGAGGCAGCAGG + Intergenic
1202358729 Y:24081042-24081064 AATTGGGAGGCTGAGGAAGCAGG - Intergenic
1202512049 Y:25589071-25589093 AATTGGGAGGCTGAGGAAGCAGG + Intergenic