ID: 914831069

View in Genome Browser
Species Human (GRCh38)
Location 1:151171374-151171396
Sequence TCTTACATGCACCTGTTGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 114}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914831069_914831081 26 Left 914831069 1:151171374-151171396 CCATGCAACAGGTGCATGTAAGA 0: 1
1: 0
2: 1
3: 17
4: 114
Right 914831081 1:151171423-151171445 CTAGCCTTACATTGGCAATGGGG 0: 1
1: 0
2: 0
3: 4
4: 152
914831069_914831078 18 Left 914831069 1:151171374-151171396 CCATGCAACAGGTGCATGTAAGA 0: 1
1: 0
2: 1
3: 17
4: 114
Right 914831078 1:151171415-151171437 GATGTCAACTAGCCTTACATTGG 0: 1
1: 0
2: 0
3: 1
4: 51
914831069_914831076 -5 Left 914831069 1:151171374-151171396 CCATGCAACAGGTGCATGTAAGA 0: 1
1: 0
2: 1
3: 17
4: 114
Right 914831076 1:151171392-151171414 TAAGATGTGGGGAGAGGGCTGGG 0: 1
1: 0
2: 5
3: 37
4: 431
914831069_914831077 -4 Left 914831069 1:151171374-151171396 CCATGCAACAGGTGCATGTAAGA 0: 1
1: 0
2: 1
3: 17
4: 114
Right 914831077 1:151171393-151171415 AAGATGTGGGGAGAGGGCTGGGG 0: 1
1: 1
2: 6
3: 83
4: 724
914831069_914831079 24 Left 914831069 1:151171374-151171396 CCATGCAACAGGTGCATGTAAGA 0: 1
1: 0
2: 1
3: 17
4: 114
Right 914831079 1:151171421-151171443 AACTAGCCTTACATTGGCAATGG 0: 1
1: 0
2: 0
3: 7
4: 75
914831069_914831075 -6 Left 914831069 1:151171374-151171396 CCATGCAACAGGTGCATGTAAGA 0: 1
1: 0
2: 1
3: 17
4: 114
Right 914831075 1:151171391-151171413 GTAAGATGTGGGGAGAGGGCTGG 0: 1
1: 0
2: 1
3: 55
4: 548
914831069_914831074 -10 Left 914831069 1:151171374-151171396 CCATGCAACAGGTGCATGTAAGA 0: 1
1: 0
2: 1
3: 17
4: 114
Right 914831074 1:151171387-151171409 GCATGTAAGATGTGGGGAGAGGG 0: 1
1: 0
2: 0
3: 17
4: 284
914831069_914831080 25 Left 914831069 1:151171374-151171396 CCATGCAACAGGTGCATGTAAGA 0: 1
1: 0
2: 1
3: 17
4: 114
Right 914831080 1:151171422-151171444 ACTAGCCTTACATTGGCAATGGG 0: 1
1: 0
2: 0
3: 4
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914831069 Original CRISPR TCTTACATGCACCTGTTGCA TGG (reversed) Intronic
906684432 1:47754410-47754432 GCTTTCATACAGCTGTTGCAGGG - Intergenic
907925708 1:58953529-58953551 TCTTCCATGCACATGGTGCAAGG - Intergenic
912533326 1:110341806-110341828 TCCAACATGCATCTGTTGCAGGG + Exonic
912674563 1:111666370-111666392 TAATATATGCACATGTTGCATGG - Intronic
913393526 1:118341109-118341131 TCTTACATGTCCCTGATCCAGGG - Intergenic
913667952 1:121067422-121067444 TAATGCATGGACCTGTTGCATGG - Intergenic
914658193 1:149762769-149762791 TAATGCATGGACCTGTTGCATGG - Intergenic
914831069 1:151171374-151171396 TCTTACATGCACCTGTTGCATGG - Intronic
915639805 1:157215941-157215963 TCTCACTTGCACCGGTGGCAGGG + Intergenic
923983766 1:239355991-239356013 TTTTACAAACACCTCTTGCAGGG - Intergenic
1063959209 10:11292897-11292919 TCTTCCAGGCTCCTGTTGCCTGG - Intronic
1064155239 10:12898330-12898352 TCGTACATGCAGCTATTTCAAGG - Exonic
1064598725 10:16972167-16972189 TCTTTCATCCACCCGTTACATGG + Intronic
1064920586 10:20513098-20513120 TCTTACATTCATATATTGCACGG + Intergenic
1068306915 10:55223349-55223371 TTTTACATGCACCTTTTTCAAGG + Intronic
1073641220 10:105254575-105254597 TCTTACATGCAGGTTCTGCAGGG - Intronic
1075993905 10:126861018-126861040 TTGCACATGCTCCTGTTGCAGGG - Intergenic
1085863000 11:80256682-80256704 TTCTATATGCACCTGTTGCTAGG + Intergenic
1086747551 11:90448747-90448769 TCTTACATTCACCAGTGTCAAGG - Intergenic
1087849816 11:103015438-103015460 TCTTGCATGCATATATTGCATGG + Intergenic
1089332306 11:117698392-117698414 TTTTACATGTATCTGTTGCATGG - Intronic
1094720171 12:33055094-33055116 TCTTACATGAAACTGTTCCCTGG - Intergenic
1102901840 12:116644899-116644921 TGTTGGATGCATCTGTTGCAGGG - Intergenic
1103889146 12:124225457-124225479 TCCTGCATGCTCCTGCTGCAGGG - Intronic
1104735665 12:131134651-131134673 TTTTACAGGCACCGGTTGCCCGG + Intronic
1105615853 13:22011470-22011492 TGTTTCATGAACCTGTTTCATGG + Intergenic
1107614466 13:42150470-42150492 TCTTATATACACCAGTTACATGG + Intronic
1108198042 13:48014707-48014729 GCTTTCATGTATCTGTTGCAAGG - Intergenic
1108887029 13:55199491-55199513 CCTATCATGCCCCTGTTGCAGGG + Intergenic
1109332468 13:60946501-60946523 TGTTACATGCATCTATTGCATGG + Intergenic
1110306310 13:73991348-73991370 TCTAACATGCACTTGGTGCATGG - Intronic
1111164331 13:84438659-84438681 TCTCAAATGCACCTTTTCCATGG - Intergenic
1113089526 13:106602592-106602614 TCATTCATTCACGTGTTGCATGG + Intergenic
1115697385 14:35913793-35913815 TCTTAGATACACCTGTTCCTTGG - Intronic
1120165080 14:81189260-81189282 ACTTACATGCACCTGTTTTGAGG + Intronic
1120683464 14:87509210-87509232 TCTTACATGCAACAGCTTCAGGG - Intergenic
1121034575 14:90690185-90690207 TCTTACATGTACCAATGGCAGGG + Intronic
1125423946 15:39531343-39531365 TCTCACATCCACCTGCTCCAGGG + Intergenic
1128643515 15:69358187-69358209 TGTTTCTTGGACCTGTTGCAAGG + Intronic
1128780945 15:70358301-70358323 TCTTAAATGCACCCCTTGAAAGG - Intergenic
1129002313 15:72344956-72344978 TCTAAAATGCACCTGTCTCATGG + Intronic
1129567029 15:76633763-76633785 TCTTACTGGCACCTGCAGCAGGG + Intronic
1136407796 16:30058791-30058813 TCTTTCATGTGCATGTTGCAAGG + Intronic
1137858220 16:51818343-51818365 TCTTACATGCACCTGGAGTCAGG - Intergenic
1144088535 17:11832520-11832542 TCTTACATTCACAAGTTGGAAGG - Intronic
1153628133 18:7041405-7041427 TCTTACGTGCACCTGGTGAGGGG - Intronic
1157098312 18:44707468-44707490 TCTTATTTCCTCCTGTTGCAAGG + Intronic
1157571938 18:48718468-48718490 TCATACATGCTCCTGTTTCTTGG - Intronic
1159761991 18:72438534-72438556 TGTTACATGCATATATTGCATGG + Intergenic
1160977890 19:1802702-1802724 TCTCACCTGCACCCGGTGCAGGG - Intronic
1162222753 19:9192127-9192149 TCTGCCATGCAGCTGCTGCAGGG - Intergenic
1166278393 19:41772425-41772447 TGTAACATGCACATGTTCCAGGG + Intergenic
1167826205 19:51975859-51975881 GTTTACAGGCACCTGCTGCAGGG + Intronic
929846307 2:45532356-45532378 TCTTTCATGTACCTCTTTCATGG + Intronic
930030379 2:47055038-47055060 TCTACCAAGCACCTGTTGAATGG + Intronic
930889849 2:56372204-56372226 TGTAACATGCACCTGTAGCTAGG - Intronic
937704112 2:124898202-124898224 TCTTATAAGCCCCTGTTGTATGG + Intronic
940042090 2:149371334-149371356 TCTTCCATGCATCTTTAGCAAGG + Intronic
940111943 2:150164372-150164394 AGTTACATGCACCTGGTACATGG + Intergenic
940549579 2:155136409-155136431 TCTAACATGAAACTTTTGCATGG + Intergenic
942587428 2:177497827-177497849 TCCCACATGCACCTATTGTAAGG + Intronic
942960366 2:181823017-181823039 TGTTACATGCACAGATTGCATGG + Intergenic
944848873 2:203696595-203696617 TCTTACATGCATATATTGCATGG + Intergenic
945358071 2:208862058-208862080 TATTTCTTGCTCCTGTTGCATGG + Intergenic
946794306 2:223333130-223333152 TATTACATCCACTTGGTGCAGGG - Intergenic
947270743 2:228331771-228331793 TATTAGATGCACTTGTTGCTGGG - Intergenic
1169342964 20:4810217-4810239 TCCTTCATGCAACTGCTGCAGGG - Intronic
1170742783 20:19072762-19072784 TCCTACATGCAATTGTTTCAGGG - Intergenic
1172824302 20:37767484-37767506 TCTTGCTTCCACCTGATGCAGGG + Intronic
1173515416 20:43662282-43662304 TATTACATACACCTGTTGGCTGG - Intergenic
1177741568 21:25160326-25160348 CAATACAAGCACCTGTTGCAGGG + Intergenic
1183881011 22:40829727-40829749 TCTTGCATGGACAGGTTGCATGG - Intronic
949899346 3:8797062-8797084 TCTGTCATGTACCTGCTGCATGG - Intronic
950235922 3:11320108-11320130 TTTTGCATGCACCTTTTGCCTGG + Intronic
952022834 3:29043403-29043425 TCTTATATGCACCTTTGGCAAGG + Intergenic
954704565 3:52472382-52472404 CCTTACCTCCACCTGATGCAGGG - Exonic
955141853 3:56277545-56277567 TCTTAGATGTTCCTGTTTCAAGG + Intronic
956171591 3:66437693-66437715 TGCTACATGCAGCTGCTGCAAGG + Intronic
956406827 3:68936640-68936662 TCTTACGTGGACATGTTGCATGG - Intergenic
963218504 3:142778596-142778618 TTTTACTAGCCCCTGTTGCAAGG + Intronic
964717826 3:159741380-159741402 ACTGACATGCACCAGTTTCATGG + Intronic
965093219 3:164188176-164188198 TCTTACATGCACATCTTTCTGGG + Intergenic
965570207 3:170164941-170164963 TCTGACATGAACCTGTTGGAGGG - Intronic
969045602 4:4334358-4334380 TCACTCACGCACCTGTTGCAGGG + Intergenic
969150784 4:5166993-5167015 GCTGACATGCACATGTGGCATGG - Intronic
975850476 4:78566764-78566786 TCTTACATGCAGATGGTGCATGG - Intronic
982085122 4:151827347-151827369 TCTTACATGAGCATGTTTCATGG + Intergenic
982145921 4:152392160-152392182 TCTTGCATGCTCTTCTTGCAAGG + Intronic
983343883 4:166502218-166502240 CCTATCATGCCCCTGTTGCAGGG + Intergenic
986486260 5:8241521-8241543 TGTTCCATGCATATGTTGCATGG - Intergenic
986628866 5:9749629-9749651 TCTTCCATGTAGCTGTTGAAGGG + Intergenic
988001068 5:25349030-25349052 TCTCAGAAGCAACTGTTGCAAGG + Intergenic
996779536 5:127170943-127170965 TCCAACATGCAGTTGTTGCAGGG - Intergenic
1000336535 5:160245646-160245668 TCTTCCAGGCACCTGGTGCCAGG + Intergenic
1006248948 6:32764341-32764363 TATCAGATGCACCTGTTTCATGG - Intergenic
1008452805 6:51672478-51672500 ACTTACATGCGCCCCTTGCAAGG - Intronic
1022130378 7:27399597-27399619 TGTTACATGAACCTGCTGCTGGG - Intergenic
1026246773 7:68627276-68627298 TCTTACAAGAACTGGTTGCAAGG - Intergenic
1027366849 7:77467627-77467649 TCTTACATGATCCCATTGCATGG - Intergenic
1028829402 7:95311019-95311041 TCTTAGATGCACTTGATTCAGGG + Intronic
1031483128 7:122301818-122301840 TCTTGCATGCACCTGCTAAATGG - Exonic
1031735668 7:125357542-125357564 TCTTATGTCCACCTGATGCAAGG - Intergenic
1032779973 7:135157736-135157758 TCTCACAGCCACCTGTAGCAGGG + Intronic
1034999208 7:155598167-155598189 TCTTAGATGCAAATTTTGCATGG - Intergenic
1035062845 7:156081991-156082013 GCTTACATGCACCTGTGCCAAGG + Intergenic
1037255996 8:16954379-16954401 TCTTACATGCACATATTGCCTGG - Intergenic
1037569162 8:20144067-20144089 TCTGACATCCACCTGGGGCAGGG - Intergenic
1037927762 8:22857922-22857944 ACTTACATGCCCCTGGTGCATGG + Intronic
1041811866 8:61920529-61920551 TCTAACTTGAACCTGTTCCAGGG + Intergenic
1046496309 8:115019009-115019031 TCTTACAGTTGCCTGTTGCAGGG + Intergenic
1053558965 9:39169688-39169710 TCTTACATTCACCTGGTGATTGG - Intronic
1053823087 9:41989935-41989957 TCTTACATTCACCTGGTGATTGG - Intronic
1054138146 9:61449255-61449277 TCTTACATTCACCTGGTGATTGG + Intergenic
1054607486 9:67197431-67197453 TCTTACATTCACCTGGTGATTGG + Intergenic
1055650873 9:78405638-78405660 TATTGCAGGCACCTGTTGCAGGG - Intergenic
1057818006 9:98309872-98309894 TCTTACATGCCCTTCTGGCATGG + Intronic
1059864813 9:118502502-118502524 TGTTACATGCATATATTGCATGG + Intergenic
1185615862 X:1421465-1421487 TCTAAGTTGCACCTGTTCCAGGG + Intronic
1185752876 X:2628050-2628072 GCTTAGATGCAGCTGTTGGAGGG + Intergenic
1186024190 X:5290872-5290894 TATTAAATGCACGTGTTCCAAGG + Intergenic
1187157365 X:16733478-16733500 TCTTACTTACACCTGTTGAAGGG - Intronic
1187855447 X:23632455-23632477 TCTTACATGCATATATTGCATGG + Intergenic
1188924869 X:36027230-36027252 TCTTACATGCATATGTTGCATGG + Intergenic
1189640042 X:43058905-43058927 TCTTACATAAACCTATTGCCTGG - Intergenic
1191161475 X:57334130-57334152 TATTACAGGCACCTGCTGCCAGG - Intronic
1192591619 X:72364769-72364791 TCTTATATGCATATATTGCATGG - Intronic
1193113068 X:77749002-77749024 TCGTACATGCATATATTGCATGG + Intronic
1194027044 X:88764966-88764988 CCTATCATGCCCCTGTTGCAGGG - Intergenic
1195315504 X:103673591-103673613 ACTTACTAGCACCTATTGCAAGG + Intergenic
1197307210 X:124858016-124858038 TTTTACATACACCTATTACAAGG + Intronic
1197393524 X:125897916-125897938 TCTTATAAGCACCTCTTGTAAGG + Intergenic
1197561812 X:128033711-128033733 TGTGCCATGCACCTGTTGCTGGG - Intergenic
1199971030 X:152861342-152861364 TCTTACATGGGCCTGTTCCCAGG + Intronic