ID: 914833714

View in Genome Browser
Species Human (GRCh38)
Location 1:151190074-151190096
Sequence CCGGTTCCCAGCGGTCTTCC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 106}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914833704_914833714 5 Left 914833704 1:151190046-151190068 CCTCCTCTGCCTCCAAAAGCCCA 0: 1
1: 0
2: 22
3: 517
4: 12891
Right 914833714 1:151190074-151190096 CCGGTTCCCAGCGGTCTTCCGGG 0: 1
1: 0
2: 0
3: 8
4: 106
914833708_914833714 -7 Left 914833708 1:151190058-151190080 CCAAAAGCCCAGAAAGCCGGTTC 0: 1
1: 0
2: 0
3: 7
4: 112
Right 914833714 1:151190074-151190096 CCGGTTCCCAGCGGTCTTCCGGG 0: 1
1: 0
2: 0
3: 8
4: 106
914833706_914833714 -4 Left 914833706 1:151190055-151190077 CCTCCAAAAGCCCAGAAAGCCGG 0: 1
1: 0
2: 1
3: 12
4: 117
Right 914833714 1:151190074-151190096 CCGGTTCCCAGCGGTCTTCCGGG 0: 1
1: 0
2: 0
3: 8
4: 106
914833705_914833714 2 Left 914833705 1:151190049-151190071 CCTCTGCCTCCAAAAGCCCAGAA 0: 1
1: 0
2: 4
3: 41
4: 664
Right 914833714 1:151190074-151190096 CCGGTTCCCAGCGGTCTTCCGGG 0: 1
1: 0
2: 0
3: 8
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914833714 Original CRISPR CCGGTTCCCAGCGGTCTTCC GGG Exonic
900464117 1:2815738-2815760 CCTGTACCCAGAGGTCTTCTGGG + Intergenic
903186822 1:21633795-21633817 CCAGTTCCCTGGGGTCTTCCTGG + Intronic
904236946 1:29122477-29122499 CTTGATCCGAGCGGTCTTCCCGG - Exonic
904562252 1:31406752-31406774 CTGGTGCCCACCTGTCTTCCTGG + Intergenic
906524515 1:46486359-46486381 CAGGGTCCCAGCTGTCTGCCCGG - Intergenic
912818714 1:112850150-112850172 CCGGCTCCCAGGCGTCTTCCCGG - Intergenic
914833714 1:151190074-151190096 CCGGTTCCCAGCGGTCTTCCGGG + Exonic
915125149 1:153658693-153658715 CCGGTTCCCGGCGGCCCTCGCGG + Exonic
915517259 1:156420806-156420828 CTGGGTCGCTGCGGTCTTCCCGG - Intronic
916787517 1:168097178-168097200 CCGGTTCCCTGTGATCTTCATGG + Exonic
919796333 1:201323452-201323474 CCGGTCCCCAGCTGGCCTCCTGG + Intronic
923140944 1:231161487-231161509 TGGGTTCCCAGGGGTCTACCCGG + Intergenic
1065253153 10:23837345-23837367 CCAGTTCCCTGCCTTCTTCCCGG + Intronic
1067720138 10:48721986-48722008 CAGGTTCCCTGCTGTGTTCCTGG - Intronic
1068033930 10:51736700-51736722 CTGGTTTCAAGCGGTCCTCCTGG + Intronic
1071500865 10:86203509-86203531 CCGGTGCCCAGTGCTCGTCCTGG - Intronic
1076272874 10:129169960-129169982 CCTGCTCCCTGCTGTCTTCCAGG + Intergenic
1076819113 10:132929992-132930014 CCGGAGCCCAGCAGTCTCCCGGG + Intronic
1079119173 11:17668339-17668361 CCAGTTGACAGCTGTCTTCCTGG + Intergenic
1081968817 11:47185167-47185189 TCGGCTCCGAGAGGTCTTCCTGG + Intronic
1082811610 11:57482288-57482310 CCGGGCACCAGCGGCCTTCCCGG + Intergenic
1086245362 11:84745370-84745392 CCTGTTCCCATCCTTCTTCCTGG + Intronic
1086489925 11:87348996-87349018 TTGGTTCCCAGCTATCTTCCTGG - Intergenic
1087208173 11:95418561-95418583 CAGGTTGCCTGCGGTCTCCCTGG + Intergenic
1089613183 11:119681017-119681039 CCGAGTCCCAGTGGTCCTCCTGG + Intronic
1089616418 11:119697165-119697187 CCAGTTCCCACCAGTCTTTCTGG - Intronic
1094008808 12:25784871-25784893 CCGGCTCCCAGCAGTGTTGCCGG + Intergenic
1094199303 12:27780360-27780382 CCGGGTAGCAGCGGTCCTCCAGG - Exonic
1095129582 12:38523302-38523324 CTGGTTCCCAGAGGTTTTCATGG - Intergenic
1096389287 12:51217108-51217130 CCGGGTCCCACCGGTCGTCCCGG + Intronic
1097860235 12:64511608-64511630 GGGGTTCCCAGCAGTCATCCTGG + Intergenic
1100830854 12:98515733-98515755 CCGCTCCGCAGCGCTCTTCCCGG + Exonic
1101191045 12:102332918-102332940 CCTGTCCCCAGCGTTCTTCAAGG - Intergenic
1101733669 12:107446782-107446804 CCAGATCCCAGCTGTCTTGCTGG + Intronic
1105700446 13:22932108-22932130 TGGGTTCACAGCGGTCATCCAGG + Intergenic
1114239792 14:20856058-20856080 CCAGTACCTAGCGGTCTGCCTGG - Intergenic
1130518994 15:84647928-84647950 CTGGTTACCAGTGGCCTTCCAGG - Exonic
1131143638 15:89998306-89998328 CCTGCTCCCAGGGGCCTTCCTGG + Intergenic
1134833549 16:17343273-17343295 CCGTCTCCCTGCGGTCTTTCAGG + Intronic
1135205451 16:20480133-20480155 CAGGGTCCCAGGGGGCTTCCTGG + Intronic
1135213457 16:20543679-20543701 CAGGGTCCCAGGGGGCTTCCTGG - Intronic
1136009001 16:27350229-27350251 CCAGTTCCCAGCTCCCTTCCAGG + Intronic
1142353412 16:89590034-89590056 CCGGTTCCCAGCAGGCAGCCAGG - Intronic
1149356517 17:55845413-55845435 CCCGTTCCCCGCGGGCTCCCAGG + Intergenic
1155010179 18:21769490-21769512 CTGGTGCCCAGCAGTCATCCTGG + Intronic
1161678642 19:5667679-5667701 CCTGTGCCCAGGTGTCTTCCTGG + Intronic
1161739439 19:6011589-6011611 CAGGTTCACAGCTGTCTGCCAGG + Intronic
1162013801 19:7832795-7832817 CCTGTTCCCCGTGGTCCTCCTGG - Intronic
1167795877 19:51708143-51708165 CTGGTGACCAGCGCTCTTCCAGG + Intergenic
930606759 2:53501077-53501099 CCCGTTCACAGTGGGCTTCCTGG + Intergenic
933779393 2:85791035-85791057 CCTGTGCCCCGCTGTCTTCCTGG - Intergenic
935653062 2:105398794-105398816 CCCTCTCCCAGTGGTCTTCCCGG + Intronic
936241287 2:110790655-110790677 CCTGTTCCCTGAGGTCTGCCAGG + Intronic
943524864 2:189003997-189004019 CCAGGTCCCAGCGGTTCTCCAGG + Exonic
947680351 2:232025962-232025984 CCAGTTCCCAGCTGTCTCTCAGG - Intronic
948284859 2:236776177-236776199 CTGGTTCACAGCAGGCTTCCAGG - Intergenic
1171750830 20:29046810-29046832 GTGGTTCCCAGCGGTCCTACAGG + Intergenic
1173288352 20:41692928-41692950 CTGTTTCCCAGAAGTCTTCCTGG + Intergenic
1174562077 20:51438551-51438573 TCCATTCCCAGCTGTCTTCCAGG + Intronic
1175285038 20:57832163-57832185 CCTGTTCCCAGCTGTCTCCCAGG - Intergenic
1175447302 20:59032145-59032167 CCGGTGCCCAGAGGTCATGCAGG - Intronic
1176313932 21:5224111-5224133 GTGGTTCCCAGCGGTCCTACAGG - Intergenic
1176329554 21:5536212-5536234 CAGGTTCCCTGGGTTCTTCCAGG + Intergenic
1176398203 21:6284739-6284761 CAGGTTCCCTGGGTTCTTCCAGG - Intergenic
1176438954 21:6704365-6704387 CAGGTTCCCTGGGTTCTTCCAGG + Intergenic
1176463216 21:7031434-7031456 CAGGTTCCCTGGGTTCTTCCAGG + Intergenic
1176486777 21:7413213-7413235 CAGGTTCCCTGGGTTCTTCCAGG + Intergenic
1180391749 22:12290228-12290250 GTGGTTCCCAGCGGTCCTACAGG - Intergenic
1180407995 22:12574528-12574550 GTGGTTCCCAGCGGTCCTACAGG + Intergenic
950106109 3:10389851-10389873 CTGGGTCCCAGCTGTCCTCCTGG - Intronic
953372182 3:42398026-42398048 CCGGTTTCCACGGGTCTTCCAGG + Intronic
953981303 3:47414483-47414505 CTGGTCCCCAGGGGCCTTCCAGG - Intronic
954152269 3:48663466-48663488 CTGGTCCCCAGCAGTCTCCCGGG + Intergenic
954228691 3:49199661-49199683 CAGGATACCAGCGGTCCTCCCGG + Intronic
956847461 3:73196515-73196537 CCTATTCCCAGGGGGCTTCCAGG - Intergenic
960047537 3:113212159-113212181 CCGGGTCCCAGCGCTCGGCCGGG + Intronic
962283988 3:134071620-134071642 CCTCTTCCCAGAGGGCTTCCAGG + Intronic
962374295 3:134847313-134847335 CCTAGTCCCAGCTGTCTTCCTGG - Intronic
968750649 4:2387201-2387223 CGGGTTCCCAGTGGACTGCCAGG - Intronic
969555062 4:7902199-7902221 TCAGTTCTCAGCGGGCTTCCCGG + Intronic
971230820 4:24799390-24799412 CCAGTCCCCAGTGGGCTTCCTGG - Intronic
985733099 5:1561861-1561883 CCAGTGCCCAGCCGTGTTCCTGG - Intergenic
988962885 5:36387142-36387164 CCTGTTCCTAGCCTTCTTCCTGG + Intergenic
989637933 5:43556598-43556620 CCAGCCCCCAGCGGCCTTCCCGG - Exonic
991198342 5:63961167-63961189 CGGGGTCCGAGCGGTCTTCCGGG + Exonic
1003508514 6:6759753-6759775 CCAGTTCACAGAGATCTTCCTGG - Intergenic
1004287000 6:14330336-14330358 CCAGTTCCCAGCCATCTTCCAGG - Intergenic
1007655557 6:43449236-43449258 CCGGCCCCCAGCCTTCTTCCTGG - Intronic
1013990780 6:116252207-116252229 CTGGATCCCAGCTGCCTTCCTGG - Exonic
1016806379 6:148216561-148216583 CCAGATGCCAGCGGTCTTCCTGG - Intergenic
1018254612 6:161905580-161905602 CCGCTTCCAAGCTGTCTTTCTGG + Intronic
1019378204 7:707493-707515 ACGGATCCCAGCGGCCTTCTTGG - Intronic
1034958426 7:155350223-155350245 CCGGCTTCCTGCGGTCTCCCGGG + Intergenic
1034958456 7:155350295-155350317 CCGGCTTCCTGCGGTCTCCCGGG + Intergenic
1034958466 7:155350331-155350353 CCGGCTTCCTGCGGTCTCCCCGG + Intergenic
1034958481 7:155350367-155350389 CCGGCTTCCTGCGGTCTCCCCGG + Intergenic
1034958497 7:155350403-155350425 CCGGCTTCCTGCGGTCTCCCGGG + Intergenic
1034958512 7:155350439-155350461 CCGGCTTCCTGCGGTCTCCCGGG + Intergenic
1034958526 7:155350475-155350497 CCGGCTTCCTGCGGTCTCCCCGG + Intergenic
1034958542 7:155350511-155350533 CCGGCTTCCTGCGGTCTCCCGGG + Intergenic
1034958556 7:155350547-155350569 CCGGCTTCCTGCGGTCTCCCCGG + Intergenic
1034958572 7:155350583-155350605 CCGGCTTCCTGCGGTCTCCCGGG + Intergenic
1034958586 7:155350619-155350641 CCGGCTTCCTGCGGTCTCCCCGG + Intergenic
1034958602 7:155350655-155350677 CCGGCTTCCTGCGGTCTCCCGGG + Intergenic
1034958616 7:155350691-155350713 CCGGCTTCCTGCGGTCTCCCCGG + Intergenic
1034958631 7:155350727-155350749 CCGGCTTCCTGCGGTCTCCCCGG + Intergenic
1049326967 8:142026723-142026745 CAGGTTCCCAGAGTTCTTCAGGG + Intergenic
1057230418 9:93318384-93318406 CCGGTTCCCTGGGCTCATCCAGG + Exonic
1057801403 9:98193156-98193178 TCGGTTCCCAGCGGCGCTCCCGG - Intergenic
1203432541 Un_GL000195v1:104114-104136 CAGGTTCCCTGGGTTCTTCCAGG - Intergenic
1185646413 X:1618865-1618887 CTGGTTCACAGCGGTGTTCAGGG + Intronic
1186152058 X:6685714-6685736 CAGGCACCCAGCGATCTTCCTGG - Intergenic
1195221249 X:102746543-102746565 CCGGCTCCCCCCGGCCTTCCCGG - Intronic
1200009691 X:153111655-153111677 CCGGCTCCCAGCCGTCTTATTGG + Intergenic
1200029909 X:153288267-153288289 CCGGCTCCCAGCCGTCTTATTGG - Intergenic