ID: 914838540

View in Genome Browser
Species Human (GRCh38)
Location 1:151228590-151228612
Sequence GAAGCATCCTGGATCCTTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 161}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914838540 Original CRISPR GAAGCATCCTGGATCCTTGA GGG Intronic
903546834 1:24129590-24129612 GAAGATTTCTGGATCCTTTAAGG - Intronic
905230785 1:36513926-36513948 GAAGGGTCCTGGCTCCTCGATGG - Intergenic
906072761 1:43029142-43029164 GAAACACCCTGGAGCATTGATGG + Intergenic
906541453 1:46589636-46589658 GAATCATCCTGGTTCCTGCAGGG + Intronic
907527816 1:55063956-55063978 GAAGAATCCTGCCTCCTTGGTGG - Exonic
909793564 1:79703868-79703890 GAAGAATCCTTGAACCTGGAAGG - Intergenic
910168135 1:84349328-84349350 GCAGCATCTTTGATCCTTAAGGG + Intronic
911072519 1:93843657-93843679 AGAGCATCCTGGTTCCTTGGGGG + Intronic
911467204 1:98270721-98270743 GAAGAAGCCTGGGTTCTTGATGG + Intergenic
914838540 1:151228590-151228612 GAAGCATCCTGGATCCTTGAGGG + Intronic
915744681 1:158146815-158146837 GAAGCTTCCTTGAGCCTTGAGGG - Intergenic
920362193 1:205426748-205426770 GAAGGATCCTGGAACCTGAAGGG - Intronic
920541920 1:206785185-206785207 GCAGATTCTTGGATCCTTGAAGG + Intergenic
922383068 1:225052909-225052931 GAAGCATCCTATGTCCCTGATGG - Intronic
924626763 1:245702164-245702186 GATCCATCCTGGATCCTCCATGG + Intronic
1067247538 10:44559078-44559100 AAAGGATCCTGGGTCCTTGATGG - Intergenic
1070714684 10:78710762-78710784 GAAAGCACCTGGATCCTTGATGG + Intergenic
1071769909 10:88716805-88716827 GAAGTATCCTGAAGGCTTGAGGG + Intergenic
1072703765 10:97664959-97664981 GAAGCATCCTGACTCCTGGAGGG + Exonic
1073466264 10:103696181-103696203 GAGGAATCCTGAATCCTTCAGGG + Intronic
1074440765 10:113475615-113475637 GATGCATTCTGAATCCTTGAAGG + Intergenic
1078730357 11:13968309-13968331 GAAGGAGCCTGGTTCCTGGATGG - Intronic
1078933721 11:15934447-15934469 AAAGCAGCCAGGATGCTTGAAGG + Intergenic
1079694338 11:23460396-23460418 TAAGGATACTGGGTCCTTGAAGG + Intergenic
1081684417 11:45032021-45032043 GAAGGAGCCTGGGTCCTTGATGG - Intergenic
1082983700 11:59147276-59147298 CAACCTTCTTGGATCCTTGATGG - Intronic
1083721147 11:64604131-64604153 CAGGCATCCTGGCTCCTTGGCGG - Intergenic
1083868047 11:65469062-65469084 GAAGCCTCCTGGTCCCTAGAGGG + Intergenic
1084743127 11:71151796-71151818 GAAGCAGCTTGGAGCCTGGACGG - Intronic
1085763398 11:79261463-79261485 GAAGCATCCTGGTTTCTTTTGGG + Intronic
1089867942 11:121648409-121648431 GGAAAATCCTGGATCTTTGATGG - Intergenic
1094221328 12:27996862-27996884 GAAATAACCTGGATCCTTGAGGG - Intergenic
1096797921 12:54090298-54090320 GAAGCAGCGTGGATCCAAGAAGG + Intergenic
1097393205 12:59040788-59040810 AAAGCTTCCTGGCTCTTTGAGGG + Intergenic
1098295734 12:69002190-69002212 GAAGGATTCTGCCTCCTTGATGG - Intergenic
1098896583 12:76069615-76069637 GAAGAGTCCTGGATCCCTTATGG + Intronic
1101712886 12:107284895-107284917 GGAGGATCTGGGATCCTTGATGG + Intergenic
1103300837 12:119925386-119925408 GAATAATCCTGCATCCTTGAAGG + Intergenic
1103957192 12:124583805-124583827 GAAAGAACCTGGGTCCTTGATGG - Intergenic
1106270639 13:28150206-28150228 GAAGCCTCCTTGATACATGATGG + Intronic
1110637805 13:77786767-77786789 AAAGCAGCCTGGATCCTAGCTGG + Intergenic
1115085070 14:29505668-29505690 GTAGTATCCAAGATCCTTGAGGG - Intergenic
1117580141 14:57143662-57143684 GAAGCTTCTTGGAAGCTTGATGG - Intergenic
1119675592 14:76551175-76551197 GAGGAATCCTGTATTCTTGAGGG - Intergenic
1122116034 14:99527722-99527744 GAAGCTGCCTGGGTCCTTGAGGG - Intronic
1122539110 14:102487043-102487065 GCAGCACCATGAATCCTTGAGGG + Intronic
1128555765 15:68630742-68630764 GAAGAGGCCTGGGTCCTTGATGG - Intronic
1130965455 15:88694418-88694440 AAACCATCCAGTATCCTTGAGGG + Intergenic
1131143604 15:89998095-89998117 GTATCTGCCTGGATCCTTGAGGG + Intergenic
1131549110 15:93341541-93341563 GAAGCATCCTGTACCATGGAAGG - Intergenic
1133700278 16:8302230-8302252 GACACATCCTGGAACATTGAGGG - Intergenic
1136252859 16:29017826-29017848 GGAGCATCCTGGAGCCCTGGAGG + Intergenic
1136578689 16:31139358-31139380 GAAGGGTCCTGGATCCTCGTGGG - Exonic
1138122730 16:54413522-54413544 GATGCATGCTGGATCCTGTAGGG - Intergenic
1140074750 16:71688006-71688028 GAAGGAGCCTGGGTCCTTGCTGG - Intronic
1141788939 16:86219882-86219904 GAAGGAGCCTGGAGCCTGGACGG + Intergenic
1144793173 17:17873156-17873178 GAAACATCCTGAGGCCTTGAAGG - Intronic
1151356600 17:73562246-73562268 GAACCATCCTGGTACCTTGGAGG - Intronic
1151526434 17:74672107-74672129 GAAGCTTTCTGGAGCCATGAGGG - Intronic
1152225025 17:79088826-79088848 GAAGCAACATGGCTCCTTGTGGG + Intergenic
1155357388 18:24966431-24966453 GAAAGAGCCTGGATCCTTGATGG + Intergenic
1156181548 18:34611496-34611518 GAAGAATCATGTATTCTTGAAGG + Intronic
1161454499 19:4363246-4363268 GCAGCATCCTGGATTCTTCCTGG - Intronic
1161995226 19:7707593-7707615 GAAGTATCCTGGGGCCTTGAGGG - Intergenic
1162275992 19:9655442-9655464 GAAGTAGCCTGCACCCTTGAGGG - Intronic
1162459201 19:10804135-10804157 GAAGCATCCTGGTGTCTTGGGGG - Intronic
1168339842 19:55616608-55616630 GAAGTAGCCGGGATCCTTGAAGG - Exonic
1168410256 19:56135480-56135502 GGAGGAACCTGGATCCTTCATGG - Intronic
924987680 2:287255-287277 GAAGCATCCAGGCTCCTTCATGG - Intronic
925551179 2:5076877-5076899 GAGCCTTCCTGGATACTTGAAGG + Intergenic
925994245 2:9278940-9278962 GGGGCATCCTGGAGCCTTGCTGG + Intronic
926235636 2:11041324-11041346 GCAGCAGCCTGGATCTTTGGAGG + Intergenic
926539505 2:14157819-14157841 GTAGCATCCTGAATTGTTGAGGG + Intergenic
926547047 2:14255215-14255237 GAAGCAGACAGGCTCCTTGATGG - Intergenic
927295886 2:21452766-21452788 GAAGCATTGTGGATCCACGAAGG - Intergenic
928058677 2:28087032-28087054 GAAGCATCCTTGTTAATTGAGGG + Intronic
928264672 2:29801540-29801562 GTGGCATCCCTGATCCTTGAAGG - Intronic
929438464 2:41947157-41947179 GCAGCCTTCTGGATCCTTGGTGG + Intronic
929573640 2:43039073-43039095 AGAGAACCCTGGATCCTTGAGGG - Intergenic
929934748 2:46286481-46286503 GAGGGATCCTGGACCCTGGAAGG - Intergenic
931146057 2:59519903-59519925 GAAGCATCCTGAATTCATTAGGG + Intergenic
932056619 2:68449485-68449507 GGAGCATCCTGGATCCTGGATGG - Intergenic
933848617 2:86347943-86347965 GATTATTCCTGGATCCTTGAGGG - Intergenic
935184577 2:100720606-100720628 GAATCATACTGGGTCCCTGAGGG + Intergenic
936478701 2:112865094-112865116 GGTGCATCCTGATTCCTTGAAGG + Intergenic
937840281 2:126518347-126518369 CCAGCATCCTGCATCCTTCAAGG - Intergenic
945112898 2:206380200-206380222 CAAGTCTCTTGGATCCTTGAGGG + Intergenic
1169760888 20:9092693-9092715 GAAGGAACCTGGTTCCCTGATGG - Intronic
1169855183 20:10094247-10094269 GATGGATCCTGGATCCTGGTGGG + Intergenic
1170171366 20:13417019-13417041 AAAGCATCCTGCATGTTTGATGG - Intronic
1171112134 20:22494100-22494122 GAAGCATCCTCAATCAATGAAGG - Intergenic
1171849758 20:30300123-30300145 GAAGCAGCGTGGATCCAAGAAGG + Intergenic
1175090985 20:56504060-56504082 GAAGCCCCCTGGTTCCTGGAGGG + Intronic
1175224601 20:57437661-57437683 GAAGGAACCTGGGTCCTTCAGGG - Intergenic
1175656128 20:60772673-60772695 GATGCTCCCTGGATCCTCGAAGG - Intergenic
1177772858 21:25536255-25536277 AAATCATCCTGCAACCTTGAGGG + Intergenic
1180122933 21:45765933-45765955 GAAGTCTCCTGGAGCCTGGAAGG + Intronic
1184100947 22:42341565-42341587 GAAGCCTCCTGCTTCCTTGGGGG - Intronic
1184932864 22:47693935-47693957 GAACCATCATGGTGCCTTGAGGG - Intergenic
949098652 3:116788-116810 CCATCAGCCTGGATCCTTGATGG + Intergenic
950527345 3:13532362-13532384 GAAGCTTCCTGGGCCCTTGGTGG + Intergenic
951275108 3:20675689-20675711 AAAGAATGCTGGATCCCTGAAGG - Intergenic
953965872 3:47306290-47306312 GAAGCATGTTGGACCTTTGATGG + Intronic
954897771 3:53991535-53991557 GAAGAATCCTCAGTCCTTGATGG - Intergenic
954943245 3:54393986-54394008 GAAGCATCCTAGACCCTGTATGG - Intronic
955747167 3:62151560-62151582 ACAGCACCCGGGATCCTTGAAGG + Intronic
956202794 3:66723683-66723705 GAAGCATCCATGATCAGTGAGGG - Intergenic
960041916 3:113158578-113158600 AAAGCAATCTAGATCCTTGATGG + Intergenic
962770698 3:138608319-138608341 GAAGAAACCTGCATCCTTTAAGG + Intergenic
965462626 3:168986381-168986403 GAAGAAGCCTGAATCCTTGCTGG + Intergenic
966710503 3:182967706-182967728 GAAGAATCCTAGACACTTGAGGG - Intronic
967302032 3:188023339-188023361 GAAGCATCCTTTTTCCTTAAGGG - Intergenic
970822835 4:20239113-20239135 GAAGAACCATGGATCCTAGAAGG - Intergenic
971482958 4:27130601-27130623 GAAGCATTCTGGGTCCTTAGAGG + Intergenic
972207763 4:36798595-36798617 GAAGCAACCTGCTGCCTTGAAGG + Intergenic
972246392 4:37249242-37249264 GAAGTAACCTGAGTCCTTGATGG - Intronic
973551373 4:52038557-52038579 GAAGCGTCCTCGATTTTTGAGGG - Intergenic
973941386 4:55914571-55914593 GAATCATGCTGGATCCTGGTGGG + Intergenic
973950447 4:56007582-56007604 GAAACATCATGGATACCTGAAGG - Intronic
982711852 4:158766306-158766328 GAAGCGAGCTGGGTCCTTGATGG - Intergenic
983091334 4:163506242-163506264 GAAGGATCCTGGATCCCTAAGGG + Intronic
984365676 4:178796862-178796884 GAAGGAAACTGGATCCTAGATGG - Intergenic
985960983 5:3303045-3303067 GAAGCATCCTGGAGGCTTGGGGG - Intergenic
986871147 5:12048437-12048459 ATAGCATTCTGAATCCTTGAGGG + Intergenic
989463764 5:41730573-41730595 GAAGCATCCCGGATAATAGATGG - Exonic
990127942 5:52541947-52541969 GATGCTTCATCGATCCTTGAAGG + Intergenic
996194226 5:120583690-120583712 GGAGGTTGCTGGATCCTTGAGGG + Intronic
998436932 5:142118245-142118267 ATATCATCCTGGATCCTGGATGG - Intronic
1001409342 5:171499259-171499281 GAAGACCCCTGGATGCTTGAAGG + Intergenic
1001881607 5:175249564-175249586 GAAGCATCCTGGAGACCTGTGGG + Intergenic
1004159088 6:13197687-13197709 GAATGATTCTAGATCCTTGAGGG - Intronic
1006523175 6:34583804-34583826 GAGACACCCTGGATCCCTGATGG - Intergenic
1008444236 6:51569992-51570014 GATGCAGCCTGGATCAATGATGG + Intergenic
1009517828 6:64642077-64642099 GAAAGATTCTGGCTCCTTGATGG + Intronic
1009771961 6:68154560-68154582 GCAGCATTCTTGAGCCTTGAAGG + Intergenic
1013661607 6:112303344-112303366 GAACCATCCTACATCGTTGATGG - Intergenic
1014054118 6:116993441-116993463 GAGCCATCTTGGTTCCTTGAAGG - Intergenic
1017655700 6:156627217-156627239 GAGGGAGCCTGGATCCTTCATGG + Intergenic
1017749715 6:157479967-157479989 GAAGCTGCCAGGATCCTCGAGGG + Intronic
1021185742 7:17562723-17562745 AAAAGATCCTGGATCTTTGATGG + Intergenic
1022316822 7:29253212-29253234 GAAGAAGCCTGGGTCCCTGATGG - Intronic
1022554307 7:31276447-31276469 GAAGCCCCCTGCATCCTTGCAGG - Intergenic
1024139831 7:46451072-46451094 GAAGCATCCAAGATACTTGGTGG + Intergenic
1024440840 7:49415875-49415897 GAAGCCACCTGGGTCCTTGGAGG - Intergenic
1024630641 7:51244133-51244155 GTTTCATCCTGGAGCCTTGAGGG - Intronic
1029415669 7:100441752-100441774 TCAGCATCCAGGGTCCTTGAAGG + Intergenic
1029472283 7:100762156-100762178 GAAGCAGCCTCGGTCCTCGAGGG - Intronic
1034135407 7:148763252-148763274 GAAGCACACTGCTTCCTTGAAGG - Intronic
1034849970 7:154484445-154484467 GAAGCCTCCTGCATCCTTCAAGG + Intronic
1035761017 8:2068816-2068838 GCAGCATCCTGGCTCCTACACGG + Intronic
1037700963 8:21273437-21273459 GAACCATCCTGAATCCAGGAAGG + Intergenic
1037727623 8:21496088-21496110 GAATCATTCTGGATCCTGGGAGG - Intergenic
1037946919 8:22995584-22995606 GAAGCTTCCTGTATCCTTGTGGG + Intronic
1038614759 8:29082780-29082802 TAAGCATCCTTAATCCTTCATGG - Intronic
1039982133 8:42416705-42416727 GGAGAATCCTGGATGCTGGATGG - Exonic
1040866792 8:52055587-52055609 CAAGCATCCTGAAACCATGAAGG + Intergenic
1041926720 8:63244369-63244391 CAAGCATCCAGGAAGCTTGAAGG - Intergenic
1043182395 8:77102562-77102584 GAAGCTGCCTGGATTATTGAGGG - Intergenic
1044121413 8:88401143-88401165 GAAGAAGCCTGGGTCCTTGCAGG - Intergenic
1048194740 8:132323057-132323079 GAAGCTTCCCGGATCCGTGATGG - Intronic
1048575551 8:135687118-135687140 TAAGCATCCTGCATGCTGGAGGG + Intergenic
1049959148 9:721690-721712 GAACCAACCTGAAGCCTTGAGGG - Intronic
1050256070 9:3793492-3793514 GAATCATCCTGGATTATTGTAGG - Intergenic
1053787531 9:41663416-41663438 GAAGCAGCGTGGATCCAAGAAGG + Intergenic
1054157591 9:61651351-61651373 GAAGCAGCGTGGATCCAAGAAGG - Intergenic
1054175810 9:61874753-61874775 GAAGCAGCGTGGATCCAAGAAGG + Intergenic
1054477365 9:65582356-65582378 GAAGCAGCGTGGATCCAAGAAGG - Intergenic
1054661729 9:67706055-67706077 GAAGCAGCGTGGATCCAAGAAGG - Intergenic
1055896516 9:81182822-81182844 GAAGCAGCCTGGAGCCGTGGAGG - Intergenic
1055986311 9:82058955-82058977 GAATGATCATGGGTCCTTGAAGG - Intergenic
1056611847 9:88130762-88130784 GAATGATCATGGGTCCTTGAAGG - Intergenic
1056778437 9:89531584-89531606 GAAGCTTCCTGGACCCATGAGGG - Intergenic
1057160861 9:92887228-92887250 GAATGATCATGGGTCCTTGAAGG + Intergenic
1058163957 9:101599610-101599632 GAAGAAACCAGGAGCCTTGATGG + Intronic
1058716321 9:107725410-107725432 GAAGCATCCTAGATCTTTCCCGG - Intergenic
1061103818 9:128513617-128513639 GGAGGATCCTTGATCCTGGAAGG + Intronic
1062131532 9:134896734-134896756 CAAGCATGCTGGATACGTGATGG - Intergenic
1188065054 X:25648529-25648551 GAAGCATCATGAATGCCTGAAGG - Intergenic
1188289823 X:28373343-28373365 GAAGGATCCTGGAACCTCCATGG - Intergenic
1189085756 X:38021819-38021841 TAAACAGCCTGGATTCTTGAGGG + Intronic
1195143065 X:101983519-101983541 GAATCATCTGGGATCCTTGGCGG + Intergenic