ID: 914839202

View in Genome Browser
Species Human (GRCh38)
Location 1:151233818-151233840
Sequence CTCCAATAGCAATCAGAGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 102}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914839202_914839205 -6 Left 914839202 1:151233818-151233840 CCTTACTCTGATTGCTATTGGAG 0: 1
1: 0
2: 0
3: 4
4: 102
Right 914839205 1:151233835-151233857 TTGGAGGTTCTGGAGAAGTTAGG 0: 1
1: 0
2: 0
3: 27
4: 286

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914839202 Original CRISPR CTCCAATAGCAATCAGAGTA AGG (reversed) Intronic
900709616 1:4105333-4105355 CTCTAATAACAGTCAGAGTCTGG - Intergenic
908964485 1:69741649-69741671 CTCCAAAAGTATTCAGAATAGGG + Intronic
912089373 1:106051952-106051974 CTCCAACTGGAATGAGAGTAAGG + Intergenic
912571319 1:110625368-110625390 CTCATATAACAATGAGAGTAGGG + Intronic
914437532 1:147672908-147672930 CTCCAAAAGAAACCAGAGTGAGG + Intergenic
914839202 1:151233818-151233840 CTCCAATAGCAATCAGAGTAAGG - Intronic
915933459 1:160075438-160075460 CTCTACTAACAATCAGAGTGAGG + Intergenic
923670737 1:236038569-236038591 ATCCAATAGCAATCTCAGGATGG + Intronic
1065917944 10:30367995-30368017 CTCCCACAGCCATCAGAGCAGGG + Intronic
1069504001 10:68980391-68980413 CTCCATTAGCAAACACAGCAAGG - Intronic
1073815832 10:107205539-107205561 CTCCAATAACACTATGAGTATGG - Intergenic
1077753477 11:5000499-5000521 CTAGAATAGCAATGAGAGAAAGG - Intergenic
1079333826 11:19553994-19554016 TTCCCCTAGCAATCAGAGAAGGG + Intronic
1089049698 11:115535589-115535611 CTCCATTCGCAATAAGAATATGG - Intergenic
1089655882 11:119946644-119946666 CTACAACAGCACTCAGAGCAGGG + Intergenic
1089997770 11:122925343-122925365 CTCCAAAAGGAATCAGATTTGGG - Intronic
1101770532 12:107746330-107746352 CTCCAATAGAGAGCAGAGCAAGG - Exonic
1102075356 12:110055671-110055693 CTCCCCTAGCAATCAGGGAATGG + Intronic
1102444023 12:112987496-112987518 CTCCAAAGACAATCAGGGTATGG - Intronic
1102455320 12:113067214-113067236 CTCCAACTGCAAGCAGAGCACGG + Intronic
1106965740 13:35064635-35064657 CTCCAAAAACAGTCAGATTACGG - Intronic
1108588564 13:51892457-51892479 CAACAATACCAAGCAGAGTAGGG - Intergenic
1118659736 14:67995564-67995586 CTCCAATAGTATTCAGAGGGGGG - Intronic
1122821628 14:104349291-104349313 CACCAATAGATAACAGAGTAGGG - Intergenic
1124822324 15:33058603-33058625 CTCAAATAGGAATCAAAGAAGGG - Intronic
1125578625 15:40770853-40770875 CTCCACCAGCACTCAGAGAAGGG + Exonic
1126146922 15:45483328-45483350 CTCCTCTAAGAATCAGAGTAGGG - Exonic
1127905303 15:63371906-63371928 CTAAAAAAGCTATCAGAGTAAGG + Intronic
1130259511 15:82344437-82344459 CTCCCACAGCCATCAGAGCAGGG + Intronic
1130269167 15:82434731-82434753 CTCCCACAGCCATCAGAGCAGGG - Intronic
1130473123 15:84240911-84240933 CTCCCACAGCCATCAGAGCAGGG - Intronic
1130502758 15:84511583-84511605 CTCCCACAGCCATCAGAGCAGGG + Intergenic
1130595408 15:85245501-85245523 CTCCCACAGCCATCAGAGCAGGG - Intergenic
1131188039 15:90292262-90292284 CTCCCACAGCCATCAGAGCAGGG - Intronic
1138074879 16:54032370-54032392 CTCCAAAACCAATTTGAGTATGG + Intronic
1140259227 16:73362818-73362840 CTAAAATAGCAAACAGAGTACGG + Intergenic
1142702487 17:1672247-1672269 CTCTAATGGAAACCAGAGTAAGG + Intronic
1147703047 17:42407912-42407934 CTCCAGTAGCAGGCAGGGTAAGG - Intronic
1147966751 17:44198340-44198362 CTCCACTGCCAATCAGAGTCTGG + Intronic
1149039384 17:52169767-52169789 ATCTAGTAGCAATCAGAGAACGG - Intergenic
1154106308 18:11526840-11526862 CAACAACAGCAATCAGAGAAAGG - Intergenic
1155247148 18:23921564-23921586 TTCCAATTGCAATCAGGGAAAGG + Exonic
1156234332 18:35186765-35186787 CTCTAATAGGAATCAAATTAGGG + Intergenic
1159843099 18:73423938-73423960 CTTCAGTAGCAAACAGAGAATGG + Intergenic
1160478490 18:79216557-79216579 CTTGACTAGCAATCAGGGTAGGG - Intronic
1167933467 19:52887458-52887480 CTCCAACAGCATTCAGAATGAGG - Intronic
1168060819 19:53891139-53891161 CTCCATTAGGAACCAGAGTTTGG - Intronic
925230141 2:2225799-2225821 CCACAATAGCAATCTGAGGAGGG + Intronic
927954580 2:27199644-27199666 CTCCAAAAGGAAACAGAGCACGG + Exonic
927989009 2:27434210-27434232 CTGCAATGGCGATAAGAGTAGGG + Intronic
928186887 2:29118429-29118451 TTCCTATAGAAATCAGAGTTTGG + Intronic
928417226 2:31105771-31105793 CTCCAGTAGCAATGAGTGCATGG - Intronic
935362832 2:102262247-102262269 CAAAAATAGCAATCAGAGTGAGG + Intergenic
939146652 2:138423792-138423814 ATCCAATAGCAACCAAAGAATGG - Intergenic
939675326 2:145065329-145065351 CTGGAATTGCATTCAGAGTAAGG + Intergenic
940978161 2:159970199-159970221 TTTCAATAGCTATCAAAGTATGG - Exonic
941220086 2:162767485-162767507 CTCCAATAGCAGTAAAACTATGG - Intronic
941774625 2:169379002-169379024 CTCCAACAGAAATCACAGTAGGG + Intergenic
942298195 2:174537376-174537398 CTCCAATAGAAATAAGAACAGGG + Intergenic
1172812439 20:37658457-37658479 CTCCATTAGCAATCATAGCAGGG + Intergenic
1177017265 21:15807585-15807607 CACCAACAGCCACCAGAGTACGG - Intronic
1180122990 21:45766310-45766332 CTCCAAAAGCAGTCATACTAGGG - Intronic
1181373784 22:22440151-22440173 CTCTGATAGACATCAGAGTAGGG - Intergenic
950315742 3:12000574-12000596 CTCCCACAGCAATCGGTGTAGGG - Intergenic
951936800 3:28031315-28031337 CTCCAATTACAATCACATTAGGG - Intergenic
952060694 3:29505437-29505459 CTACAATAATAAACAGAGTATGG - Intronic
956486522 3:69728701-69728723 CTCAAATAGAAATCAGAAGAGGG - Intergenic
958890530 3:99777471-99777493 CCCTAATAGCAAACAGATTAAGG - Intronic
963935048 3:151043612-151043634 CTCCAATAACACTCTGAGAAAGG + Intergenic
965067024 3:163863147-163863169 CTCCAACAGCAAGAAGATTATGG + Intergenic
967382144 3:188870736-188870758 CTCCGATAGCAATTCGAGGAGGG - Intronic
969172188 4:5373121-5373143 CTCAAACAGAAAACAGAGTAAGG + Intronic
970679135 4:18487350-18487372 CTCAAAGAGCAATCAGAAAAAGG - Intergenic
971114681 4:23631060-23631082 GTCCCATAGGAATAAGAGTAGGG - Intergenic
979520664 4:121662823-121662845 CTCCACTAGCAAAAAGACTATGG - Intergenic
987449174 5:18060768-18060790 CTCCAAACACACTCAGAGTAGGG - Intergenic
993723133 5:91341420-91341442 CTCCTAGAGCAGCCAGAGTAGGG - Intergenic
1009515233 6:64607714-64607736 CACCAAAAGAAATCTGAGTATGG + Intronic
1011921684 6:92585351-92585373 CACCAATAGAAATCAGATAATGG - Intergenic
1013552005 6:111217094-111217116 CTCCAATAGCAGTCAGGCTAGGG - Intronic
1013831371 6:114276588-114276610 CTCCAAAAGCTATGAGAGTGTGG + Intronic
1014659364 6:124148916-124148938 CACCAACAGCATTGAGAGTAAGG + Intronic
1014780978 6:125564298-125564320 CTCCAACAGTCATCAGAATAAGG - Intergenic
1015427287 6:133086219-133086241 CTTCAATAGTAAACAGAGTTTGG - Intergenic
1016869789 6:148805664-148805686 TTCCAACAGCATTCAGAATACGG + Intronic
1017637242 6:156455688-156455710 CTCCCATAGCAAGCAGAAGAGGG + Intergenic
1020210145 7:6152882-6152904 GTCCAAGAGAAATCAGAGAAAGG + Intronic
1023213034 7:37829131-37829153 CTCCAGTCCCAGTCAGAGTAGGG + Intronic
1027028342 7:74870719-74870741 CTCCCAAAGCACTCAGATTATGG + Intergenic
1028318398 7:89433024-89433046 CATCATTAGCAATCAGAGAAAGG - Intergenic
1037596248 8:20356833-20356855 TGCCAGTAGCAATCACAGTAAGG - Intergenic
1038911169 8:31966347-31966369 CTGGAAAAGCAATAAGAGTAGGG + Intronic
1039264547 8:35809924-35809946 CAGAAATAGCAATCAGAATATGG + Intergenic
1043209941 8:77500222-77500244 TTACAATACCAATGAGAGTATGG + Intergenic
1056959233 9:91107183-91107205 CTCCATTAGCAACAAGATTATGG - Intergenic
1058279253 9:103091078-103091100 CCCCTCTAGCAATCAGACTATGG - Intergenic
1060421498 9:123472693-123472715 CTGCAGAAGCAAGCAGAGTATGG + Intronic
1061532652 9:131227221-131227243 CATCACCAGCAATCAGAGTAGGG + Intronic
1186101489 X:6162240-6162262 CTCCATCAGCAACCAGAGAAGGG + Intronic
1186500711 X:10048136-10048158 CTCCAATACAAACCAGAGTGGGG + Intronic
1190735452 X:53252853-53252875 CTTCAATAGCACTCAGAGCTGGG + Intronic
1200322985 X:155209263-155209285 CTCCAATACTAATCACAGTTGGG - Intronic
1201311038 Y:12598369-12598391 CTCCTATAGCAAATAGAGGAGGG + Intergenic
1202367070 Y:24172798-24172820 CTCCCACAGCCATCAGAGCAGGG - Intergenic
1202373356 Y:24212871-24212893 CTCCCACAGCCATCAGAGCAGGG + Intergenic
1202497425 Y:25457249-25457271 CTCCCACAGCCATCAGAGCAGGG - Intergenic
1202503711 Y:25497325-25497347 CTCCCACAGCCATCAGAGCAGGG + Intergenic