ID: 914845735

View in Genome Browser
Species Human (GRCh38)
Location 1:151282636-151282658
Sequence CCTGGCGCCCCCGGCTCGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 88}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914845727_914845735 1 Left 914845727 1:151282612-151282634 CCAGGAGGGTCGAGAACCCCAGG 0: 1
1: 0
2: 2
3: 15
4: 285
Right 914845735 1:151282636-151282658 CCTGGCGCCCCCGGCTCGAGAGG 0: 1
1: 0
2: 0
3: 7
4: 88
914845726_914845735 2 Left 914845726 1:151282611-151282633 CCCAGGAGGGTCGAGAACCCCAG 0: 1
1: 0
2: 0
3: 20
4: 312
Right 914845735 1:151282636-151282658 CCTGGCGCCCCCGGCTCGAGAGG 0: 1
1: 0
2: 0
3: 7
4: 88
914845724_914845735 4 Left 914845724 1:151282609-151282631 CCCCCAGGAGGGTCGAGAACCCC 0: 1
1: 0
2: 0
3: 11
4: 99
Right 914845735 1:151282636-151282658 CCTGGCGCCCCCGGCTCGAGAGG 0: 1
1: 0
2: 0
3: 7
4: 88
914845719_914845735 19 Left 914845719 1:151282594-151282616 CCGTAGCCGGGTAAACCCCCAGG 0: 1
1: 0
2: 0
3: 0
4: 34
Right 914845735 1:151282636-151282658 CCTGGCGCCCCCGGCTCGAGAGG 0: 1
1: 0
2: 0
3: 7
4: 88
914845723_914845735 13 Left 914845723 1:151282600-151282622 CCGGGTAAACCCCCAGGAGGGTC 0: 1
1: 0
2: 0
3: 12
4: 78
Right 914845735 1:151282636-151282658 CCTGGCGCCCCCGGCTCGAGAGG 0: 1
1: 0
2: 0
3: 7
4: 88
914845725_914845735 3 Left 914845725 1:151282610-151282632 CCCCAGGAGGGTCGAGAACCCCA 0: 1
1: 0
2: 1
3: 7
4: 111
Right 914845735 1:151282636-151282658 CCTGGCGCCCCCGGCTCGAGAGG 0: 1
1: 0
2: 0
3: 7
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914845735 Original CRISPR CCTGGCGCCCCCGGCTCGAG AGG Intronic
903059841 1:20661898-20661920 CCTGCCGCTCACGGCTCCAGGGG + Intergenic
904181468 1:28669167-28669189 CCCGGCGCCCCCGGACCGAGGGG + Intronic
904528948 1:31155396-31155418 CCCGCCGCCCCCGGCTCCTGAGG - Intergenic
905639207 1:39576884-39576906 CCTCGGGCCCCCGGGCCGAGTGG - Intergenic
907501958 1:54887384-54887406 CCTGGCACCCCCGCCTCGCGCGG - Intergenic
908389857 1:63674676-63674698 CTTGGCGTCCACGGCTTGAGAGG - Intergenic
914845735 1:151282636-151282658 CCTGGCGCCCCCGGCTCGAGAGG + Intronic
923260650 1:232264708-232264730 CCTGGCCCCCCCTGCTTCAGGGG + Intergenic
1074819222 10:117166433-117166455 CCTCGCACCCCAGGCTGGAGAGG + Intergenic
1076421459 10:130335193-130335215 CCTGCCGTCCCCCGCTCCAGGGG + Intergenic
1081860973 11:46333185-46333207 CCTCGCGTCCCCGGCCCGGGCGG + Intronic
1084888006 11:72223391-72223413 CCTTCCGCCCTCGGCTGGAGGGG + Intergenic
1088143954 11:106652231-106652253 CCTGGTGCCCTTGGCTCCAGTGG - Intergenic
1089012587 11:115143099-115143121 CCTGACTCCCCTGGCCCGAGTGG + Intergenic
1096557413 12:52411902-52411924 CCTGGGGCCACAGGCTCCAGTGG - Intergenic
1102124478 12:110469052-110469074 CATGGGGCCCCCGGGTCGTGAGG + Intronic
1104961491 12:132490353-132490375 CCTGGGACCCCCGGCGCGGGCGG - Exonic
1113887145 13:113666991-113667013 TCTGGGGCCCCTGGCTGGAGAGG - Intergenic
1115314286 14:32009966-32009988 CCTGGCACCCCCAACTCGGGTGG - Intronic
1119703247 14:76769052-76769074 CCGGGCTCCCCTGGCTGGAGAGG + Intronic
1122081815 14:99272049-99272071 CCTGGCGCCGCGGGCCCGGGGGG + Intergenic
1122416490 14:101552147-101552169 CCTGGCGGACCCGGCTGGGGTGG - Intergenic
1126142269 15:45448326-45448348 CCTGGCTCCCCTGGCTCTGGGGG + Intronic
1129925931 15:79364484-79364506 CATGGGGCTCCAGGCTCGAGGGG - Intronic
1132253154 15:100349797-100349819 CCGGCCGCCCCCTGCTGGAGGGG - Intergenic
1135290623 16:21234931-21234953 CCTTGAGCCCCAGGCTCAAGTGG + Intronic
1138104168 16:54278435-54278457 CCTGGTGCCCAAGGCTGGAGCGG - Intergenic
1138465445 16:57186548-57186570 CCGCCCGCCCCAGGCTCGAGCGG - Exonic
1146956265 17:36937949-36937971 CCCGGGGCCCCGGGCTGGAGCGG - Exonic
1147994719 17:44354428-44354450 CCTCGCCCCCCGGGCCCGAGTGG + Exonic
1148685163 17:49496763-49496785 CCGGGCGCCCCCGTCTCGTTAGG - Intronic
1152945349 17:83194905-83194927 CCTGGGGACCCCTGCTCCAGAGG + Intergenic
1153985023 18:10343922-10343944 CCTGGCCTCCCCTGCTGGAGGGG + Intergenic
1158643181 18:59220313-59220335 CCTGGCGCCCCGGGGGCGAGCGG + Exonic
1160185854 18:76675519-76675541 ACTGGCTCCCCAGGCTCCAGTGG + Intergenic
1160242248 18:77132455-77132477 TCTTGCGCCCCCGGCTCCCGCGG + Intronic
1160767459 19:814782-814804 CCTGGGGACCCCAGCTCCAGTGG + Intronic
1161338978 19:3730402-3730424 CCTGGCGCCCTGGGCTGGAGGGG - Exonic
1161828528 19:6586109-6586131 CCTGACGCCCCTGGCCCGAGGGG - Exonic
1161911531 19:7198122-7198144 GCTGAGGCCTCCGGCTCGAGGGG - Intronic
1164671343 19:30073812-30073834 CTTGGCGCTCCCTGCTGGAGGGG + Intergenic
1165237197 19:34431285-34431307 TCTGTCGCCCCAGGCTGGAGTGG + Intronic
1166121630 19:40690491-40690513 CCGGGCGCCCCCGCCTCCCGCGG + Exonic
1166852306 19:45766674-45766696 CCTGGGGCCCCTGGCCCAAGTGG - Exonic
1166960416 19:46493369-46493391 GCTGGCGCCCCCGGCCTGCGAGG + Exonic
1167638666 19:50668638-50668660 CCTTGCGGCCGCGGCCCGAGCGG + Exonic
1168121921 19:54256488-54256510 CCTGTCGCCACCAGCTCCAGGGG + Exonic
926152605 2:10433134-10433156 CCAGGCCCTCCGGGCTCGAGCGG + Intergenic
927168771 2:20350955-20350977 CAGGGCGCCCCCGGCCCGCGCGG - Intronic
931869042 2:66439904-66439926 CCCGCCACCCCCGGCTCGCGGGG - Exonic
932567280 2:72917874-72917896 CCTGGCGCCGCCGCCTTGCGGGG - Exonic
934647202 2:96065830-96065852 CCTGGGGCCCCCAGATCTAGAGG - Intergenic
939619710 2:144403949-144403971 CCTACCGCACCCAGCTCGAGCGG - Exonic
1170420938 20:16192643-16192665 CCTGGAGGCAACGGCTCGAGTGG - Intergenic
1172799233 20:37564613-37564635 GCTGGCGCCCCCTGCGGGAGCGG - Intergenic
1173245538 20:41335149-41335171 CCCTCCGCCCCCGGCTGGAGAGG - Intergenic
1175358516 20:58389127-58389149 CCCTGCGCCGCCGGCTCCAGGGG - Exonic
1175847376 20:62065839-62065861 CCAGGCGCGCTCGGCCCGAGCGG - Intergenic
1175862576 20:62158080-62158102 CCTGGTGCCCCTAGCTGGAGGGG - Intronic
1180614945 22:17120821-17120843 CCTGGGGCCGCCGGCTCAGGTGG - Exonic
1181161976 22:20964952-20964974 CGGGGCGCCCCCGGCCAGAGCGG + Intergenic
1181636038 22:24175354-24175376 GCTGGCTCCCCCTGCTGGAGAGG + Intronic
1182351507 22:29702574-29702596 CCTGGAGCCCGGGGCTGGAGAGG + Intergenic
1182374677 22:29838012-29838034 CCTGGCGGCCAAGTCTCGAGAGG + Intronic
1183514322 22:38255057-38255079 TCTGTCGCCCCAGGCTGGAGGGG + Intronic
1183780346 22:39995216-39995238 CCTGGCGCTCCGGGCTGGAGAGG - Exonic
1184347415 22:43922324-43922346 CATAGCGCCCCCAGCTGGAGTGG - Intergenic
953027363 3:39152958-39152980 CCGGGCGCCCCCGGCCGGCGGGG - Intronic
961202456 3:125055740-125055762 CCTGGCGCCCCTCGCGGGAGCGG - Exonic
961450461 3:127000097-127000119 CATGCCGCCCCCTGCTTGAGAGG - Intronic
961519533 3:127458892-127458914 CCTGGAGACCCCTGCTCTAGCGG - Intergenic
968405493 4:336737-336759 CCCGGTGGCCCCGGCTCCAGCGG + Intergenic
980481609 4:133395166-133395188 CCTGGAGCCACGGGCTGGAGAGG + Intergenic
986661691 5:10065447-10065469 GCTGGCTCCCTCGGCTTGAGGGG + Intergenic
991298178 5:65103059-65103081 CCGGTCGCCCCGGGCCCGAGCGG + Intergenic
994359981 5:98839636-98839658 CCCGGCGCCCCCGGAGCCAGCGG + Intergenic
1001998350 5:176180129-176180151 CCTGCCTCCCCGGACTCGAGTGG + Intergenic
1004501886 6:16216930-16216952 CCTGGCGGCCCCGGGCAGAGGGG + Intergenic
1006473115 6:34238920-34238942 CCTGGGGCCCCCTCATCGAGGGG - Intronic
1008673235 6:53794595-53794617 CCTGGCGCCCCCGGCGCGCAAGG + Intronic
1010489037 6:76452480-76452502 CCTGGAGCCGCGGGCTGGAGTGG - Intergenic
1013367384 6:109446274-109446296 GCTGGCGCTCCGGGCTGGAGAGG + Exonic
1018936727 6:168278647-168278669 CCTGGCCCCTCCTGCTGGAGAGG - Intergenic
1019456404 7:1130036-1130058 CCTGGCACCCTCGGGTGGAGGGG + Intronic
1021015421 7:15525752-15525774 CCAGGAGCCCCAGGCTGGAGAGG + Intronic
1033361334 7:140640713-140640735 CCCGCCGCCCCCGGCCCCAGCGG + Exonic
1039907511 8:41797691-41797713 CCGGGCGCTCCCGGCACGGGCGG + Intronic
1049212236 8:141392102-141392124 CCGCGCGCCCCCGCCCCGAGCGG - Intronic
1057178417 9:93015995-93016017 CCTGGTGCCCCAGGCTGGAAGGG + Intronic
1057716650 9:97501529-97501551 CCGGGCGCCCCCGAGTGGAGGGG + Intronic
1058851217 9:109013507-109013529 CCTGTCGCCGCCGCCTCGGGCGG - Exonic
1062575635 9:137205953-137205975 CCTGGCGTGCCCGCCTCGCGGGG + Intronic
1191085821 X:56565446-56565468 CCTGGCTCCACCGGCTCTGGTGG + Exonic
1192584115 X:72306626-72306648 CCAGGCGCCCCGGGGTCGGGTGG - Intronic
1195649736 X:107272513-107272535 CCTGCTGCCCCCAGCTGGAGGGG + Intergenic
1196825583 X:119737901-119737923 TCTGTCGCCCCAGGCTGGAGTGG + Intergenic