ID: 914847102

View in Genome Browser
Species Human (GRCh38)
Location 1:151289340-151289362
Sequence TGCAGACATCAGGCAGGGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 255
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 235}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914847102_914847107 -7 Left 914847102 1:151289340-151289362 CCCAACCCTGCCTGATGTCTGCA 0: 1
1: 0
2: 2
3: 17
4: 235
Right 914847107 1:151289356-151289378 GTCTGCACTGTCCTCACTTCAGG 0: 1
1: 0
2: 0
3: 8
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914847102 Original CRISPR TGCAGACATCAGGCAGGGTT GGG (reversed) Intronic
901736249 1:11314014-11314036 CGCATTCATCAGGCAGGGATTGG + Intergenic
902215945 1:14934693-14934715 TGGAGGCATCAGGCAGGGACTGG + Intronic
903128786 1:21264944-21264966 TGCAGCGATCAGGAAGGGATGGG - Intronic
904270936 1:29349613-29349635 GCCAGACAGCAGACAGGGTTGGG + Intergenic
905003227 1:34689759-34689781 TACAGAGAGCAGGCAGGCTTGGG - Intergenic
905645764 1:39624218-39624240 TGGAGACACCAGGAAGGCTTGGG + Exonic
908831282 1:68180984-68181006 TGTAGACAATAGGTAGGGTTGGG + Intronic
909551900 1:76907349-76907371 TGCTGCCACCAAGCAGGGTTGGG - Intronic
914847102 1:151289340-151289362 TGCAGACATCAGGCAGGGTTGGG - Intronic
915323067 1:155066706-155066728 TGCAGGCATAACGCAGGGGTGGG - Intronic
915603964 1:156939381-156939403 CGCCGATATCAGGCAGGCTTTGG - Intronic
916028230 1:160853982-160854004 TGCATACACCAGGCAGGCCTTGG - Intronic
917981274 1:180271270-180271292 TGCCTACAGCAGGCAGGCTTAGG + Intronic
922903600 1:229157219-229157241 TGCAGAAGGCAGGCAGGGTGAGG + Intergenic
923055569 1:230424430-230424452 TGCAGACCTCTGGCAGGCTGCGG - Intronic
923451123 1:234118289-234118311 CACAGACATCAGGCAGGGACTGG + Intronic
924413217 1:243829069-243829091 TGAAGAGATTAGGCAGGGATAGG - Intronic
924601309 1:245492099-245492121 AGCAGACATCAGGAAGGGCCTGG - Intronic
1067427523 10:46221113-46221135 TGCAGGCAGCAGGCAGGAGTGGG + Intergenic
1067582953 10:47457048-47457070 TGCAGGCAGCAGGCAGGAGTGGG + Intergenic
1068549228 10:58386971-58386993 TGCTCACATCAGGCTGGGTGAGG + Intronic
1069298342 10:66875239-66875261 TGCAGACATGAGGAAGGGCCAGG + Intronic
1069897247 10:71687408-71687430 TGCAGGCCTCAGGAAGGGATGGG - Intronic
1070757211 10:79000824-79000846 TGCAGCCATGAGGCAGGGCTGGG - Intergenic
1071979365 10:90988067-90988089 GGCAGCCACCCGGCAGGGTTAGG - Intergenic
1072298876 10:94039674-94039696 TGGAGAAATCAGGCTGGGTGTGG - Intronic
1072338747 10:94424880-94424902 TGCACAATTCACGCAGGGTTTGG + Intronic
1072578659 10:96721450-96721472 AGCAGAGATGAGGCAAGGTTAGG + Intergenic
1073106108 10:101032871-101032893 TGCAGCCATCTGGCTGAGTTGGG - Intronic
1073434169 10:103506208-103506230 AGCAGACACCAGGCAGGGGCTGG - Intronic
1075741785 10:124700441-124700463 TGCAGACCTCAGCTAGGGCTCGG - Intronic
1076283871 10:129274906-129274928 TGCAGACCCCAGGCAGGGCCTGG - Intergenic
1076508294 10:130993502-130993524 TGAAGAAAACAGGCAGTGTTTGG + Intergenic
1079514339 11:21249035-21249057 TCCTGACTTCAGGCAGGGCTGGG - Intronic
1079730351 11:23933185-23933207 GACAGACAGCAGGCAGGATTTGG - Intergenic
1079882628 11:25945227-25945249 TGAAGTGATCAGGCAGGGGTAGG - Intergenic
1080429001 11:32181648-32181670 TCCAGAGATCAGGCTGGGTGTGG - Intergenic
1081343733 11:41957172-41957194 TGTAGAGAGCAGGAAGGGTTAGG - Intergenic
1081413706 11:42788648-42788670 TGCAGGCTTCTGGCAGAGTTGGG - Intergenic
1082255250 11:50027092-50027114 TGCACACAGCAGGAAGGCTTTGG - Intergenic
1082992720 11:59222123-59222145 TGCAGATATCAGGCAAAGATGGG - Intergenic
1088225497 11:107615521-107615543 TGCTGACAACAGGCTGGGTGTGG - Intronic
1089257707 11:117202608-117202630 AGCAGACAGCAGGCTGGATTTGG - Exonic
1089488093 11:118862643-118862665 TGCAGAGATCTGGCCGAGTTTGG + Intergenic
1091319926 11:134642125-134642147 TGCAGACATCAGCAACGGCTCGG + Intergenic
1093690306 12:22102224-22102246 TGAAGTGATCAGGCAGGGTCAGG + Intronic
1096089614 12:48890167-48890189 TGCAGAACTCAGGCAGGGCAGGG + Intergenic
1096273886 12:50189300-50189322 AGGGGACATCAGGGAGGGTTTGG - Intronic
1096514062 12:52146742-52146764 GGCAGGCAGCAGGCAGGGGTGGG - Intergenic
1097732583 12:63146302-63146324 AGCAGAGATGAGACAGGGTTGGG - Exonic
1102373807 12:112404632-112404654 TGCACAAATCTGGCAGGGTGTGG + Intergenic
1103207147 12:119138857-119138879 TGTAGACATCATGGAGGGTGAGG + Intronic
1103219591 12:119232508-119232530 TGCAGACAGCAGGCAGGGCTGGG + Intergenic
1103308213 12:119983165-119983187 TCCCGACATCAGGCAGGGCAGGG + Intergenic
1103335229 12:120184275-120184297 TGCAGACCTCAGGCAGAGGCAGG + Intronic
1103874060 12:124113802-124113824 TGCAGAAGCCAGGCAGGGCTTGG - Intronic
1103915066 12:124371979-124372001 TGCAGACAAAAGCCAAGGTTAGG + Intronic
1105439196 13:20401877-20401899 TGCGGATATCAGGCATGTTTTGG - Intergenic
1105915458 13:24911473-24911495 TTCATTCATCAGGCAGGGGTTGG + Intronic
1107808962 13:44180975-44180997 TGCAGACATCCAGGAGAGTTGGG + Intergenic
1110617508 13:77557664-77557686 AGCAGACATTTGGCAAGGTTGGG + Intronic
1112716537 13:102192421-102192443 TGAAGACAACAGGAAGGGTGTGG - Intronic
1114634837 14:24181680-24181702 GGGAGACATCAGGCAGGGCTTGG - Intronic
1116335072 14:43647391-43647413 TGAAGACATCACCCAAGGTTCGG - Intergenic
1117987421 14:61401149-61401171 CTCAGACATCAGGCATGGATGGG + Intronic
1120183643 14:81370062-81370084 TGAAGGCTTCAGGCAGGATTTGG - Intronic
1121302277 14:92881244-92881266 AGCAGACAAGTGGCAGGGTTGGG - Intergenic
1122060508 14:99133902-99133924 TGCAGACATCTGGATGGGTCTGG - Intergenic
1122921461 14:104882102-104882124 TGCTGCCATCAGGAAGGGCTGGG + Intronic
1123068699 14:105630603-105630625 TGCTGGCATCATGCAGGGTGGGG + Intergenic
1123072695 14:105649406-105649428 TGCTGGCATCATGCAGGGTGGGG + Intergenic
1123098286 14:105776631-105776653 TGCTGGCATCATGCAGGGTGGGG + Intergenic
1123908715 15:24945566-24945588 TACAGGCAGCAGGCAGGATTTGG + Intronic
1126407794 15:48339639-48339661 TGGAGAAATAAAGCAGGGTTTGG + Intronic
1126705531 15:51401927-51401949 TGCAGACCCCAGGCAGGGGCTGG - Intronic
1127996968 15:64158743-64158765 GGCAGAAAAGAGGCAGGGTTAGG - Intronic
1128049313 15:64649573-64649595 TTAACCCATCAGGCAGGGTTTGG - Intronic
1130876026 15:88015396-88015418 GGCAGACAGGGGGCAGGGTTTGG - Intronic
1134213425 16:12297112-12297134 TGCAGAAAGAAGACAGGGTTAGG + Intronic
1135595785 16:23741863-23741885 AACAGGCAGCAGGCAGGGTTTGG - Intergenic
1135721531 16:24822280-24822302 TGTAGACCTCAGGCAGGCTGTGG + Intronic
1137943401 16:52710757-52710779 TGCAGACATCAGCTGGGGCTTGG - Intergenic
1138312107 16:56035242-56035264 TACAAAGATCAGGCAGGGTGTGG - Intergenic
1139361165 16:66401122-66401144 TGCAGATTGGAGGCAGGGTTGGG - Intronic
1140584639 16:76275089-76275111 TGCAGCCATCAGGCAGAGACAGG + Intergenic
1141327059 16:83070812-83070834 TATATAAATCAGGCAGGGTTAGG + Intronic
1141625869 16:85260805-85260827 TGCAGATGTCATGCAGGGGTGGG - Intergenic
1141713808 16:85715680-85715702 AGCAGGCATCAGGCAGGATTGGG + Intronic
1142178938 16:88657871-88657893 TGCTGACAACAGGGAGGGATGGG + Intronic
1142699493 17:1650432-1650454 TGGAGACCTGAGGCAGGGCTGGG - Intergenic
1143098106 17:4489280-4489302 TGCAGCCAACAGGGAGGGCTGGG - Intergenic
1143432637 17:6898403-6898425 TTCAGGCATGAGGCAGGTTTGGG - Intronic
1144058627 17:11562013-11562035 GGCTAACATCAGGCTGGGTTGGG - Exonic
1144164165 17:12591488-12591510 AGCAGAGATCAGGCAGGGAGGGG + Intergenic
1144844399 17:18208820-18208842 TGCAGACATCAGTGAGGGAAAGG - Exonic
1147459950 17:40561871-40561893 TTCAGACAGTAGGCAGGGATGGG + Intronic
1148047105 17:44750901-44750923 TGCAGACATAAGCCACGGTCTGG - Exonic
1148820148 17:50355367-50355389 CCCAGACATCAGCCAGGGGTAGG + Intronic
1149454559 17:56777398-56777420 TGCAGAGATGGGGCAGGGGTGGG - Intergenic
1151268418 17:72974388-72974410 TGCAAACATTAGGCCGGGTGTGG - Intronic
1151450029 17:74193025-74193047 TGAGGCCATCAGGCAGGGTGTGG + Intergenic
1152679171 17:81656834-81656856 TTCAGAGATCAGGCAGGGTCAGG - Intronic
1154354403 18:13614057-13614079 TGAAGTCATCAGGAAGTGTTTGG + Intronic
1155299747 18:24418473-24418495 TAGAGACAGGAGGCAGGGTTGGG - Intergenic
1155368850 18:25077149-25077171 TGCGGTCATCAGCCCGGGTTAGG + Intronic
1159318959 18:66820595-66820617 TGCAGATGTCAGCCAGGATTTGG - Intergenic
1160095836 18:75872081-75872103 CGCAGATATCAGGCAGGCTGCGG - Intergenic
1161619041 19:5288885-5288907 CGCAGACATCAGGGAGGTGTGGG - Intronic
1163042969 19:14616263-14616285 TGAAGAAATGAGGCAGGGCTGGG - Intergenic
1163300052 19:16439399-16439421 TGCAGACATGAGGCCGGGCACGG + Intronic
1163784813 19:19269583-19269605 TGCAGACATCAGGGAAGGGATGG + Intronic
1165078745 19:33295693-33295715 TGCAGCCATCAAGCTGGGGTGGG - Intergenic
1165095601 19:33408139-33408161 TGCGTACATCAAGCGGGGTTTGG - Intronic
1165277695 19:34769318-34769340 TGCAGGGATCAGGGAAGGTTGGG + Intronic
1165756399 19:38295776-38295798 TGCACCCATCAGGCAGGCCTGGG - Intronic
1166718932 19:44986584-44986606 TGCAGGCAGCTGGCAGGGCTGGG - Intronic
1166882601 19:45938550-45938572 TGCACACAAAAGGCAGGGGTGGG + Exonic
1168022443 19:53619382-53619404 TGCAGAAAACAGGCCGGGTGCGG + Intergenic
1168029724 19:53669923-53669945 TGCAGAAAACAGGCTGGGTGCGG - Intergenic
1168289425 19:55350328-55350350 TGGGGACATCAGGCAAGGTCTGG - Exonic
925678152 2:6388069-6388091 TGCATATATCAGGCATGGTTTGG + Intergenic
926382107 2:12301239-12301261 TGCTGAGGTCAGGCAGGGCTAGG + Intergenic
928113431 2:28528170-28528192 TGCAGGCAGCAGGCAGGGTGCGG - Intronic
930024809 2:47023595-47023617 TGCACACAGCAAGCAGGGATAGG + Intronic
930030407 2:47055153-47055175 TGGAGTCATTAGGCAGGGTTTGG - Intronic
932308059 2:70717784-70717806 TGAACACATCAGGCAGGGTGCGG - Intronic
933285939 2:80384810-80384832 GGCAGACCTCAGGCAAGGTCTGG - Intronic
934151809 2:89154324-89154346 AGCCCACATCAGGTAGGGTTTGG + Intergenic
934215451 2:90027582-90027604 AGCCCACATCAGGTAGGGTTTGG - Intergenic
934992672 2:98932656-98932678 TGGAGACTTCAGTCAGGGCTGGG - Intronic
935551550 2:104463023-104463045 TACAGACAGGAGGCAGGGTGGGG - Intergenic
936773364 2:115941947-115941969 TGAAGACATAAGGCAGGGATAGG - Intergenic
938177288 2:129144993-129145015 TGCAGACAGCAGGTAGGGGTGGG - Intergenic
941065557 2:160898787-160898809 TACAGACACAAGGCAGGATTTGG - Intergenic
945357487 2:208857115-208857137 TGCAGTGTTCAGGCATGGTTAGG + Intergenic
946153588 2:217792632-217792654 TGCAGGCCACAGGAAGGGTTTGG - Intergenic
947914674 2:233823496-233823518 GGCAAACGTCAGGCAGGGGTGGG + Intronic
948076585 2:235169634-235169656 TACAGACATCAGGTACAGTTCGG + Intergenic
948401198 2:237686834-237686856 TGCAGACAGCAGGCAGGGTCTGG + Intronic
949055109 2:241923437-241923459 TGCAGACATGAAGCTGGGCTCGG + Intergenic
949055130 2:241923590-241923612 TGCAGACATGAAGCTGGGCTCGG + Intergenic
1171188575 20:23141809-23141831 AGCAGAGATTAGGCAGTGTTGGG + Intergenic
1171992651 20:31708572-31708594 TGCAGATTTCAGGGAGGGTGGGG - Intronic
1172091908 20:32438797-32438819 TTTTGACATCAGGCAGGTTTGGG + Exonic
1172948564 20:38706904-38706926 TGCAGCCAACAGGCAGGGAAAGG - Intergenic
1173817358 20:45998294-45998316 TGCAGACATGTGACTGGGTTTGG - Intergenic
1174048771 20:47752809-47752831 TGCAAACATCAGGCCAGGTGTGG + Intronic
1175148535 20:56914732-56914754 AGCAGACAGCTGGCAGGATTTGG + Intergenic
1175722610 20:61296415-61296437 TACACACTTCAGGCAGGGCTGGG + Intronic
1175870551 20:62207608-62207630 TTCGAACAGCAGGCAGGGTTGGG - Intergenic
1176159466 20:63641092-63641114 TGCAGACACCAGGCCGGGCGCGG - Exonic
1176906649 21:14509665-14509687 TGCAAGTATCAGGCAGAGTTGGG + Intronic
1179196982 21:39173536-39173558 AGCAGACATCAGGCCTGGGTAGG - Intergenic
1179812723 21:43882836-43882858 TGGAGACAACAGGCAGAGCTGGG - Intronic
1179982548 21:44903864-44903886 TGCAGGCATGGGGCCGGGTTAGG - Intronic
1180590229 22:16930905-16930927 TGCAGACATCTGGCTGGCTCTGG - Intergenic
1181778974 22:25179063-25179085 TGCAGACACCAGGCCGGGCGCGG - Intronic
1182621987 22:31623432-31623454 GGCAGACATGAGGCAGGCTAGGG + Intronic
1182710583 22:32320514-32320536 TGCAGAGACCAGGCAGGCTTGGG + Intergenic
1183760088 22:39808248-39808270 TGCTGTCCTAAGGCAGGGTTAGG + Intronic
1183771449 22:39929630-39929652 TGGAGACAGCAGGGAGGGATGGG - Intronic
1184878801 22:47292044-47292066 TTCAGGCATCAGGGAGGGTATGG + Intergenic
1184882871 22:47322522-47322544 TGAAGACATCAGCCAGGTCTTGG + Intergenic
952722131 3:36544458-36544480 TGCAGACACCTGGCCGGGTGCGG - Intronic
954430992 3:50470761-50470783 GGCAGAGAGCAGGCCGGGTTGGG + Intronic
959973914 3:112437163-112437185 GGCAGAGTTCAGGCAGGGCTGGG - Intergenic
961206017 3:125082292-125082314 TGCAGATTTCAGGCTGGGCTTGG - Intergenic
962279762 3:134040917-134040939 TGCAGAAGTCAGGCAGAGGTGGG - Intronic
963639069 3:147836620-147836642 TGCAGAGTTCAGGCAGTGGTGGG + Intergenic
968474351 4:795915-795937 TGCAGACATCGGGGAGGGTGGGG + Intronic
968586503 4:1419171-1419193 CACAGACACCTGGCAGGGTTCGG - Intergenic
968648170 4:1750036-1750058 TGCAGACATCAGGGTGGGCGGGG + Intergenic
971173428 4:24257676-24257698 TGCAGACATGGGGCAGGGGGAGG - Intergenic
972739502 4:41877249-41877271 TGGAGACATCAGGGACAGTTAGG + Intergenic
974011740 4:56613372-56613394 GGCAGGCATCAGGCTGGGTATGG + Intergenic
974017692 4:56663773-56663795 GGCACACATCAGGCAGGGCGCGG - Intronic
975382829 4:73722238-73722260 TGCAGACATCAGTCAGTGGGTGG - Intergenic
976645474 4:87383112-87383134 AGGACACATCAGGCAGGGTGTGG + Intronic
977666509 4:99651229-99651251 TGCAGACAGCTGCCTGGGTTTGG + Exonic
984113727 4:175651509-175651531 TGCAGACATCACGTTGAGTTTGG + Intronic
984173563 4:176389346-176389368 TGCAGACCCCAGGCAGGTCTCGG - Intergenic
985113299 4:186567639-186567661 TGCAGCAATTAGGCAGGGGTCGG + Intergenic
986175257 5:5347091-5347113 TCCACACAACAGGCAGGGTGGGG + Intergenic
987051074 5:14146642-14146664 TGCTGTCACCTGGCAGGGTTTGG + Intronic
989110790 5:37905011-37905033 TTTAGACATGAGACAGGGTTTGG + Intergenic
990492808 5:56319050-56319072 TGCAGACATGAGAAAAGGTTAGG + Intergenic
993700664 5:91114926-91114948 TGCAGGAATCTGACAGGGTTGGG - Intronic
994221885 5:97205761-97205783 AGCAGACATGAGGCAATGTTTGG - Intergenic
995872665 5:116759172-116759194 TTCAGGCATCAGGCAGGTTCTGG + Intergenic
996597311 5:125220315-125220337 TGCAGAAATCAGTGAGGGATGGG - Intergenic
996714915 5:126579360-126579382 TGCACTCATGAGGCTGGGTTAGG + Intronic
999238020 5:150111419-150111441 TGCAGAGGGCAGGCAGGGTCTGG - Intronic
1001485599 5:172117475-172117497 GGGAGACATCAGGCTGGGTAAGG - Exonic
1002886047 6:1295336-1295358 GGCAGACATCAGAGAGGGCTGGG - Intergenic
1003011927 6:2434512-2434534 TGCAGACAACAGGCAGGCACTGG + Intergenic
1003266166 6:4566500-4566522 AGCAGACATTCGGCAGGGTTGGG + Intergenic
1004011982 6:11698133-11698155 TGGAGACATCAGTCAGGGCTGGG + Intergenic
1005089972 6:22046209-22046231 AGCATACATTTGGCAGGGTTGGG - Intergenic
1006573108 6:35021693-35021715 TGCAGAGCTCAGGCCGGGTGCGG + Intronic
1007545550 6:42690952-42690974 TGCCTAAATCAGGAAGGGTTGGG + Intronic
1007786061 6:44280017-44280039 TGGAGACATGAGGCAGGGAAGGG - Exonic
1008045746 6:46849656-46849678 TGCACACATGGGGCATGGTTAGG - Intergenic
1009324970 6:62338509-62338531 TGAAGTCATCAGGCAGGGGTAGG - Intergenic
1011309835 6:85969695-85969717 TACAGAAATCTGGCAGGGTGAGG - Intergenic
1016092207 6:139993628-139993650 GGGAGAAATAAGGCAGGGTTAGG + Intergenic
1016709763 6:147156336-147156358 TGAAGACATCAGCTGGGGTTAGG - Intergenic
1018088816 6:160328251-160328273 TATTGACATCAGGGAGGGTTCGG + Intergenic
1019348377 7:541500-541522 TGCAGACCTCAGACAGGGCCCGG - Intergenic
1019379167 7:712330-712352 TGCGGACATTTGGAAGGGTTCGG - Intronic
1019450613 7:1095843-1095865 TGCAGAAATCATACAGGGCTGGG + Intronic
1019560962 7:1656931-1656953 GACAGACATCAGGCCGGGTGCGG - Intergenic
1019572850 7:1721244-1721266 TGAAAACATCAGGCCTGGTTGGG - Intronic
1020172889 7:5858775-5858797 TGCTGACATCAGGCTGGGCATGG + Intergenic
1020761099 7:12269255-12269277 TGCAGACAGGAGGCATGGATGGG + Intergenic
1024609181 7:51048907-51048929 TGCTAGCATGAGGCAGGGTTTGG + Intronic
1026133373 7:67638339-67638361 TTCTGACATCAGGCAGAGCTGGG - Intergenic
1026640263 7:72118003-72118025 AACAGACAGCAGGCAGTGTTGGG + Intronic
1026775742 7:73230079-73230101 TGCAGCCATCAGGGATGGTGAGG - Intergenic
1026865864 7:73823644-73823666 ATCAGACATTAGGCAGGGTGTGG + Intronic
1026978999 7:74515735-74515757 TGCAGAGATGAGGAAGGGCTGGG - Intronic
1027016599 7:74783451-74783473 TGCAGCCATCAGGGATGGTGAGG - Intronic
1027071429 7:75162485-75162507 TGCAGCCATCAGGGATGGTGAGG + Intergenic
1029085895 7:98011484-98011506 TGCTGACATCAGGCTGGGCATGG - Intergenic
1029695915 7:102213132-102213154 AGCAGACATCTGGCTGGGTGTGG - Intronic
1030479846 7:110089794-110089816 TGCAGACATCAGAAAGATTTAGG + Intergenic
1030685136 7:112478632-112478654 TGCAGAATTCAGGCAGGCCTAGG - Intronic
1032783728 7:135184613-135184635 GGCAGGCCTCAGGCAGGGTGTGG + Exonic
1037404256 8:18524491-18524513 TACATACATCAGGCCGGGTGTGG + Intergenic
1037777055 8:21842451-21842473 TCAAGAGAGCAGGCAGGGTTAGG - Intergenic
1037885558 8:22594418-22594440 TGCAGGCAACTGGCAGGGGTGGG - Intronic
1042337189 8:67640780-67640802 TGCAGACAGGAGGTAGGGCTGGG - Intronic
1042771285 8:72385535-72385557 TGTAGAAAGCAGGCAGTGTTTGG - Intergenic
1046747716 8:117894048-117894070 TGTAGCCAAAAGGCAGGGTTAGG - Intronic
1047954224 8:129961088-129961110 TGGAGCCATCAGACAGGGCTGGG + Intronic
1051745910 9:20294281-20294303 TGGAGAAATGTGGCAGGGTTGGG - Intergenic
1053290791 9:36878582-36878604 ACCAGACAGCAGTCAGGGTTGGG + Intronic
1056449219 9:86699301-86699323 CGCAGACAGCAGGCATGTTTGGG + Intergenic
1058103118 9:100938276-100938298 TGCAGAGTTCAGGCAGGGGTGGG + Intergenic
1058690213 9:107513844-107513866 AGCAGACATCAGTGAGGGCTTGG + Intergenic
1059155117 9:111982689-111982711 TCCAGACATTAGGAAGGGGTTGG - Intergenic
1059375950 9:113881853-113881875 CGCAGACTTCTGCCAGGGTTAGG + Intronic
1060010332 9:120038134-120038156 AGCAGACAGCAGGCAGCATTTGG - Intergenic
1061160072 9:128888620-128888642 AGCTGACCTCAGGAAGGGTTTGG + Intronic
1061668020 9:132171679-132171701 TGCAGACAGCAGGCAGGTCCTGG + Intronic
1061974459 9:134061341-134061363 TTCAGCAAACAGGCAGGGTTGGG + Intronic
1062116785 9:134813885-134813907 GGCAGACAGCAGGCAGGATTTGG + Intronic
1185628133 X:1496926-1496948 TGCAAACATCAGGCCGGGCGTGG + Intronic
1186598799 X:11013767-11013789 TTCAGTCTTCAGGCAGGGTATGG - Intergenic
1189274134 X:39772509-39772531 TGCAGTCCTCCTGCAGGGTTGGG - Intergenic
1191907388 X:66108026-66108048 TGCAGGCAGCAGCCGGGGTTGGG - Intergenic
1195428594 X:104762715-104762737 ACCAGAAATCAGGAAGGGTTTGG - Intronic
1195937274 X:110137745-110137767 TGAAGACATCTTGCAGGGTAGGG - Intronic
1199828407 X:151523778-151523800 GGCTGACATTAGGCAGGGCTTGG + Intergenic
1199983831 X:152936502-152936524 AGCAGCCATCAGGTAAGGTTAGG + Exonic
1200165455 X:154032271-154032293 TCCAGCCTTCAGGCAGGGTGGGG + Exonic