ID: 914847730

View in Genome Browser
Species Human (GRCh38)
Location 1:151292193-151292215
Sequence CTGGGTTTGGGGAAGGAGTC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 678
Summary {0: 1, 1: 0, 2: 6, 3: 65, 4: 606}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914847730 Original CRISPR CTGGGTTTGGGGAAGGAGTC AGG Exonic
900083023 1:873429-873451 CTGGGTTGGGGGACTGGGTCTGG + Intergenic
900998040 1:6133457-6133479 CTGGGTTTGAGCAAGGGGCCTGG + Intronic
901652133 1:10749065-10749087 ATGGGTTGGGAGAAGCAGTCCGG + Intronic
901915434 1:12495900-12495922 CGGGGTTGGGGGAAGGAGCTTGG - Intronic
902450670 1:16494877-16494899 AAGGGTTGGGGGAAGGAGACAGG + Intergenic
902560172 1:17272375-17272397 GAGGGTTTGGGGCAGGACTCTGG + Intronic
902682317 1:18052077-18052099 GTGTGTTAGGGGAAGGAGTAGGG - Intergenic
903046179 1:20565902-20565924 CGGAGGTTGGGGAAGGAGTAGGG + Intergenic
903261974 1:22136398-22136420 CTGGGGTTGGGGAAAGAGGAGGG + Intronic
903460968 1:23520882-23520904 CTTGGTTGGGGGAAGGTGTCAGG - Intronic
903587633 1:24428306-24428328 CTGGCTTTGGGGAAAGGTTCTGG - Intronic
903806164 1:26007057-26007079 CTGGGTTTGAAGGAGGAGACAGG - Intergenic
904435431 1:30491914-30491936 CTGGGTCTGGGGAAGGAAGCTGG - Intergenic
904475447 1:30762057-30762079 CTGGGTTCGGGGCAGGAGACAGG - Intergenic
904772029 1:32886120-32886142 GTGGGTATGGGGAAGGAAGCGGG + Intronic
904940949 1:34164684-34164706 CTGGGGTTGGGGCAGCAGTGAGG + Intronic
905244562 1:36603571-36603593 TTGGATATGGTGAAGGAGTCTGG - Intergenic
905562714 1:38940329-38940351 ATGGGATTAGGGAAGGTGTCAGG - Intronic
906112529 1:43333747-43333769 CCTGCTTTGGTGAAGGAGTCCGG - Intergenic
906183237 1:43839562-43839584 CTGTCTCTGGGGAAGGAGTCTGG - Intronic
906349241 1:45043377-45043399 CTTGGTCTGGATAAGGAGTCTGG + Exonic
906502965 1:46355353-46355375 ATGGGTTAGGGCAAGGATTCTGG + Intronic
906528255 1:46508912-46508934 CTGGGGCAGGGGAAGGAGTGGGG - Intronic
906873686 1:49512618-49512640 CTGGGTTTGGAGAGGGTGTCAGG - Intronic
907105480 1:51878725-51878747 CTGGGTTGGGGGAGGGGTTCAGG - Exonic
907140453 1:52181351-52181373 CTGGGATTGCAGACGGAGTCTGG + Intronic
907358249 1:53894085-53894107 CCGGGTCAGGGGAAGGAGTCAGG - Intronic
907513898 1:54981144-54981166 CGAGGTTAGGGGAAGGGGTCGGG - Intronic
909082704 1:71133044-71133066 CTGGGTTTGTAAAAGGAGTTTGG - Intergenic
909392395 1:75132483-75132505 CTGGGCTTGGGGAAGAAGAATGG - Intronic
911002372 1:93180013-93180035 CTGGGTTAAAGGAAGGAGGCTGG + Intronic
912545905 1:110451315-110451337 TTGGGTTTTGGGAAGATGTCAGG + Intronic
912630873 1:111245778-111245800 CTGGGGTTGGGGATGGATTCTGG + Intergenic
914328009 1:146639736-146639758 CTGGCTTTAAGGAAGCAGTCTGG + Intergenic
914847730 1:151292193-151292215 CTGGGTTTGGGGAAGGAGTCAGG + Exonic
915448758 1:155990129-155990151 CTGACTTTGGGGAAGTGGTCAGG + Intronic
915552926 1:156645585-156645607 CTGGGTTCGAGGAAGGAGTCTGG + Intronic
915740322 1:158113962-158113984 CTGGGGGTGAGGAAGGAGGCAGG + Intergenic
916415099 1:164585151-164585173 AAGGGGTTGGGGAAGGAGTGAGG - Intronic
916602539 1:166306967-166306989 CTGTCTTTGGGGAAGGTTTCTGG + Intergenic
917745605 1:178003825-178003847 CTGTGTTTGTGGAGGGAGTGTGG + Intergenic
918245731 1:182657505-182657527 CTGGGCTTGGGGAGGGAGCAGGG - Intronic
918427917 1:184429005-184429027 CTGGGTTGGGGGATGGAGCCAGG - Intronic
919905457 1:202075507-202075529 CTGGGGTAGGGGCAGGAGCCAGG - Intergenic
920826384 1:209427416-209427438 CACGGTTTAGGGGAGGAGTCCGG + Intergenic
921305105 1:213788533-213788555 CAGGGTATGGGGAGGGAGTCAGG - Intergenic
922101810 1:222483217-222483239 CTGGCTTTGAAGATGGAGTCAGG - Intergenic
922262892 1:223958338-223958360 CTGGCTTTGAAGATGGAGTCAGG - Intergenic
922565559 1:226599282-226599304 CTGAGTTGGGTGAAAGAGTCTGG - Intronic
923456824 1:234171960-234171982 CTGGGGTTGGGGAAGTAGGGCGG - Intronic
923656180 1:235919137-235919159 CGGGGTCTGGGTAAGGGGTCTGG - Intergenic
924237598 1:242012209-242012231 ATGTGTTGGGTGAAGGAGTCTGG + Intergenic
924344730 1:243063339-243063361 CTGGCTTTGAAGATGGAGTCAGG - Intergenic
924583377 1:245341049-245341071 CTGGGATTGGGAAAGGAGGATGG - Intronic
924589912 1:245393925-245393947 CTGGGGGAGGGGAAGGGGTCAGG + Intronic
1062907087 10:1186502-1186524 CTGGGCTTGGGGAACGCGTCAGG - Intronic
1064651343 10:17512999-17513021 TTGGGTTTGGGGAAGTAGACAGG - Intergenic
1067043930 10:42974150-42974172 CTCAGTTTGGGGAAGGAGCTGGG + Intergenic
1067354353 10:45511676-45511698 CTGGGATTGCAGACGGAGTCTGG + Intronic
1067471576 10:46541914-46541936 CTGGGCTGGGGGAAGGGGTGGGG - Intergenic
1067552647 10:47246364-47246386 CTGGACTTGGGAAGGGAGTCAGG - Intergenic
1068067261 10:52147606-52147628 TTGTGTTTGGGGAAAGAGTAGGG + Intronic
1068875732 10:61994607-61994629 CTGGGGGTGGGGAAGGAGTCGGG - Intronic
1069949673 10:72010226-72010248 CTGGGTTTGAGGTGGGAGTGGGG - Exonic
1070276584 10:75013060-75013082 ATGTCTTTGGGGAAGGAGGCTGG - Intronic
1070312606 10:75284423-75284445 CTGGGTTGGGGGAAGGGGACTGG + Intergenic
1071517731 10:86310190-86310212 CTGGGCTTGGGGATGGGGCCAGG - Intronic
1072405986 10:95153367-95153389 GTGGGTTGGGGGAAGGAGGGAGG + Intergenic
1072740295 10:97905084-97905106 ATGGGTTGGGGGAGGGAGACTGG + Intronic
1073057019 10:100709591-100709613 GTGGGTTGGGGGAAGAGGTCAGG + Intergenic
1073112296 10:101069968-101069990 TTGGGATTGGGGATGGAGTTGGG + Intergenic
1073693115 10:105833865-105833887 CTGGGTTTAGTGAAGGAGAAAGG + Intergenic
1074051208 10:109882768-109882790 CAGGATTTGGGAAAGGAGTGGGG - Intronic
1075677746 10:124307998-124308020 CTGTGTCTGGGGAAGGTGTCAGG + Intergenic
1075747236 10:124736435-124736457 CTGGGTGAGGAGAAGGAGCCTGG - Intronic
1076550500 10:131274857-131274879 CTGGGATTGTGGATGGAGGCAGG - Intronic
1076797181 10:132804011-132804033 CTGTGCTTGGGAAAGGAGCCGGG + Intergenic
1077156307 11:1093272-1093294 CTGGGCTTGGGGATGTGGTCAGG - Intergenic
1077334141 11:1995999-1996021 CTGTGGATGGGGAAGGAGTGAGG + Intergenic
1077355313 11:2114175-2114197 CTGAGTTTGGGGCAGGAGGTGGG - Intergenic
1077499232 11:2901852-2901874 AGGGGTTAGGGGAAGAAGTCAGG - Intronic
1077632449 11:3819976-3819998 CAGAGTTTGGGGAAGGCCTCAGG - Intronic
1078087177 11:8241123-8241145 CCAGGTTTGGGGAAGAAATCAGG - Intronic
1078101561 11:8333230-8333252 CTGCGTTTTGGGGAGGAGGCTGG + Intergenic
1078724755 11:13920152-13920174 CAGGTTTTGGGGGAGGAGTAAGG - Intergenic
1078968844 11:16381775-16381797 TTGGGTTTTGGGAGGGAGTGGGG - Intronic
1081298046 11:41416047-41416069 CTAGGTTTGGGGAAGGAGATAGG + Intronic
1081463447 11:43293741-43293763 CTGGCTTTGTAGAATGAGTCAGG - Intergenic
1081594388 11:44449211-44449233 CTGGGATCAGGGACGGAGTCAGG + Intergenic
1081650294 11:44819100-44819122 CTGGATCTGGGGAAGGAGTCAGG + Intronic
1081673352 11:44954182-44954204 GTGGGGTTGGGGATGGAGCCAGG + Intergenic
1081858090 11:46316543-46316565 ATGGGCTTGGAGAAGGAGTCTGG - Intronic
1082262148 11:50084731-50084753 CTGGCTTTGAAGATGGAGTCAGG - Intergenic
1082791395 11:57348711-57348733 TTGGCTTTAGGGAAGGAGTGGGG - Intronic
1083199039 11:61108640-61108662 CTGTGTTTTGGGTAGGATTCTGG - Intronic
1083307605 11:61769352-61769374 CAGGGTTTGGGCAAGTAGTTGGG + Intronic
1083321645 11:61851366-61851388 CTGGCTTTGGGGCAGGAGATAGG + Intronic
1083363485 11:62127748-62127770 CTGTGTTTGGGCAGGGAGTGAGG + Intronic
1083596558 11:63920568-63920590 CCGGGGTTGGGGAGGGAGTGTGG + Intergenic
1083887760 11:65581139-65581161 CTGGGGTTGGGGGTGGAGACTGG + Intronic
1084012897 11:66362593-66362615 AGGGGTTTGGGGCAGGAGCCTGG - Exonic
1084193431 11:67509282-67509304 TTGAGTTTGGAGAAGGAGCCTGG - Intergenic
1084323029 11:68384149-68384171 CGGGGCTTGGAGCAGGAGTCAGG + Intronic
1084998409 11:73006232-73006254 TAGGGTTTAGGGAAGGTGTCTGG - Intronic
1085015377 11:73170334-73170356 CTGGGGGTGGAGAAGCAGTCTGG - Intergenic
1085049313 11:73371965-73371987 TTGGGTTTGGGACAGGGGTCAGG + Intergenic
1085140139 11:74132596-74132618 CTGGTATTGGGGAAAGAGTTGGG + Intronic
1085214880 11:74820615-74820637 GTGTGTTTGGGGAGGGATTCAGG + Intronic
1085281486 11:75333966-75333988 CTGGGACTGGGTCAGGAGTCTGG - Intronic
1085328643 11:75628272-75628294 CTGGGGGTGAGGAAGGAGTATGG + Intronic
1085442151 11:76575038-76575060 CAGGGTTTGGGCAGGGAGACAGG + Intergenic
1086270972 11:85066431-85066453 CTGGCTTTGTAGAATGAGTCAGG - Intronic
1087077816 11:94141990-94142012 CTGGGGTTGGGGAATGTGTCTGG + Intronic
1087091990 11:94283177-94283199 CTGGGTTAGGGGAGGGAATGTGG - Intergenic
1087104252 11:94394541-94394563 CAGGGTTGGGGGAAGAGGTCAGG + Intronic
1087129937 11:94660026-94660048 CAGGGTCAGGGGAGGGAGTCGGG - Intergenic
1087203716 11:95372303-95372325 CAGGGTTGGGGGAAGCAGACAGG + Intergenic
1087214637 11:95482086-95482108 CTGGGATTGCAGACGGAGTCTGG + Intergenic
1087335196 11:96835331-96835353 TTAGGTATGGTGAAGGAGTCAGG + Intergenic
1088559738 11:111101248-111101270 CTGGCTTTGGGGATGGAGAGAGG + Intergenic
1088908199 11:114170560-114170582 CTGGTTTGGGGGAAGGAGGAGGG - Intronic
1089540935 11:119188573-119188595 CTAGGGTTGGGGCAGGAGTGGGG + Intronic
1089602546 11:119624416-119624438 CTGGCTCTGGGGAAGGCCTCTGG + Intronic
1090075040 11:123575229-123575251 CTGGGTTTGGGGAAGGATGAAGG + Intronic
1090383937 11:126345642-126345664 GTGGGATTGGGGGAGGAGTGGGG + Exonic
1090846497 11:130534044-130534066 CTGGGTTTGGGGTGGGTGTGAGG + Intergenic
1091227232 11:133964913-133964935 CTGGGGGTGGGGGAGGAGACTGG + Intergenic
1091283516 11:134395609-134395631 CTGGGATTGGGGGAGAAGTCTGG + Intronic
1202817124 11_KI270721v1_random:51181-51203 CTGTGGATGGGGAAGGAGTGAGG + Intergenic
1091462915 12:659374-659396 CTGCATTTTGGGAAGGAGCCAGG + Intronic
1092634923 12:10433381-10433403 CTGCGTTTTGGAGAGGAGTCAGG + Intronic
1093434548 12:19121550-19121572 ATGGGTCTGGGGAAGGGCTCAGG + Intergenic
1094043383 12:26141263-26141285 CTGTGTTTGGGGATGGAGGAAGG + Intronic
1094209298 12:27873600-27873622 CTGGGATTGCAGACGGAGTCTGG + Intergenic
1094349632 12:29509469-29509491 CCAGGTTTGGGGAAGGAGCGAGG + Intronic
1094813859 12:34165660-34165682 CTGGGTTGGGGGACTGGGTCTGG - Intergenic
1095103060 12:38202857-38202879 CTGGGTGCGGGGACTGAGTCTGG + Intergenic
1096113243 12:49041027-49041049 CGGGGTTTGAGGAATGGGTCAGG + Exonic
1096411913 12:51383131-51383153 GTGGGTTTGAGGAAGGCTTCGGG + Intronic
1096466371 12:51849150-51849172 CTGGGGTTGGGGTGGGGGTCGGG + Intergenic
1097045074 12:56181510-56181532 CTGGGGTTGGTGAAGGAGAGGGG + Exonic
1097188992 12:57210581-57210603 CTGGGTTGTGGAAAGGAGGCTGG - Intronic
1099096490 12:78380292-78380314 TTGTGTTTGGGGAAGGAGGAAGG - Intergenic
1100650919 12:96587206-96587228 TGGAGTTTGGGGAAGGGGTCTGG + Intronic
1101725637 12:107385963-107385985 CTGGGTTTGAGTGAGAAGTCTGG + Intronic
1102562252 12:113770471-113770493 CAGTGCTTGGGGAAGGAGTAGGG - Intergenic
1102566985 12:113803324-113803346 CTGGGTCTGGGGAAGGAGAGTGG - Intergenic
1102616471 12:114158908-114158930 CTTGGTTTGGGGAAGTTGTTTGG - Intergenic
1103317297 12:120066454-120066476 CTGGGTTGGGGGAAAGAGGCAGG + Intronic
1103327408 12:120130787-120130809 CTGGCTCTGGGGAAGGGGTGGGG - Intronic
1103733422 12:123043425-123043447 CAGCGTTAGAGGAAGGAGTCAGG - Intronic
1104497605 12:129255672-129255694 ATGGGTTTGGGGGTGGAGTGAGG - Intronic
1104834986 12:131783853-131783875 TTGGGGTTGGTGAAGGAGACTGG + Intronic
1106259747 13:28056069-28056091 CTGGGGTTGGGGGTGGAGTAAGG - Intronic
1106466806 13:30021035-30021057 CTGAGTTTGGGGAATCACTCAGG + Intergenic
1106680028 13:31999748-31999770 CTGGGATTGCAGACGGAGTCTGG + Intergenic
1107589028 13:41882531-41882553 CTGGGATTGCAGACGGAGTCTGG - Intronic
1108426957 13:50312198-50312220 CTGGGGCTAGGGAAGGTGTCTGG + Intronic
1108608434 13:52063341-52063363 CCGGGTTTGCAGACGGAGTCTGG + Intronic
1110088195 13:71409149-71409171 ATTGGTTTGGGGGAGGACTCTGG - Intergenic
1110412910 13:75223014-75223036 CAGGCTCTGGGGAAGAAGTCTGG - Intergenic
1110479660 13:75959542-75959564 CTGAGTCAGGGGAAGGAGGCTGG + Intergenic
1110495037 13:76158293-76158315 CTTGGGTTGGAGTAGGAGTCAGG + Intergenic
1110558418 13:76885817-76885839 CTGCGCTCGGGGAAGTAGTCGGG + Exonic
1110600605 13:77368218-77368240 CTGGCTTTGTAGAAGGAGTTAGG - Intergenic
1111331631 13:86765646-86765668 CAGGGTGTGGGGACTGAGTCTGG + Intergenic
1113575552 13:111392805-111392827 CTGGCTCTGAGGAAGGGGTCAGG + Intergenic
1113674971 13:112201097-112201119 CTAGGTTTGATGGAGGAGTCTGG + Intergenic
1116502025 14:45634785-45634807 CTGGGATTGCAGACGGAGTCTGG + Intergenic
1117029302 14:51652102-51652124 CTGGGTTTCGGGAGGGTTTCTGG + Intronic
1117772992 14:59153124-59153146 CAGGGTTGAGGGAAGCAGTCAGG - Intergenic
1117893666 14:60453751-60453773 GTGGGATTGGGGAAGGAGATTGG - Intronic
1118242562 14:64074223-64074245 CTGGGTTTGGGGGAGCGGTCTGG + Intronic
1118261409 14:64250708-64250730 CTGAGTTCGGGGAAGGAGGAGGG - Intronic
1118656269 14:67953255-67953277 ATGGGATTGGGGTAGGAGTTAGG + Intronic
1118656493 14:67955874-67955896 ATGGGATTGGGGTAGGAGTTTGG + Intronic
1118755876 14:68843491-68843513 GTGTGTTTGGGGAGGGAGTAGGG - Intergenic
1118877332 14:69796617-69796639 CTGGGATGGGGGCAGGAGTTGGG - Intronic
1119776695 14:77253474-77253496 CTGGGTATGGGGAAGGAGATGGG + Intronic
1120228971 14:81822329-81822351 CTGACCTTGGGGAAGGAATCAGG - Intergenic
1120968628 14:90189627-90189649 CTGGGGTTGGGGAGGAGGTCAGG + Intergenic
1121143019 14:91558074-91558096 CCGGGTTTGCAGACGGAGTCTGG - Intergenic
1121291161 14:92776699-92776721 CTGGGGTGGGGGAAGGAATATGG + Intergenic
1122087324 14:99316876-99316898 CTGGGTTCGGGGAAAGAGGGCGG + Intergenic
1122092020 14:99347164-99347186 CTGGGTGTGGGGAGGAAGGCGGG - Intergenic
1122487980 14:102094510-102094532 CTGGCTGTGGGGAGGGAGTGTGG + Intronic
1124605511 15:31167653-31167675 ATGGGGTTGGGGGAAGAGTCAGG - Intergenic
1125261493 15:37830853-37830875 TTGGGTTTGGGGAAGTAGAGAGG - Intergenic
1125698582 15:41660304-41660326 CTGGTGTTGGGGGAGGGGTCAGG + Intronic
1125752799 15:42041488-42041510 CTGGGGTTGGGGAAAGAGGTTGG + Intronic
1127292961 15:57586564-57586586 CTGGGTATGGGGATGGAGGGTGG - Intergenic
1127920787 15:63492534-63492556 ATGGCTTTGGGGAGGGACTCTGG + Intergenic
1129061975 15:72867446-72867468 CTGAGCCTGGGGAAGGATTCTGG + Intergenic
1129552664 15:76470354-76470376 CTGAATCTGGGGAAAGAGTCAGG + Intronic
1129737340 15:77973716-77973738 CTGGGTGTGTGGGAGAAGTCGGG - Intergenic
1129848732 15:78779909-78779931 CTGGGTGTGTGGGAGAAGTCGGG + Intronic
1130990452 15:88872852-88872874 GTGGGAGTGGGGAAGGAGTAAGG - Intronic
1131022354 15:89109458-89109480 CTGGGTTTGGGGTGGGGGTAGGG + Intronic
1131064450 15:89424862-89424884 CTGGGTTTGGGGCAGGGGGAAGG + Intergenic
1131433551 15:92405313-92405335 CAGGGTCTGGGGAAGGAGAAGGG + Intronic
1131856858 15:96606267-96606289 GGGAGTTTGGGGAAGGGGTCAGG + Intergenic
1131888761 15:96949286-96949308 ATGTGTTTGGGGAAGGAATGTGG + Intergenic
1132198181 15:99929454-99929476 CTGGCTTTGGGGATGGAGGACGG + Intergenic
1132207875 15:99998942-99998964 CTTGGTTTGGGGCGGGATTCAGG - Intronic
1132294732 15:100726699-100726721 CTGGGCTTGGGGCTGCAGTCTGG + Intergenic
1132646007 16:999602-999624 CTGGGTTTTGGGCCAGAGTCTGG + Intergenic
1132846074 16:2001502-2001524 CTGGGAGTGGGGATGGGGTCAGG - Intronic
1132910225 16:2306484-2306506 CTGGGTCTGTGGAAGGAGGTGGG - Intronic
1132981941 16:2742724-2742746 CTGGGCTGGTGGAAGGAGCCAGG + Intergenic
1133151364 16:3834512-3834534 CAGGGTTTTGGGAAGGAGAGAGG + Intronic
1134071603 16:11263624-11263646 CCTGGGTTGGGGCAGGAGTCGGG - Intronic
1134447925 16:14344850-14344872 GTGGGGGTGGGGAAGGGGTCTGG - Intergenic
1135035376 16:19072611-19072633 CTGGGTTTGGGTAAGGAACCGGG + Intronic
1135256781 16:20947509-20947531 CTGGGTTGGGGGAAAGAATTGGG + Intronic
1135503681 16:23018253-23018275 CTGGATTTGGGGAAAGCCTCAGG + Intergenic
1137750035 16:50854481-50854503 CTGGTTTTGGGGAATGATCCAGG + Intergenic
1137896000 16:52213553-52213575 CTGGGTTTGGGGTAGGACATAGG - Intergenic
1138257183 16:55576133-55576155 CTTGGTTTGGGGAAGGGGAAGGG + Intronic
1138475839 16:57270290-57270312 CAGGGGCTGGGGAAGGACTCGGG - Intronic
1138554522 16:57763867-57763889 CTCGGCTTGGGGACAGAGTCTGG - Intronic
1138599095 16:58044722-58044744 CTGGGTTGGGGGCTGCAGTCAGG - Intronic
1139437317 16:66943709-66943731 GTGGGCTTGGGGAATGAGTGGGG - Intronic
1139623336 16:68164129-68164151 CTGGGATTGCAGACGGAGTCTGG - Intronic
1139747037 16:69083054-69083076 CTTGGGTTGGAGAAGGAGGCAGG - Intronic
1139908185 16:70380842-70380864 CTGGGGGTAGGGACGGAGTCGGG + Exonic
1140005552 16:71071201-71071223 CTGGCTTTAAGGAAGCAGTCTGG - Intronic
1141115213 16:81302762-81302784 CTAGGTTTTGGGAAGGAGAAAGG - Intergenic
1141815254 16:86405118-86405140 CTGGGTTTAGGGAAGTGGACAGG - Intergenic
1142063642 16:88047404-88047426 CTGGTTTGGGGGAAGGAGCAAGG - Intronic
1142479868 17:212652-212674 CGGGGTTTGGGGCAGGAGGCAGG + Exonic
1142486567 17:251347-251369 CTGGGAATGGGGGAGGAGACTGG - Intronic
1142500203 17:328011-328033 CCAGGTTTGGGAAAGGAGTAGGG - Intronic
1142523023 17:518370-518392 CTGTGTTATGAGAAGGAGTCTGG - Exonic
1142643054 17:1295712-1295734 GTGGGTTGGGGGAAGGAGAAGGG + Intronic
1142765016 17:2059797-2059819 CTGGGACTGGGGAGGGAGGCAGG - Intronic
1143102434 17:4511870-4511892 CTGGGGGTGTGGAAGGAGTGGGG - Intronic
1143727635 17:8860420-8860442 CTGGGGATGGGGATGGATTCGGG - Intronic
1143924990 17:10361738-10361760 CTGAGTTTGGGGAAGAACGCAGG + Intronic
1144581722 17:16463041-16463063 CTGGGTCTGAGGAAGGAATTGGG + Intronic
1144914480 17:18712018-18712040 CTGGGCCTGGGAATGGAGTCTGG + Intronic
1144959890 17:19039074-19039096 CTGGTGTGGGGGAAGGAGCCGGG - Intronic
1144975270 17:19135450-19135472 CTGGTGTGGGGGAAGGAGCCGGG + Intronic
1145950431 17:28812668-28812690 CTGGCTTTGGGGTAGGGGCCGGG - Intronic
1146682021 17:34815290-34815312 CAAGGTGTGGGGAAGGAGCCAGG + Intergenic
1146721949 17:35130027-35130049 CTGGGTATGGGGTAGGGGTATGG + Intronic
1147240468 17:39087346-39087368 CTGGGTTTGGGGTGGGGGTTAGG - Intronic
1147452075 17:40511965-40511987 GTGGGTGGGGGGAAGGAGTTGGG + Intergenic
1147629139 17:41918804-41918826 CCGGGTTGGGGGACGGAGGCAGG + Intronic
1147654507 17:42081162-42081184 CTGGGTTAGGGGAAGAAGGATGG + Intergenic
1148122619 17:45221882-45221904 CAGGGTTGGGGGAGGAAGTCAGG - Exonic
1148457651 17:47819688-47819710 TTGGGGTTGTGGGAGGAGTCTGG - Intronic
1148757460 17:49981077-49981099 CTGGGCTTGGGGAATGTGACAGG - Intergenic
1149267918 17:54947891-54947913 CTGAGTTTAGAGAAGGGGTCTGG - Intronic
1149436262 17:56636046-56636068 CTGAGTTTGTTGAAGGAGTTGGG - Intergenic
1149633761 17:58149283-58149305 ATGGGTTTGTGGAAAGAATCGGG + Intergenic
1149814809 17:59713250-59713272 GTGGGTTGGGGGAAGGAGGGAGG + Intronic
1151382298 17:73734316-73734338 CTGGGCTGGGGGAAGGAGGGGGG - Intergenic
1151403518 17:73871764-73871786 CTGGGATTGAGGGAGGAGTGAGG + Intergenic
1151575555 17:74951120-74951142 CTGGCTTTGGGTTAGGAGGCTGG + Exonic
1151678887 17:75613831-75613853 CTGGGCTTGGAGAAGGAGGAGGG - Intergenic
1151788213 17:76286969-76286991 CTGGCTTTGGATAAGGAATCTGG + Intronic
1152190260 17:78883806-78883828 CTGGGGTTGGGGAGGGCGGCAGG - Intronic
1152281356 17:79386603-79386625 CTGACTCTGGGGAAGGTGTCTGG - Intronic
1153141954 18:1982983-1983005 CTAGGTTTGTGGAAGTATTCAGG - Intergenic
1153597320 18:6740939-6740961 CTGGGTTCGGGGAAGCAGGAAGG + Intronic
1153955095 18:10089343-10089365 CTGGGCTTGATGAAGGAGTAAGG + Intergenic
1155181994 18:23356054-23356076 CTTGGTCTTGGGAAGGACTCAGG - Intronic
1155312011 18:24533125-24533147 CTGGGGTTGGGGTGGGAGTAGGG + Intergenic
1155526508 18:26721314-26721336 CTGGGGATGGGGATGGAGGCAGG + Intergenic
1155535645 18:26814202-26814224 AGGGGTTTGGGGTAGGGGTCAGG - Intergenic
1157100578 18:44725428-44725450 CTGGGTTTGGGGAAGTAGTTAGG + Intronic
1157437713 18:47685112-47685134 CTAAGTGTGGGGAAGGAGTGGGG + Intergenic
1157689149 18:49666721-49666743 CTGGTTTTCTGGATGGAGTCGGG + Intergenic
1158318415 18:56237379-56237401 CTGGGTTTGAAGAAGGAGGAAGG + Intergenic
1158696200 18:59706439-59706461 ATAGGATTGGGGAAGGAGTAGGG - Intergenic
1158722290 18:59936283-59936305 CTGGGTCTGGGGAGGAAGTGGGG - Intergenic
1159623788 18:70669272-70669294 CTGAGATTGGAGAAGGAGTCAGG - Intergenic
1160329425 18:77978142-77978164 CTGGGTGTGGGGAAGTAGGGAGG - Intergenic
1160662274 19:306594-306616 CGGGGGGTGGGGAAGGGGTCAGG + Exonic
1160941696 19:1623098-1623120 CTGGGTTCGGGGTTAGAGTCAGG - Intronic
1161006212 19:1938225-1938247 GTAGGTTTGGGGGAGGAGGCAGG - Intergenic
1161333492 19:3699248-3699270 CTGGCTCTGGGGAAGGAACCGGG + Intronic
1161537879 19:4831294-4831316 CTGGGTGTTGGGGAGGAATCTGG + Intronic
1161537896 19:4831334-4831356 TGGGGTTTGGGGGAGGGGTCAGG + Intronic
1162065639 19:8123761-8123783 GTGCGGTTGGGGAAGGGGTCAGG - Intronic
1162311777 19:9912463-9912485 CTGGGTTTGGGGGATGATTTGGG + Intronic
1162466973 19:10848304-10848326 GTGTGTTTGGGGAAGGGGTGGGG + Intronic
1163026312 19:14514711-14514733 CTGGTTTTGGGGGTGGAGTGGGG - Intergenic
1163035005 19:14565002-14565024 CTGGGTGTGGGGACGGGGTCGGG + Intronic
1163279076 19:16304165-16304187 TGGGGTTTGGGGAAGAAGACGGG - Intergenic
1163455327 19:17403145-17403167 CTGGGTGTGGGGACACAGTCGGG - Exonic
1163721735 19:18901123-18901145 CTGGGTTTTGGGAGGCACTCAGG - Intronic
1165382987 19:35494273-35494295 CTGGGTCTAGGGAGGGAGTGGGG + Intronic
1165834244 19:38744505-38744527 GTGGGGCTGGGGAAGGAGGCGGG + Intronic
1166089325 19:40497948-40497970 CTGGGTTTGGGGCTGGGGTAGGG - Intronic
1166300045 19:41908081-41908103 CTGGGGCTGGGGAAGGAGACTGG + Intronic
1166333988 19:42094577-42094599 ATGAGGTTGGGGAAGGAGTGGGG - Intronic
1166418146 19:42610998-42611020 CCGGGATTGCAGAAGGAGTCTGG - Intronic
1166690631 19:44819872-44819894 CTGGGTTTGGGGCTGTAGTTGGG - Intronic
1167124525 19:47540051-47540073 CTGGGTCGGGGGCTGGAGTCAGG - Intronic
1167166394 19:47802698-47802720 CTGGGATTGGGGCAGGGATCGGG + Exonic
1167249323 19:48392142-48392164 CTGGGTCTGAGGGAGGAGGCTGG - Intergenic
1167249336 19:48392177-48392199 CTGGGTCTGAGGGAGGAGGCTGG - Intergenic
1167276689 19:48544036-48544058 CTGGGTCTGAGGGAGGAGGCTGG - Intergenic
1167276740 19:48544182-48544204 CTGGGTCTGAGGGAGGAGGCTGG - Intergenic
1167289197 19:48615175-48615197 CTGGCTGTTGGGAAGGAGGCAGG + Intergenic
1167291739 19:48628614-48628636 CAGGGGTTGGGGAAAGAGACAGG - Intronic
1167373245 19:49097208-49097230 GAGGGTTCGGGGAAGGAGCCTGG + Intronic
1167456456 19:49598834-49598856 CTGGGTTTAGGGAGAGAGGCAGG + Intronic
1167695845 19:51015310-51015332 ATGGGTTTGGGAATGGAGTTGGG + Intronic
1167696304 19:51017335-51017357 CTGGGTTTGGGGTTGGAGCTGGG + Intronic
1167748844 19:51368102-51368124 CCGGGTTGGGGGCAGGAGACGGG - Intronic
1167750164 19:51374631-51374653 CTGAGTTTGGGGATGGAGTTGGG - Intergenic
1168187327 19:54708598-54708620 CTGGGTTTGGGGAGGGTCCCTGG - Intergenic
1168253561 19:55154967-55154989 CTGGGTCTGAGGGAGGAGTTGGG + Intronic
1168253573 19:55155001-55155023 CTGGGTTTGAGGGAGGAGAAGGG + Intronic
926297496 2:11579227-11579249 CTGGGCATGGGGAAGCAGTGAGG - Intronic
926831167 2:16963701-16963723 CTGGGGTTGGAGATGGAGTTGGG + Intergenic
926899760 2:17737881-17737903 CTGGGTTTGGGTCAATAGTCAGG + Intronic
927672067 2:25076974-25076996 ATGAATTTGGGGAAGGAGGCAGG - Intronic
927904998 2:26849259-26849281 CTGGGTTTGAGGAGGGAGGACGG + Intronic
927961480 2:27242981-27243003 CTGGGCTTGAGGAAGAAGCCAGG + Intronic
928230904 2:29498251-29498273 CTGGGTTTGGGGGAGGAGGTTGG + Intronic
928275682 2:29898149-29898171 CTGGGGCTGGGGAAGGTGGCAGG - Intronic
928436860 2:31260439-31260461 AGGGGTTTGGAGAAGCAGTCGGG - Intronic
929938680 2:46314110-46314132 ATGGGTCTGTGGAAAGAGTCTGG - Intronic
930395218 2:50814381-50814403 CAGGGTTTGGGGAATGAGAAGGG - Intronic
931447236 2:62336758-62336780 GTGGGTTGGGGGATGGAGCCCGG - Intergenic
931569739 2:63656240-63656262 CTGGAATTGGGGAAGTAGACAGG - Intronic
932129790 2:69177601-69177623 CAGGGATTGGGGAGGGAGGCCGG - Intronic
932301790 2:70672621-70672643 CTGAGTTGGGGCAAGGAGCCGGG + Intronic
932399519 2:71470222-71470244 CTAGATTTGGGGCAGGAGTTGGG + Intronic
932578225 2:72974422-72974444 CTGGATGAGGGGAAGGAGGCTGG - Intronic
932750352 2:74367658-74367680 TTGGGCTTGGGGCAGGAGGCAGG - Intronic
932849863 2:75174040-75174062 CTGGGTTTTGGGAGTGAGGCAGG - Intronic
934708686 2:96501816-96501838 CTGGGCTGGGGGAGGGAGGCTGG + Intronic
934766097 2:96880943-96880965 CTGGGTTTGGGGTGGGTGTGAGG + Intronic
934925922 2:98381725-98381747 CTGGGCTGGGGGAAGGAGGCTGG + Intronic
935179901 2:100679891-100679913 CAGGGTTTGAAGAGGGAGTCAGG + Intergenic
936471158 2:112799671-112799693 CTGGGTTTGAGGAAGGAAACTGG + Intergenic
936528700 2:113259897-113259919 CTGCGTTTGGGGAGGGAAACAGG + Intronic
936560918 2:113539196-113539218 CTGGGTCTGTGGAAGGAGCTGGG + Intergenic
936882396 2:117269784-117269806 CTGCCTTTGGGCAAGGGGTCTGG - Intergenic
937053094 2:118908147-118908169 CAGGGCATGGGGAAGGAGTAGGG + Intergenic
937078938 2:119126681-119126703 CTGGGATTGGGGGTGGAGGCAGG - Intergenic
937274516 2:120675343-120675365 CTGGGCTTGGGAAGTGAGTCAGG - Intergenic
939871309 2:147529058-147529080 CTGGGCTGGTGGAAGGAGTAGGG - Intergenic
939949688 2:148455282-148455304 CAGGGTTTGGGGATGGAGTATGG - Intronic
940136378 2:150440689-150440711 CAGGGTTTGGGGATGCAGTGGGG + Intergenic
941547859 2:166876426-166876448 CTGGCTTTGGGTATGGAGACAGG + Intergenic
942858863 2:180585761-180585783 CTGGGGTTGGGGAAGGGGGGAGG - Intergenic
943169952 2:184385811-184385833 CTGGGTTTGGGGTAGGGGTGAGG - Intergenic
943394739 2:187320261-187320283 CAGGGTTTGGGGAAAGAATCTGG - Intergenic
944600418 2:201297655-201297677 CTGGGATTGGAGCAGAAGTCAGG + Intronic
944868281 2:203883768-203883790 CTGGGCTGAGGGAAGGAGGCTGG + Intergenic
945036049 2:205704830-205704852 CTGGGTTCGGAGAAGGTGCCAGG - Intronic
945080084 2:206079762-206079784 CTGTGTTAGGGGAAGGAGTTTGG - Intronic
945263630 2:207868423-207868445 CTGGGTATTGGGAAGTAGTGGGG + Intronic
946069893 2:217025003-217025025 GTGGGGTGGGGGAAGGAGTGAGG + Intergenic
946177080 2:217928584-217928606 CTGGGTTTGGGGAAAGGGCCAGG - Intronic
946415861 2:219539319-219539341 CTGGTTTTGGGGGAGAAGTGGGG + Exonic
948486620 2:238285342-238285364 GTGGGGGTGGGGAAGGAGTGGGG + Intronic
948572596 2:238927048-238927070 CTGGATTTGGGGGAGGTGACAGG + Intergenic
1169290371 20:4344485-4344507 CTGGGATTTGGGAAGGGGTCAGG + Intergenic
1169671037 20:8102742-8102764 CTGGCTTTGTAGAATGAGTCAGG + Intergenic
1169893620 20:10479073-10479095 CTGGCATTGGAGAAGGAGTTAGG + Intronic
1170166863 20:13368760-13368782 CAGGGGTTGGGGAAGGGGACAGG - Intergenic
1170625386 20:18026354-18026376 GTGGGTCTGGGGTAGGAATCAGG + Intronic
1171431118 20:25083700-25083722 CTGGGTTTAGGGAAGGCGTTGGG + Intergenic
1172425670 20:34854469-34854491 GTGGGTGTGGGGAAAGGGTCAGG - Intronic
1172875935 20:38164428-38164450 TTGTGTGTGGGGAGGGAGTCAGG + Intronic
1172930914 20:38585967-38585989 CTGGGTCAGGGGTAGGAGACAGG + Intronic
1173014921 20:39216284-39216306 ATGGGTGTGGGGATGGAATCGGG - Intergenic
1173290724 20:41712685-41712707 CTGTGTTTAGGGAAGCAGGCTGG - Intergenic
1173417097 20:42866367-42866389 CTGGATTTGGGTGTGGAGTCAGG - Intronic
1175100455 20:56575387-56575409 CTGGGTCCGAGGAAGGAGGCAGG - Intergenic
1175295652 20:57907188-57907210 CTATGATTGGGGAAGGAGTGGGG - Intergenic
1175306782 20:57981694-57981716 GAGGGGTTGGGGAAGGAGGCAGG + Intergenic
1175776032 20:61654152-61654174 CTGGGATTGCAGACGGAGTCTGG - Intronic
1175963837 20:62650297-62650319 CTGGGCTTGGGGAAGAAGGGAGG - Intronic
1175987416 20:62770925-62770947 CTGGATTTGGTGAAGGGCTCCGG - Intergenic
1176075065 20:63244632-63244654 CTGCCTTTGGGGCAGGGGTCAGG + Intronic
1176217680 20:63956027-63956049 CGGGGCTCGGGGAAGGAGTCCGG - Intronic
1176383031 21:6122875-6122897 CTGGGTTTGGGGGCGGGGACTGG - Exonic
1178034274 21:28563478-28563500 CCGGGTTTGCAGACGGAGTCTGG + Intergenic
1178274699 21:31226438-31226460 CTAGGGTTGGGGAAGTGGTCAGG + Intronic
1179104094 21:38383271-38383293 CTGGGGCTGGGGAAGGAAGCCGG - Exonic
1179740438 21:43415364-43415386 CTGGGTTTGGGGGCGGGGACTGG + Exonic
1179944054 21:44658696-44658718 CAAGGCTTGGGGAGGGAGTCGGG - Intronic
1179960984 21:44766855-44766877 CGGGGTTTGGGGGAGGAAGCTGG + Intergenic
1180394181 22:12314402-12314424 GTGGGTTAGGGGAAGGGGGCAGG - Intergenic
1180405565 22:12550347-12550369 GTGGGTTAGGGGAAGGGGGCAGG + Intergenic
1181439997 22:22930834-22930856 CTGGCTTTGGGACAGGAGCCAGG + Intergenic
1181629439 22:24142870-24142892 CTGACTTGGGGGAAGGAGTGAGG - Intronic
1181956725 22:26592648-26592670 GTGGGCTGTGGGAAGGAGTCGGG + Intronic
1182876385 22:33694968-33694990 CTGGGATTGGGGATGCAGCCTGG - Intronic
1183105149 22:35610219-35610241 CAGGGTTGGGGGCAGGAGCCTGG - Intronic
1183337111 22:37256232-37256254 CTGGGTTTGGGGATCGGGTGGGG - Intergenic
1183348214 22:37319479-37319501 GCAGGTGTGGGGAAGGAGTCGGG + Intergenic
1184169560 22:42750974-42750996 CCGGGTTTGCAGACGGAGTCTGG - Intergenic
1184288591 22:43486260-43486282 CAGTGTCTGGGGAAGGACTCGGG + Intronic
1184329898 22:43820786-43820808 CTGGAAATGGGGCAGGAGTCAGG - Intergenic
1184421230 22:44384055-44384077 CGGAGTTTGAGGAAGGGGTCTGG - Intergenic
1184811028 22:46832118-46832140 CTGGGTTTGGGCAGGATGTCTGG + Intronic
1185229276 22:49670914-49670936 CTGGGGATGGGGAGGGAGGCTGG + Intergenic
1185230304 22:49676920-49676942 CTGGCATTGGGGAGGGAGGCTGG - Intergenic
1185296337 22:50057105-50057127 CTGGGTTGGGGGATGAGGTCTGG + Intergenic
1185376585 22:50485419-50485441 CTGGGTCAGGAGAAGGTGTCTGG - Exonic
949498823 3:4658551-4658573 CAAGGTTTGGGGAAGGAGGAAGG - Intronic
949577842 3:5356052-5356074 CTGGGATTAGGGATGGAGACTGG - Intergenic
949712321 3:6885577-6885599 CTGGGTGTGTGGTAGGAGGCAGG - Intronic
950707361 3:14791394-14791416 CTGGGATGTGGGAACGAGTCGGG + Intergenic
950798220 3:15528583-15528605 CTGGGATTGGGGTAGGGGGCCGG - Intergenic
952213013 3:31248350-31248372 CTGTGTTTGTGGAAGAAGCCTGG + Intergenic
952500991 3:33961843-33961865 CTGGGCTTCTGGAAGGCGTCAGG + Intergenic
952591065 3:34954253-34954275 CTGTGTATGGGGAAGGAGATAGG + Intergenic
952929072 3:38346086-38346108 CTGGGTTTGGGGAGGAATTCTGG + Intergenic
953005656 3:38976827-38976849 CTGGGTTTGGGTAGGGGGACGGG - Intergenic
953704983 3:45224825-45224847 GTGGGTGCGGGGAAGGAGTCGGG + Exonic
953773612 3:45797165-45797187 CTGGGTCCGGGGACGGAATCAGG + Intergenic
953806264 3:46071449-46071471 CTGGCTTTGTGGAATGAGTCAGG - Intergenic
954625163 3:52018512-52018534 CTCAGTTTGGGGTCGGAGTCAGG - Intergenic
954701069 3:52451198-52451220 CTGGGGTTGGGGAGGGGGTCGGG - Exonic
954929899 3:54272365-54272387 CTGGGCTTGGGGAAGCTGTGGGG + Intronic
955101574 3:55854838-55854860 CTGGGGATGGGGAAGGAGGCTGG + Intronic
955500809 3:59580717-59580739 CTGGGTTGGGGGAAGTACTAGGG - Intergenic
955597936 3:60612086-60612108 CCAGGTTTGGGTAAGAAGTCAGG - Intronic
956427937 3:69155803-69155825 GTGGGTGTGGGGAAGGGGTCAGG + Intergenic
956787811 3:72656839-72656861 CTGGGGTGGGGAAAGGAGTTGGG - Intergenic
956970230 3:74515037-74515059 CTGGATGTGGGGAGGGAGTTGGG + Intronic
957129098 3:76200230-76200252 TTGGGTCTGGGGAAGGAGCAAGG + Intronic
959351019 3:105263314-105263336 GTGGGGTTGGGGGAGGAGTGAGG + Intergenic
959401621 3:105909297-105909319 CAGGGTTTGGGGAGGGAGGTGGG - Intergenic
959542662 3:107558080-107558102 CTGGGTTAGAGGAAGAAGCCAGG + Intronic
960046928 3:113208228-113208250 CTTGGTCGGGGGAAGGAGTGGGG - Intergenic
960459460 3:117915427-117915449 CTAGCTTTGAGGAAGGAGTCAGG - Intergenic
960613950 3:119580134-119580156 CTGGGATGGGGGAAGAAGACCGG - Exonic
960637310 3:119796319-119796341 TTGGGGCTGGGAAAGGAGTCAGG - Intronic
960733471 3:120751414-120751436 CTGGATTTGGGGAAGGCCTCTGG + Intronic
960783409 3:121345861-121345883 TTGGGATTAGGGAAGGAGGCAGG - Intronic
961378690 3:126483259-126483281 CTGGGTGTGGGGATGGGGGCCGG - Intronic
961380178 3:126491980-126492002 CTGGGATTGGGTGAGGTGTCTGG - Intronic
961380373 3:126492763-126492785 CTGGGATTGGGGGAGGTGTCTGG - Intronic
961473563 3:127133620-127133642 CTGGCTTTGAAGAAGGAGGCAGG - Intergenic
962254204 3:133859420-133859442 CTGGGTTGGGGGTGGGTGTCAGG + Intronic
962801497 3:138894684-138894706 CTGGGGTTGGGGTAGGGGTTGGG + Intergenic
965170150 3:165252386-165252408 TTGGGCTTGGGGAAGGATTGGGG + Intergenic
966018567 3:175176723-175176745 CTGGCTTTGAGGATGGAGTAAGG + Intronic
966738617 3:183211209-183211231 CTGGGCCTGGGGAGGGAGCCGGG - Intronic
966948543 3:184795507-184795529 CTGGGTTTGGGGCAGGGCCCGGG + Intergenic
968539140 4:1154213-1154235 CTGGGTGTGTGAGAGGAGTCTGG + Intergenic
968539144 4:1154232-1154254 CTGGGTGTGTGAAGGGAGTCTGG + Intergenic
968684886 4:1951296-1951318 GTGAGATTGGGGAAGGGGTCTGG - Intronic
969248435 4:5951805-5951827 CTGGGGTTGGGGAAGAGGTCTGG - Intronic
969472899 4:7400147-7400169 CTGGGGATGGGGTAGGAGCCGGG - Intronic
969848585 4:9938907-9938929 CTGGGGGTGGGGATGGAGTGGGG + Intronic
970415937 4:15856901-15856923 CTGGGGTTGTGGAAGGTGTGTGG + Intergenic
970488083 4:16544397-16544419 ATGGGTTTAGGGGAGGAGTTTGG + Intronic
973190103 4:47376795-47376817 CTGGGGTTGAGGAAGAAGGCTGG - Intronic
974056480 4:56988162-56988184 CAGGGTTTGGAGAAGGGGCCGGG + Intronic
975296152 4:72736819-72736841 CTGGGTTTGTAGAATGAGTTTGG - Intergenic
975563017 4:75724904-75724926 CTGGGACTTGGGAAGGGGTCCGG + Intronic
976168976 4:82284364-82284386 GTGGGTTTGGGGGATGAGTGTGG - Intergenic
976440227 4:85064876-85064898 TTGGGTTTTGGGGAGGAGTAAGG + Intergenic
976772949 4:88674135-88674157 CTGGGGTGTGGGAAGGGGTCAGG + Intronic
977228521 4:94423766-94423788 CTAGGTTTGCAGAAGGAGTTAGG - Intergenic
977320706 4:95512070-95512092 ATGGGTCTGGAGAAGGAGGCAGG + Intronic
978464375 4:108993175-108993197 CAGGGTTTGGGGTGGGAGTGTGG - Intronic
978855007 4:113384893-113384915 CTGGGTGTGGGCAAGTAGTCAGG + Intergenic
979257986 4:118624344-118624366 CTGGCTTTGAAGATGGAGTCAGG + Intergenic
979322096 4:119336561-119336583 CTGAGTTTGGGGACAGACTCTGG + Intergenic
979330363 4:119416219-119416241 CTGGCTTTGAAGATGGAGTCAGG - Intergenic
980159224 4:129139077-129139099 CTTGGTCTGGATAAGGAGTCTGG + Intergenic
983512269 4:168621491-168621513 CTGGGGTGGTGGAAGGAGTAAGG - Intronic
983914640 4:173279191-173279213 CTGGCTTTGGGGGAGGCCTCAGG + Intronic
983976395 4:173939517-173939539 CTGGGCTTGGGAAGGGAGTCGGG + Intergenic
984833682 4:183999597-183999619 CTGGGTTTGGGAAGGGGGTGAGG + Intronic
985034037 4:185820535-185820557 CTGCAGTTGGGGAAGGAGTAGGG + Intronic
985440550 4:189980423-189980445 CTGGGTCTGAGGAGGGCGTCAGG - Intergenic
985569808 5:638807-638829 CTGGGTTGAGGGGAGGAGTCTGG + Intronic
985661424 5:1158968-1158990 CTGCCTTTGGGGCAGGAGTCCGG - Intergenic
985708459 5:1414895-1414917 CTGTGTCTGGGGAAGGGGGCGGG + Intronic
986434483 5:7714914-7714936 ATGGGCCTGGGGAAGGAGCCAGG + Intronic
986859094 5:11904777-11904799 GTGGGTTGGGGGAGGGAGGCTGG + Intergenic
987097009 5:14559100-14559122 CTGGCTTGGGGGAAGGAGAGGGG + Intergenic
988177645 5:27747506-27747528 CTGGTTTTGTAGAAGGAGTTAGG - Intergenic
989211674 5:38862891-38862913 CTGGGATTGCAGACGGAGTCTGG - Intronic
989246021 5:39255667-39255689 CTGGGTATGTAGAAAGAGTCAGG - Intronic
990823138 5:59865513-59865535 CTGGGTTTGGGGAAGAACCTAGG - Intronic
990871140 5:60431800-60431822 CTGGGATTGCAGATGGAGTCTGG - Intronic
990952908 5:61315805-61315827 CTGGGTTTGGGAAAGGGATTAGG - Intergenic
991110069 5:62889663-62889685 CTAGATTTGGGGAAGGAGGGTGG + Intergenic
992371027 5:76144390-76144412 CTGGGTTTGTGGAAGGGGTGGGG + Intronic
992391803 5:76336620-76336642 CCGGGATTGCGGACGGAGTCTGG - Intronic
992977104 5:82131871-82131893 CTGGGATAGGGGAGGGTGTCAGG + Intronic
993187759 5:84642111-84642133 CAGGGGTTGGGGAAGAAGTGGGG - Intergenic
993256963 5:85604405-85604427 AGGGGTTTGGGTAAGGAGTGGGG - Intergenic
993435590 5:87889008-87889030 CTGGGGTTGGGGAAGGGGTGGGG + Intergenic
994335720 5:98563477-98563499 CTGTGTTTGGGGATGGAGAAAGG - Intergenic
995326684 5:110897796-110897818 CTGGGTTGGGGAAAAGATTCAGG - Intergenic
996763356 5:127009199-127009221 CTTGGTTTTGGGAAGGATTCTGG - Intronic
996904531 5:128583157-128583179 ATGGGTTTGGGGAAGCAGGAAGG - Intronic
997196996 5:131987034-131987056 CTGGGATTGGTGCAGGAGTAAGG - Intronic
997234906 5:132267194-132267216 CAGAGTTTGGGCAAGGAGACTGG + Intronic
997648032 5:135494085-135494107 ATGGGCTTGGGGAAGGACTGAGG + Intergenic
997860187 5:137409002-137409024 GTGTGTTTGGGGAAGGGGTTTGG - Intronic
998067325 5:139170135-139170157 CTGGGATTGCAGACGGAGTCTGG + Intronic
998148615 5:139744680-139744702 CTGGGTCTGGGGCAGGAGCGGGG - Intergenic
998812903 5:145984365-145984387 CAGGCTTTGGGGAAGGAGATAGG + Intronic
999195162 5:149776944-149776966 CTGAGGGTGGGGAAGGACTCGGG - Intronic
999386290 5:151156589-151156611 CCGGGTTTGTGAAAGGACTCTGG - Intronic
999526926 5:152416803-152416825 GTGGGGTTGGGGGAGGGGTCGGG + Intronic
1000125468 5:158239547-158239569 CTGGGGGTGGGGAAGGACTGGGG - Intergenic
1000428809 5:161125575-161125597 CTGGCTTTGTAGAATGAGTCAGG + Intergenic
1000631812 5:163599244-163599266 CTGGCTTTCAGGAGGGAGTCAGG - Intergenic
1001198318 5:169693538-169693560 ATGGTTTGGAGGAAGGAGTCAGG + Intronic
1001279696 5:170377923-170377945 GTGGGTCTGGGGACGGAGTTGGG - Exonic
1001317319 5:170653042-170653064 CTGGGTCGGGGGAAGGAGCGAGG + Intronic
1001748792 5:174112096-174112118 CTGGGTTTGGGCCAGGTGTTGGG + Intronic
1002378488 5:178806746-178806768 CTGGCTTTGCAGAATGAGTCAGG - Intergenic
1002636311 5:180610410-180610432 AGGGGTTTGTGGAAGGAGCCTGG + Intronic
1002841539 6:910974-910996 CTGAGTGTGTGGAAGAAGTCAGG + Intergenic
1004320440 6:14627775-14627797 CTGGGGTCTGGGAAGGAGACAGG + Intergenic
1004329376 6:14707819-14707841 GTTGTTCTGGGGAAGGAGTCAGG - Intergenic
1004664371 6:17736205-17736227 CCGGGTTTGCAGACGGAGTCTGG - Intergenic
1004737240 6:18419711-18419733 ATGGGATTGGTGAAGGAGTGAGG + Intronic
1006115393 6:31773438-31773460 CTGGGTTGGGGAAAGGGATCTGG + Intronic
1006395088 6:33782051-33782073 CTGTGTTAGGGGAAGGCGACAGG - Intronic
1006522805 6:34581756-34581778 GTGGGTTTGGGGGAGTTGTCAGG - Intergenic
1006797737 6:36742080-36742102 CTGGGTTTGGGCAATAAGTGAGG + Exonic
1007400820 6:41601317-41601339 CTGGGGCTGGGGGAGGTGTCAGG - Exonic
1007486090 6:42181724-42181746 CTGGGTGTGGGGGAGGTGTGGGG + Intergenic
1008933220 6:56961763-56961785 GTGGGCTTGGGGAAGGATTTAGG - Intronic
1010159225 6:72832103-72832125 TTGGGATTTGGGAAAGAGTCTGG + Intronic
1011540938 6:88427891-88427913 CTGGGTCTGGGGAGGGAGCAGGG - Intergenic
1012854008 6:104479746-104479768 CTGGGTTCTGGGTTGGAGTCTGG - Intergenic
1013204447 6:107933989-107934011 CCGGGTTTGCAGACGGAGTCTGG + Intronic
1013596278 6:111663691-111663713 AGAGGTTTGGTGAAGGAGTCAGG + Intronic
1014052202 6:116967803-116967825 GTGAGTCTGGGGAAGCAGTCAGG + Intergenic
1014306661 6:119751340-119751362 CTGGTTTTGGAGAATGAGTTAGG + Intergenic
1014640918 6:123909366-123909388 CTGGGTGTGTGGAATGATTCTGG + Intronic
1015976571 6:138796606-138796628 CTGGGTTGGGGGAATGAGGGAGG + Intronic
1016201302 6:141412773-141412795 CTGGGTTAGAGATAGGAGTCTGG - Intergenic
1016672503 6:146725524-146725546 CTTGGTTTGGGGATGGTTTCAGG - Intronic
1016731449 6:147432305-147432327 CTGGGTTTGGAGAATTAGTGGGG - Intergenic
1017170286 6:151449917-151449939 CCGGGTTTGCAGACGGAGTCTGG + Intronic
1017414630 6:154206746-154206768 GTGGGATTGGGGTGGGAGTCAGG + Intronic
1018798289 6:167203780-167203802 CTGAGTCTGGGGAAGGAATCAGG - Intergenic
1018814423 6:167320396-167320418 CTGAGTCTGGGGAAGGAATCAGG + Intergenic
1019205847 6:170360902-170360924 TGTGGTTTGGGGAAGGAGTTGGG + Intronic
1019429215 7:991003-991025 CTGGGTGGGGTGAAGGACTCAGG + Intergenic
1019481553 7:1269410-1269432 CGGGGTTTGGGCTAGGTGTCGGG - Intergenic
1019623286 7:2002925-2002947 CGGGGTCGTGGGAAGGAGTCAGG - Intronic
1019981235 7:4623617-4623639 CTGGGATTGCAGACGGAGTCTGG + Intergenic
1020646036 7:10815445-10815467 CTGGGTTTTGGAATGGAGTATGG - Intergenic
1020973329 7:14975772-14975794 CTGGCTTTGGGGGAGGCCTCAGG + Intergenic
1021121223 7:16797950-16797972 CTGTGTTTGGGGAAGACATCTGG + Intronic
1021320477 7:19204179-19204201 CTGGCTATGGGGAAGGAGGTGGG - Intergenic
1021777970 7:24072476-24072498 ATGGGCTGGGGGAAGGAGGCTGG + Intergenic
1022470176 7:30677147-30677169 GTGGGTTTGGAGATGGAGTCGGG + Intronic
1022889371 7:34681156-34681178 CTTGGTCTGGGGATGGAGGCAGG - Intronic
1023162354 7:37309545-37309567 CTGCCTTTGGTGAAGGACTCTGG - Intronic
1023399975 7:39785634-39785656 CTGGCTTTGAAGATGGAGTCAGG + Intergenic
1024072906 7:45801403-45801425 CTGGCTTTGAAGATGGAGTCAGG + Intergenic
1024650430 7:51398775-51398797 CTGGCTTTGAAGATGGAGTCAGG - Intergenic
1025054569 7:55754439-55754461 CTGGCTTTGAAGATGGAGTCAGG - Intergenic
1025132626 7:56384586-56384608 CTGGCTTTGAAGATGGAGTCAGG - Intergenic
1025796134 7:64739293-64739315 CCGGGATTGCGGACGGAGTCTGG - Intergenic
1025911345 7:65831386-65831408 CTGGCTTTGAAGATGGAGTCAGG + Intergenic
1026019904 7:66698496-66698518 CTTGGTTTGGAGCAGGAGCCCGG + Intronic
1029104094 7:98160657-98160679 CTGATTTGGGGGAAGGAGTGTGG + Intronic
1029195726 7:98804022-98804044 CTGGAGTTGGGGAAGGAGCGAGG + Intergenic
1029594931 7:101532662-101532684 CAGAGTCTGGGGAAGGAGTTGGG - Intronic
1030348733 7:108459782-108459804 CTGGGTTTGAAGATGGAGTGAGG - Intergenic
1031143311 7:117969549-117969571 GTGGGGTTGGGGAAGGGGGCAGG + Intergenic
1031604096 7:123748527-123748549 GTGGGAGTGGGGAAGGAGGCGGG - Intronic
1031912100 7:127528471-127528493 CTGGCTTTGTGGAATGAGTTAGG - Intergenic
1032638427 7:133736825-133736847 CTGGGTTTGGGGAAAGAGTAGGG - Intronic
1033149636 7:138902292-138902314 GTGGGTTGGGGGCAGGAGCCGGG - Intronic
1033281474 7:140009576-140009598 GTGGGTGTGGGGAAGGTGTGGGG - Intronic
1033477758 7:141707028-141707050 CTGGGAATGGGGAAGGAATTAGG + Intergenic
1033539726 7:142345401-142345423 CTGGGTCTGGGGAAACTGTCAGG + Intergenic
1033804791 7:144941313-144941335 CGGGGTTTGGGAGAGGAGCCTGG + Intergenic
1034718747 7:153267751-153267773 ATGGGGTTGTGGAAGGAGTATGG + Intergenic
1034851615 7:154499168-154499190 ATGGGTTTGGGGCAGGTGACTGG + Intronic
1034907903 7:154966850-154966872 CAGGGGTTGGGGCAGGAGCCAGG - Intronic
1034934483 7:155190014-155190036 GTGGGTTTGGGGTAGGGGTAGGG + Intergenic
1036185078 8:6615499-6615521 CTGAGTTGGGGGCAGGAGGCAGG + Intronic
1037467093 8:19171816-19171838 TTGGTTTTGGGGGTGGAGTCTGG - Intergenic
1037525950 8:19724392-19724414 CTGGCTTTGGAGATGGATTCAGG - Intronic
1037579676 8:20236965-20236987 CTGGGTGTGGGGTTGGAGTAAGG + Intergenic
1037902730 8:22697044-22697066 CTGGGTGTGGAGCAGGAGTGGGG + Intergenic
1037927148 8:22852435-22852457 ATGGGTTTGGGAAAGAAATCAGG - Intronic
1038198241 8:25387742-25387764 GTGGGTATGTGGAAAGAGTCAGG - Intronic
1039166784 8:34690171-34690193 CTGGTTTTGGGGGTGAAGTCAGG - Intergenic
1039190415 8:34967458-34967480 CTAGGTTTTGGGAGGGATTCAGG + Intergenic
1039371734 8:36991488-36991510 CTGGGTTTTAGGAAGGAATCTGG + Intergenic
1039562030 8:38520274-38520296 CTGGGGTTGGGCAGCGAGTCAGG + Intronic
1039960887 8:42246836-42246858 CTGGGGTTGGGGTGGGAGTGAGG + Intergenic
1041626031 8:60028073-60028095 CTGGGTTTGGGGAGGACGTAAGG - Intergenic
1042475567 8:69245285-69245307 CTGGGATTGCAGACGGAGTCTGG + Intergenic
1044825679 8:96194647-96194669 CTGTATTTGGAGAAGGAGTTTGG + Intergenic
1045086235 8:98689364-98689386 CTGGTTTTGTGGAATGAGTTAGG - Intronic
1045971060 8:108080939-108080961 CTGGGATTGAGAAAGGAATCAGG + Intronic
1046108601 8:109694240-109694262 ATGGGTTTTGGGAAGAAGTTGGG - Intergenic
1046134312 8:110006392-110006414 CTGGGCTTGGAGAATGAGTTTGG + Intergenic
1046585261 8:116142619-116142641 CTGGGCTAGGGAAAGGGGTCTGG + Intergenic
1046644957 8:116776082-116776104 CAGGGTATGGGGAAGGGGCCAGG - Intronic
1046917045 8:119688978-119689000 CTGGGATTCAAGAAGGAGTCAGG + Intergenic
1047373914 8:124278389-124278411 CGGGGTTTGGGGAAGAACTGGGG - Intergenic
1047597158 8:126390263-126390285 ATGGGTTTGAAGAAGGAGACAGG + Intergenic
1047621506 8:126612657-126612679 CTGGTTTTGTGGAAGGAGTTGGG - Intergenic
1047740970 8:127806694-127806716 CTGGGGGTGGAGAAGGAGACTGG - Intergenic
1048307790 8:133296110-133296132 CTGGGCTTGGGGAATGCGGCTGG - Intronic
1048340775 8:133537042-133537064 TTGTGTTTGGGGTAGGAGTTGGG - Intronic
1048449795 8:134523360-134523382 TGGAGTTTGGGGCAGGAGTCTGG - Intronic
1048468876 8:134689513-134689535 CTGAATTAGGGGAAGGAGGCTGG - Intronic
1049644942 8:143731969-143731991 CTCGGGTTGGGGAGGGAGGCAGG + Intronic
1049684628 8:143934375-143934397 CTGGATGTGGAGAAGGAGTGGGG - Exonic
1049891763 9:76130-76152 CTGGGTCTGTGGAAGGAGCTGGG - Intergenic
1051708048 9:19901272-19901294 CTGGGTGTAGGGGAGGACTCAGG + Intergenic
1052413844 9:28152218-28152240 CAGGGTTTGGGGAGGCAGTGAGG + Intronic
1053070678 9:35100007-35100029 CTGGGCTTGGCCAGGGAGTCTGG - Exonic
1053508759 9:38669161-38669183 CTGGGGTTGGGAAAGGACACTGG + Intergenic
1053719778 9:40933764-40933786 GTGGGTTGGGGGAAGGGGACAGG + Intergenic
1053733187 9:41077221-41077243 CTGGGTCTGTGGAAGGAGCTGGG - Intergenic
1054695234 9:68354342-68354364 CTGGGTCTGTGGAAGGAGCTGGG + Intronic
1054722811 9:68620796-68620818 TTGGGATTGGGGAACAAGTCAGG - Intergenic
1054771834 9:69090557-69090579 CTGGGTTGGGGGAGGGAGGAAGG + Intronic
1054821410 9:69524718-69524740 CTGGCTTTGTGGAATGAGTTAGG - Intronic
1055953938 9:81756572-81756594 GTGGGTTTGGTGAAGGTGGCAGG + Intergenic
1056435127 9:86568602-86568624 CTGAATTTGGGCAAGGAGGCTGG + Intergenic
1056763246 9:89429093-89429115 CTGCATTTGGGGAAGGAGCTGGG - Intronic
1057196558 9:93118901-93118923 CTGGTGTTGGGGAAGCAGTGAGG - Intergenic
1057314807 9:93961300-93961322 CTGGGATTGGGGAAGGGGTCTGG + Intergenic
1057316105 9:93969382-93969404 CTGGGGCTGGGGGAGGAGGCTGG + Intergenic
1057953618 9:99389531-99389553 CTGGGTGTGGGGAAGCACACAGG - Intergenic
1058893380 9:109380051-109380073 TTGTGTTGGGGTAAGGAGTCTGG + Intronic
1058976530 9:110129958-110129980 CTGGGGTTGGGGAAAGATTAGGG + Intronic
1060023322 9:120150626-120150648 CTGGCAGTGGGGAAGGATTCAGG + Intergenic
1060212528 9:121719298-121719320 TGGGGGTTGGGGAAGGAGTCGGG + Intronic
1060334694 9:122711057-122711079 CTGGGATTGCAGATGGAGTCTGG + Intergenic
1060938250 9:127528191-127528213 CTGGGGATGGGGAAGGAGAAGGG + Intronic
1061306454 9:129735818-129735840 CTGGGTTGGGGGTGGGTGTCGGG - Intergenic
1062057439 9:134475796-134475818 CTGGGTTTGGGGCTGCAGCCAGG + Intergenic
1062110915 9:134781670-134781692 CATGGTCTGGGGAAGGAGTGGGG + Intronic
1062132720 9:134908633-134908655 TGGGGTTGGGGGAAGGAGTCCGG + Intronic
1062431617 9:136529053-136529075 CTGGGTCTGGGGAGGGCGTGGGG - Intronic
1062500946 9:136851776-136851798 TTGGGGCTGGGGAAGGAGTGTGG - Intronic
1203455228 Un_GL000219v1:160822-160844 GTGGGTTGGGGGAAGGGGGCAGG - Intergenic
1185849893 X:3475484-3475506 GGTAGTTTGGGGAAGGAGTCTGG - Intergenic
1186145228 X:6617986-6618008 CTGGGTTTGGGGCATGCGGCAGG + Intergenic
1186705804 X:12138445-12138467 CTCGGCTTGGAGAAGGAGGCAGG + Exonic
1186786775 X:12962910-12962932 CCGGGTTTGCAGACGGAGTCTGG + Intergenic
1187462512 X:19500576-19500598 CTTGGTTTGGGGAGGGAGAGTGG - Intronic
1187532017 X:20105750-20105772 CTGGGTTTGGTGTTGGGGTCGGG - Intronic
1189286268 X:39854456-39854478 CTGGGGCCGGGGAAGGAGGCTGG - Intergenic
1189851353 X:45179173-45179195 CTTTGTTGGGGGAAGGAGGCTGG - Intronic
1190825210 X:54011395-54011417 ATGGGTTTGGGCAAGAACTCTGG - Intronic
1192152567 X:68721282-68721304 ATGGGTTTGGGGAAGCAGAATGG - Intronic
1192159237 X:68770343-68770365 GTGGGATTGGGGAAGCAGCCAGG - Intergenic
1193132533 X:77932632-77932654 CCGGGTTTGCAGACGGAGTCTGG - Intronic
1195397242 X:104424919-104424941 CAGGGTTTGGGAAAGGGGGCTGG - Intergenic
1195823258 X:108970099-108970121 TTGGGTTTGGGGAAGGGGTGAGG - Intergenic
1196424351 X:115555182-115555204 CTGGGGTTGGGGGAGGAGGGAGG - Intergenic
1197411086 X:126117211-126117233 CTGGGTTTGGGGAGAGAGGTGGG - Intergenic
1197543521 X:127794741-127794763 CTGGGTTTGGGGGAGGGGGGAGG + Intergenic
1197729114 X:129795119-129795141 CTAGCTTTGGGGAAGGGGTTGGG + Exonic
1197735805 X:129850050-129850072 CTGGGATTGCAGACGGAGTCTGG + Intergenic
1197891611 X:131275268-131275290 CTGGGTTTGGGGAGTAAGCCTGG + Exonic
1198574773 X:137998136-137998158 CTGGGTTTGGGGCAGGGGGCTGG - Intergenic
1199100714 X:143796509-143796531 CTGAGTTTGGGCAAGGGTTCTGG + Intergenic
1199440548 X:147863335-147863357 CTGGGGTTGGGGAAAGAATATGG - Intergenic
1199596605 X:149510929-149510951 CTGGGCTTGGGTAAGGAGAAGGG + Intronic
1200081319 X:153578203-153578225 CTGGGTTTAGACAAGGTGTCAGG - Intronic
1201800534 Y:17950047-17950069 CTGGGGTGGGGGAAGGGGTGAGG + Intergenic
1201801019 Y:17955909-17955931 CTGGGGTGGGGGAAGGGGTGAGG - Intergenic
1202196878 Y:22306430-22306452 CTGGGTATGCGGTAGGGGTCCGG - Intergenic