ID: 914848731

View in Genome Browser
Species Human (GRCh38)
Location 1:151298003-151298025
Sequence CTTAGAAGGCAGGGCCTAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 199}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914848726_914848731 2 Left 914848726 1:151297978-151298000 CCCTGGGTCACTGTTGGGAGATA 0: 1
1: 0
2: 0
3: 11
4: 146
Right 914848731 1:151298003-151298025 CTTAGAAGGCAGGGCCTAGATGG 0: 1
1: 0
2: 1
3: 15
4: 199
914848727_914848731 1 Left 914848727 1:151297979-151298001 CCTGGGTCACTGTTGGGAGATAC 0: 1
1: 0
2: 1
3: 4
4: 116
Right 914848731 1:151298003-151298025 CTTAGAAGGCAGGGCCTAGATGG 0: 1
1: 0
2: 1
3: 15
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914848731 Original CRISPR CTTAGAAGGCAGGGCCTAGA TGG Intronic
901322886 1:8350138-8350160 GTTAGAAGGCGGGGCCTGGCTGG - Intergenic
901819334 1:11816681-11816703 GTGAGGAGGCAGGGCCTGGAGGG + Intronic
902511988 1:16971661-16971683 CTTAGAAGGCTGGGCCAGGATGG + Intronic
904113341 1:28143777-28143799 CTTAGGAGGCTGTGCCTGGAGGG + Intergenic
904375903 1:30082386-30082408 CTTTGAAGGCAGCTCCTGGACGG + Intergenic
904809884 1:33156559-33156581 CCTAGAAGTCAGGGACAAGAGGG - Intronic
906102163 1:43270744-43270766 CCGAGAAGGCAGGGCCGAGCAGG - Exonic
906147787 1:43570137-43570159 CTCAGATGGCAGGGCTTAGCTGG + Intronic
906613269 1:47218173-47218195 CCTCGAAGGCAGAGCCTAGAGGG + Exonic
908539408 1:65108433-65108455 CTCAGAAGGCTGAGGCTAGAGGG + Intergenic
914814795 1:151055586-151055608 TTTAGATGGCAGATCCTAGATGG + Intronic
914848731 1:151298003-151298025 CTTAGAAGGCAGGGCCTAGATGG + Intronic
916482145 1:165224014-165224036 TGTTGAAGGCAGGGCCTAGTGGG + Intronic
919860671 1:201737723-201737745 CTCAGCAGGGAGGGCCTGGAAGG - Intronic
920592379 1:207232755-207232777 CTTATAAGGCAATGCTTAGAAGG - Intergenic
921539793 1:216399364-216399386 CTAAGTGAGCAGGGCCTAGAGGG + Intronic
1063100314 10:2944727-2944749 CTTAGAAGGAAGGTCTTAGAAGG - Intergenic
1065722896 10:28643370-28643392 CGCACAAGGCAGGGCCTGGAAGG - Intergenic
1066304849 10:34130408-34130430 CTTAGAAGACTGGGAATAGAAGG - Intronic
1067059334 10:43069885-43069907 CCTGGAAGCCAGGGCCCAGAGGG + Intergenic
1069425758 10:68287508-68287530 GTCAGATGGCAGGGCCTGGATGG - Intronic
1070236175 10:74628855-74628877 TTTAGAAGGCAGAGACTAGGAGG + Intronic
1071540691 10:86480799-86480821 CCTAGAAGCCAGGACCCAGAAGG - Intronic
1073466238 10:103696072-103696094 AGTAGAAGGCAGAGCCCAGAGGG + Intronic
1074436871 10:113441847-113441869 CTTGGAAGGCAGGGCCATGAGGG + Intergenic
1075492418 10:122883286-122883308 ATTATAAGGCAGGGTCAAGATGG - Intergenic
1076331596 10:129674524-129674546 CTTTGAGAGCAGGGCCTTGATGG + Intronic
1077285979 11:1766148-1766170 CTTTGAGGTCGGGGCCTAGAGGG - Intergenic
1078031404 11:7754935-7754957 CCTAGAAGCCAGGGCTGAGATGG - Intergenic
1079590440 11:22176842-22176864 GTTGGAAGGTAGGGCCTAGTGGG - Intergenic
1082067375 11:47911604-47911626 CCAAGAAGGCAGAGCCTGGAGGG + Intergenic
1083064788 11:59913588-59913610 CTTAGTAGGCAGTGCAGAGAGGG + Intergenic
1083202235 11:61127537-61127559 CTCAGAAGGCAAGGCCTGGTTGG - Exonic
1084981308 11:72830162-72830184 CTTACAAGGCAGAGCCCACAGGG + Intronic
1085457611 11:76674133-76674155 CCTAGAAGGCAGGGCCCAGAAGG - Intergenic
1085484981 11:76855377-76855399 CTCAGAAGGCTGGGACGAGAGGG - Intergenic
1087177878 11:95111661-95111683 CATAGGAGGCAGAGCTTAGACGG + Intronic
1088631525 11:111778458-111778480 CCCAGAAAGCAGGGCCCAGAGGG + Intergenic
1089645542 11:119876326-119876348 CCGAGAAGGCAGGGCAGAGAGGG + Intergenic
1094668945 12:32549877-32549899 TGTAGAAGGCAGGGCCAAGGAGG - Intronic
1096004393 12:48157310-48157332 CTTAGAAGGCAGATCGAAGAGGG - Intronic
1096723338 12:53540837-53540859 CTTAGGAGGCTGAGCCTAGGAGG - Intronic
1099471816 12:83059495-83059517 ATTAGAAGCAAGGTCCTAGAGGG + Intronic
1104965057 12:132505288-132505310 CGTGGAAGGAAGGGCCCAGAAGG - Intronic
1106017642 13:25884486-25884508 CTTAGAAGGCAGGCTGCAGAAGG + Intronic
1106126122 13:26901328-26901350 CTTAGAAGCCCCGGGCTAGATGG + Intergenic
1108957685 13:56182127-56182149 ATTGGCAGGCAGGGCCAAGATGG + Intergenic
1110997404 13:82129855-82129877 ATTAGAAGGCAAGGTCTACAGGG - Intergenic
1117289014 14:54314720-54314742 CTTAGAAGGGAGGGCCTGGTTGG - Intergenic
1118524970 14:66629864-66629886 CTTAAAAATCAGGACCTAGAAGG - Intronic
1118767018 14:68916682-68916704 CTTAGAAGGCTGGCCCCAAAGGG + Intronic
1121100091 14:91244587-91244609 GTTTGAAGGCAGAGCCTAGCTGG - Intronic
1121444545 14:93970218-93970240 CTGGGAAGGCGGGGCCAAGAAGG + Intronic
1121777327 14:96599190-96599212 CTCTGAAGGCAGAGCCAAGAGGG + Intergenic
1122064172 14:99160093-99160115 CTGAGAAAGCAGGGCAGAGAGGG + Intergenic
1122066391 14:99176617-99176639 CTGAGAAGCCCTGGCCTAGATGG - Intronic
1124066133 15:26345863-26345885 ATTAGAATGCAAGGCCTTGAGGG - Intergenic
1127103815 15:55592321-55592343 CTTACAAGGCAGAAGCTAGAAGG + Intergenic
1129509861 15:76113460-76113482 CTTAAAAGGCTGGGGCCAGATGG + Intronic
1129685484 15:77684076-77684098 CTTAAAAGGCAAGGCACAGAAGG - Intronic
1131206340 15:90451575-90451597 GTTGGGAGGCAGGGCCTAGTAGG - Intronic
1133000758 16:2850307-2850329 CTGAGAATGTAGCGCCTAGAGGG - Intergenic
1138205084 16:55118781-55118803 CTCAGAAGGCAGGGGGTGGAGGG - Intergenic
1138217129 16:55214366-55214388 CTTAGAGTGCAGGGTATAGAAGG - Intergenic
1138757529 16:59506363-59506385 ATTAGAAGGCAGAGCCCAGGAGG + Intergenic
1141277645 16:82602938-82602960 CTTAGGAGGTAAGGCCTGGAAGG - Intergenic
1141398562 16:83726453-83726475 CTAAGAAGGCAGGCCCTGCAGGG + Intronic
1142103916 16:88291912-88291934 CTAAGAAGGCAGGGCCTCTGGGG + Intergenic
1143252464 17:5533574-5533596 TTTAGATGGCAGGGCAAAGATGG + Intronic
1144292065 17:13836348-13836370 TGTTGAAGGCAGGGCCTAGTGGG - Intergenic
1144828157 17:18118106-18118128 CTCAGAAGGCAGGGCAAGGAGGG - Intronic
1144960409 17:19041335-19041357 CTCCAAAGGCAGGGCCTACAGGG + Intronic
1144974750 17:19133189-19133211 CTCCAAAGGCAGGGCCTACAGGG - Intronic
1145815505 17:27792663-27792685 CTTTGAATGCAGGTCCTTGAGGG - Intronic
1146109846 17:30078993-30079015 CTTAGAACGCATGGCCCTGAGGG + Intronic
1147119405 17:38327077-38327099 TTCAGAAGGCAGGACCTGGAGGG - Exonic
1147566276 17:41538170-41538192 CTGTGAAGGCAGGGCCCAGGTGG - Intergenic
1148351709 17:46946028-46946050 CTTGGAAGGCGGGGCCTCCAGGG + Intronic
1148702993 17:49602400-49602422 CACAGACCGCAGGGCCTAGAAGG - Intronic
1148703249 17:49604762-49604784 CACAGACCGCAGGGCCTAGAAGG + Intronic
1149229813 17:54519638-54519660 CATAGGAGGCAGGGCCAAGAAGG - Intergenic
1150267573 17:63841295-63841317 CTTAGAAGTGAGGGCCCAGTGGG + Intronic
1150948847 17:69778707-69778729 CCTAGAAGGCAGGGCTGATATGG + Intergenic
1153085367 18:1279379-1279401 CTTAGAATTCAGAACCTAGATGG + Intergenic
1155226272 18:23732212-23732234 CTGAGCAGCCAGGGGCTAGAAGG + Intronic
1159116795 18:64123753-64123775 GTTGGAAGGCAGGGCCTGGTAGG + Intergenic
1164599583 19:29551951-29551973 CCTACAAGGCAAGGCCCAGAGGG - Intronic
1166327461 19:42059910-42059932 TTTGGAAGGGAGGGCCTTGATGG - Intronic
1167340598 19:48913614-48913636 CTTAGCATTCAGGTCCTAGAAGG - Intronic
1167690567 19:50982132-50982154 CACAGGAGGCAGGGCCTGGAGGG + Intronic
925617931 2:5761766-5761788 ATTAGAAGGCAGGGGCAGGAGGG - Intergenic
929636342 2:43525569-43525591 GCTAGAAGGCTGGGCCTAGTTGG - Intronic
929867876 2:45733855-45733877 CTGAGAAGGCAGGGGCCAGCAGG - Intronic
931447062 2:62335614-62335636 ATTTGGAGGCAGGGCCTACAAGG + Intergenic
932549626 2:72754719-72754741 CTTAGGAGGCGGAGGCTAGAGGG - Intronic
932806937 2:74792417-74792439 CCAGGAAGGCAGGGCCTAGTAGG + Intergenic
935296953 2:101657983-101658005 CTTAGGAAACAGGGCTTAGAGGG + Intergenic
935398518 2:102636488-102636510 CTTAGAAGGCAAGCTCTTGAAGG + Intronic
936697356 2:114966278-114966300 CTTGGGAGGTGGGGCCTAGAGGG + Intronic
938086857 2:128407484-128407506 CCCTGAAAGCAGGGCCTAGAAGG + Intergenic
938207569 2:129437339-129437361 CATTGAAGGAAGGGCCTGGAGGG + Intergenic
940071513 2:149693250-149693272 TTGGGAAGGCTGGGCCTAGAAGG - Intergenic
940224990 2:151391758-151391780 CTCAGAAGGCTGGGTCTAGGCGG + Intergenic
942205923 2:173620052-173620074 CTGCGAAGGCAGGGCTTAGAAGG + Intergenic
942226156 2:173818061-173818083 CTTGGAAGGCATGGCATGGAAGG - Intergenic
942227685 2:173831488-173831510 CTTTGAAGACAGCGCCGAGAGGG + Intergenic
942505175 2:176634424-176634446 CTCAGAAGGCAAAGTCTAGATGG + Intergenic
946643742 2:221811709-221811731 ATTAGAAGGCAGGCCCAGGATGG - Intergenic
948019011 2:234715012-234715034 CTTGCAAGGAAGGGCCAAGAAGG + Intergenic
948267179 2:236643509-236643531 CTCAGAAAGAAGGGCCCAGAAGG - Intergenic
948373110 2:237503261-237503283 CTGCCAAGGCAGGGCCTGGAGGG + Intronic
1169980493 20:11379231-11379253 CTTGGGGGGCAGGGCCAAGATGG + Intergenic
1172493365 20:35359767-35359789 CCAAGAAAGCAGAGCCTAGATGG + Intronic
1172738052 20:37143473-37143495 CTAAGAAGGCAAGGCATATATGG + Intronic
1172778189 20:37420201-37420223 CAGAGAAGGCAGGGGCCAGACGG - Intergenic
1173409378 20:42796143-42796165 CTTAGAAAGCAGAGACTACAGGG + Intronic
1174235205 20:49084462-49084484 CTTAGCAGCCAGGGCAAAGAGGG + Intronic
1176053983 20:63134877-63134899 CAGGGGAGGCAGGGCCTAGAGGG + Intergenic
1178450261 21:32692030-32692052 AGTAGGAAGCAGGGCCTAGAGGG + Intronic
1179779514 21:43690419-43690441 CCTGGACGGCAGGGCCTGGAGGG - Exonic
1182824583 22:33253796-33253818 CTGAGAAAGCAGGGCCTGGCTGG + Intronic
1182946480 22:34327612-34327634 GTTAGGAGGCAGGGCCTAGTGGG + Intergenic
1185085545 22:48738865-48738887 CTCAGAATTCAGGGCCAAGATGG + Intronic
949738322 3:7200228-7200250 GTTAGGAGGTAGGGCCTAGTGGG - Intronic
949971148 3:9406012-9406034 CTTAGAAGGAAGAACCTGGAAGG + Intronic
951951317 3:28202411-28202433 CTAGGAGGGCAGGGCCAAGATGG + Intergenic
953462109 3:43089627-43089649 GTTAGAATGGGGGGCCTAGAAGG + Intronic
953853616 3:46484546-46484568 CTGGGAAGGCAGTGCCAAGAAGG + Intronic
954286927 3:49625796-49625818 CTTTGACAGCAGGCCCTAGATGG + Intronic
954305856 3:49724948-49724970 CTAAGAAGGCTGGGCCTGGCAGG + Exonic
954448880 3:50561121-50561143 GTCAGGAGGCAGGGCCTGGAGGG - Intronic
956426844 3:69144820-69144842 CTGAGAAGGCGGGAGCTAGAGGG + Intergenic
957989568 3:87611927-87611949 CTAGGAAGGCAGGGCTAAGATGG + Intergenic
963207009 3:142646941-142646963 CTTAGAAAGCATGGCTTGGAGGG + Intronic
964778972 3:160314344-160314366 GTTAGAAGGAAGTGCCTAGGAGG - Intronic
964837573 3:160956282-160956304 CTTACAAGGCAGGGCATAAAAGG - Intronic
966916049 3:184584581-184584603 CTTGGAAGGTGGGGCCTAGAGGG - Intronic
967948745 3:194824186-194824208 CTGAGAAGGCCTGGCCCAGAGGG + Intergenic
969629772 4:8329381-8329403 CTTAGAAGGTAAGGCCTCCAGGG + Intergenic
970460243 4:16268041-16268063 CTTACAAGGCAGAGCCCAGTGGG - Intergenic
971137529 4:23886167-23886189 CTTGGAAGGCAGGGCCATGAGGG - Intronic
979352670 4:119663476-119663498 CTTTAAAGGGAGGGCATAGAAGG + Intergenic
981612856 4:146614128-146614150 CGTTGGAGGCAGGGCCTAGTGGG + Intergenic
981740533 4:147996740-147996762 ATTTGAAGGCAGGGTCTTGAAGG + Intronic
982176212 4:152707762-152707784 CTGAGGAGGGAGGGCCCAGAGGG + Intronic
984163520 4:176282352-176282374 CTGAGGAGGCGGGGCCAAGATGG + Intergenic
984721425 4:182976751-182976773 CATAGAAGAAAGGCCCTAGAAGG + Intergenic
984752249 4:183289268-183289290 CCTAGAAGCCAGGGCCTAAGGGG - Intronic
984962216 4:185108942-185108964 CTGAGAAGGCATGCCCAAGATGG + Intergenic
984970818 4:185188261-185188283 CTTTGAAGGCTGAGGCTAGAGGG - Intronic
985747803 5:1656982-1657004 CTTAGAAAGCAGGGCCTATGGGG + Intergenic
985846620 5:2354259-2354281 CTTAGCAGGCAGAGCCAAGGAGG - Intergenic
988490365 5:31700558-31700580 CTTAGCAGGCAGGGCCTTGCAGG - Intronic
988632234 5:32943784-32943806 ATTAGAAGGCAGGGGTTATAGGG - Intergenic
988806029 5:34741617-34741639 CTTATATGGCATGGCCCAGAGGG + Intronic
988984308 5:36601965-36601987 CTTTGAGGGCAGGGCCTGTATGG - Intergenic
990015932 5:51063287-51063309 GATAGGAGGCAGGGCCAAGAGGG + Intergenic
990845207 5:60129942-60129964 ATTAGAAGGTAGGGCCTGGGGGG + Intronic
993004125 5:82412587-82412609 CTTAGAAGGGAGAGCTTAAAGGG + Intergenic
993446628 5:88020560-88020582 TGTTGGAGGCAGGGCCTAGAGGG - Intergenic
994508927 5:100678580-100678602 CTGATAAGGCAGGGACCAGATGG - Intergenic
996163618 5:120197491-120197513 GTTAGAAGGCAGGAGTTAGAGGG + Intergenic
996568707 5:124909429-124909451 CTTCAAAGGCAGAGCCTGGATGG + Intergenic
996872054 5:128202787-128202809 CTCAGAACTCAGGGGCTAGAAGG - Intergenic
997431300 5:133842973-133842995 CTTGGAAGTCAGGGCCTGCAGGG - Intergenic
997834341 5:137180140-137180162 ATTAGGAGGCAGGTGCTAGAGGG - Intronic
999296041 5:150459967-150459989 TTGACAAGGCAGGGCCTAGCAGG - Intergenic
1002098826 5:176847363-176847385 CATAGAAGGGAGGCCCTGGAGGG - Intronic
1003394618 6:5742485-5742507 CATTGAAGTCAGGGCTTAGAAGG - Intronic
1005304870 6:24503972-24503994 AGTAGAAGGCAGGACCCAGAAGG - Intronic
1006702026 6:35982915-35982937 ATTAAAAGTCAGGGACTAGAGGG - Intronic
1008879072 6:56362591-56362613 CTTTGAAGGAAAGGCCGAGAAGG - Intronic
1015678031 6:135771902-135771924 CTTATAAAGCATGGCTTAGAAGG - Intergenic
1016139043 6:140585723-140585745 ATGAGAAGGCAGAGCCAAGATGG + Intergenic
1016799979 6:148158558-148158580 CATAGAATGCACGGCCTATAGGG + Intergenic
1017758880 6:157552792-157552814 ATTATAAGGCAGGGTGTAGAAGG - Intronic
1019369698 7:655189-655211 CTGAGATGGGAGGCCCTAGAAGG - Intronic
1020333941 7:7047103-7047125 CTGAGCAGCCAGAGCCTAGAAGG + Intergenic
1023246091 7:38205811-38205833 ATTAGAAGGCAGAGGGTAGAGGG - Intronic
1024096464 7:45986653-45986675 CATAGAAGGCAGGCCCAGGATGG + Intergenic
1024281738 7:47724418-47724440 CCTACAAGGCAAGGCCTAAAGGG + Intronic
1027201897 7:76069251-76069273 CCTGGAAGGCAGGAGCTAGAGGG - Intergenic
1029359684 7:100079558-100079580 CTTTGAAGTCAGTCCCTAGAAGG + Intronic
1030080559 7:105774218-105774240 TTAAGAAGGCAGGGGCTAGATGG - Intronic
1030692505 7:112550555-112550577 ATTACAAAGCAGGGACTAGAAGG - Intergenic
1032766625 7:135000122-135000144 CTAATAAGGCAGTGCCCAGAAGG - Intronic
1033603641 7:142908881-142908903 TTTAGAAAGCAGGGTCAAGAGGG + Intronic
1033879299 7:145861959-145861981 ATTAGGAGGCAAGGCCAAGATGG + Intergenic
1037647649 8:20807991-20808013 CATTGAAGGTGGGGCCTAGAGGG + Intergenic
1038180036 8:25218821-25218843 CTTAGGTGGCAGGACCTTGAAGG + Intronic
1041530341 8:58858566-58858588 CTTTGCAGGCAAGGCCTGGAAGG + Intronic
1042866393 8:73359924-73359946 CTTAGAAGGCAGAGTCCAAAGGG - Intergenic
1043510307 8:80944648-80944670 TTTAGGAGGCAGGGCCTAGTAGG - Intergenic
1045087628 8:98703683-98703705 CTTAGAAGGATGGGGCTATAGGG - Intronic
1048496937 8:134943106-134943128 CTTATAAGGCATGGTCTGGATGG + Intergenic
1050252200 9:3756892-3756914 TTAAGAAAGCAGGGCTTAGATGG - Intergenic
1050328872 9:4524945-4524967 ATTGGAAGGCAGGGCCCAGTGGG - Intronic
1051596304 9:18827415-18827437 CTGAGTGGGCAGGGTCTAGAAGG - Intronic
1054904099 9:70399794-70399816 TTTGGAAGGAAGGGCCTGGAAGG - Intronic
1057191870 9:93092882-93092904 CTTGGAAGGCAGAGCCCACAGGG + Intergenic
1057818505 9:98313787-98313809 GGTAGAAGGCAGGTCTTAGACGG + Intronic
1061575723 9:131504514-131504536 CTCAGAAGGCAAGACCTAAAAGG - Intronic
1191146422 X:57170585-57170607 CTCAGAAGGCAGAGTGTAGAAGG - Intergenic
1192256730 X:69467559-69467581 CTTAGGAGGTAGGGCTTAGTGGG + Intergenic
1197105116 X:122704026-122704048 CTTAGAAGGCCCTCCCTAGAAGG + Intergenic
1197276646 X:124487402-124487424 CTTAGGAGGCAAAGCCTGGAGGG - Intronic
1198024674 X:132693466-132693488 CTCAGAGGGCAGAGCCTGGAAGG + Intronic
1200162096 X:154014907-154014929 CTGAGAGGGCAGAGCCGAGAAGG + Intronic
1200688120 Y:6276072-6276094 TTTAGATGTCAGGGCCTTGAAGG - Intergenic
1200855441 Y:7932932-7932954 CTTTGAAGGCAGAGCCACGATGG + Intergenic
1201047147 Y:9898628-9898650 TTTAGATGTCAGGGCCTTGAAGG + Intergenic
1201935552 Y:19407292-19407314 TTTAGATGGCAGGCCCTAGGGGG + Intergenic
1202106889 Y:21380225-21380247 CTTAGATGTCAGTGCCTTGAAGG + Intergenic
1202263917 Y:22998311-22998333 CTTTGAAGGCAGAGCCACGATGG - Exonic
1202416908 Y:24632053-24632075 CTTTGAAGGCAGAGCCACGATGG - Exonic
1202453879 Y:25038033-25038055 CTTTGAAGGCAGAGCCACGATGG + Exonic