ID: 914854001

View in Genome Browser
Species Human (GRCh38)
Location 1:151336866-151336888
Sequence CCAGCTAGAATGTTTAAAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 128}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914853997_914854001 8 Left 914853997 1:151336835-151336857 CCATGCTGTGATCATTTATTTGT 0: 1
1: 0
2: 5
3: 54
4: 628
Right 914854001 1:151336866-151336888 CCAGCTAGAATGTTTAAAGTTGG 0: 1
1: 0
2: 1
3: 13
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914854001 Original CRISPR CCAGCTAGAATGTTTAAAGT TGG Intergenic
909837242 1:80272015-80272037 CCAGCTAGAATGTAAAATTTTGG + Intergenic
909974967 1:82035372-82035394 CCAGAAACAATGTTTAAAATGGG - Intergenic
910505070 1:87941185-87941207 CCAACTAGGATTTTTAAATTAGG + Intergenic
914854001 1:151336866-151336888 CCAGCTAGAATGTTTAAAGTTGG + Intergenic
919327276 1:196124554-196124576 CGAGATAGAATGGCTAAAGTGGG - Intergenic
919833002 1:201555323-201555345 TCACATAGAATGTTAAAAGTAGG - Intergenic
920766214 1:208836310-208836332 CCAGCCAGAATAATTAGAGTAGG + Intergenic
921767599 1:218990495-218990517 ACAGTTACAATGTGTAAAGTTGG - Intergenic
922441552 1:225659269-225659291 CCAGCTAGATTTTATAAAATAGG - Intergenic
1063180967 10:3599590-3599612 CCATCTGGAATGTTTACAGAAGG + Intergenic
1067133205 10:43584946-43584968 CCAGGTAGTATGTGTACAGTGGG + Intergenic
1067332706 10:45336697-45336719 GCAGCTAGAATATGAAAAGTTGG + Intergenic
1068998640 10:63238257-63238279 CCACCTAGAATTTTTAAGGAAGG + Intronic
1075112571 10:119599131-119599153 CAAACTAGAATGGTTAAAATGGG + Intergenic
1079698730 11:23517871-23517893 CTAGCTAGAAATTTAAAAGTGGG - Intergenic
1079950394 11:26794871-26794893 TCAGCTTGAATGTTTAAAATAGG - Intergenic
1081828921 11:46089139-46089161 TCAGACACAATGTTTAAAGTAGG + Intronic
1084885051 11:72198614-72198636 CAAGCTGCAATGTTTAATGTGGG + Intergenic
1084990962 11:72925362-72925384 CCAGCTGGAATTTTTAAAGTAGG - Intronic
1086682608 11:89691822-89691844 CCACTCAGAATGTTGAAAGTAGG - Intergenic
1090229827 11:125093568-125093590 CCAGCTGGAATGTTGAGACTTGG - Intergenic
1092207867 12:6627091-6627113 CCAACTGAAATGTATAAAGTGGG + Intronic
1094033013 12:26034700-26034722 CTAGCTAGGATGTAAAAAGTAGG - Intronic
1096179441 12:49542573-49542595 CCACTTAGAATGTTTAGAGTTGG - Intronic
1096688744 12:53306641-53306663 ATAGCTAGAAGGTTTAAGGTAGG - Intronic
1099638643 12:85253141-85253163 GCAGCATTAATGTTTAAAGTTGG + Intronic
1100894685 12:99168218-99168240 CCAGCTTAACTTTTTAAAGTAGG - Intronic
1101769296 12:107733688-107733710 GCAGCTAGTAAGTTTAAAGCAGG - Exonic
1106595818 13:31135470-31135492 GCAGCTAGAAATTATAAAGTAGG + Exonic
1106873106 13:34043164-34043186 TCAGCTAGAATAGTTTAAGTGGG + Intergenic
1108695451 13:52898851-52898873 ACAGATAGAACGTTGAAAGTAGG - Intergenic
1109277703 13:60321031-60321053 GCAGATAGAATGTTGAAAGTAGG + Intergenic
1109963784 13:69666012-69666034 CCACAGAGAATGTTAAAAGTGGG + Intergenic
1116637401 14:47415311-47415333 CAAGATAGGATGATTAAAGTTGG - Intronic
1117414686 14:55483857-55483879 TCATGTAGAAAGTTTAAAGTAGG + Intergenic
1119843537 14:77811119-77811141 CCACCTAGAATGTTGGAAGTAGG + Intronic
1121430093 14:93880342-93880364 GCTGCTAAAATGTTTTAAGTGGG + Intergenic
1122330370 14:100908106-100908128 GCACCTAGAATGTGTGAAGTAGG - Intergenic
1124077856 15:26462552-26462574 TCAGCCAAAATGTTTATAGTGGG - Intergenic
1127478406 15:59356136-59356158 GCAGCTATAATGTTGAAAATGGG - Intronic
1127667776 15:61165728-61165750 TCAGCTTTCATGTTTAAAGTGGG - Intronic
1128009994 15:64283781-64283803 CCATCAAGAAAGTTAAAAGTTGG - Intronic
1129562900 15:76590225-76590247 CTAGATAGAATGTTATAAGTTGG + Intronic
1130138493 15:81202069-81202091 CCAGATAAAATGTATAAAGTAGG - Intronic
1130516481 15:84629805-84629827 CCAGATAAAATGTGTAAAGTAGG + Intergenic
1132306208 15:100814980-100815002 CAAGCAAGAATTTTTAAAGGTGG - Intergenic
1140926706 16:79590338-79590360 TCAGCTGGAATCTTTAAAGCTGG - Intronic
1143325983 17:6098739-6098761 CCAGCTTTAAAGTTTAAAGTGGG + Intronic
1153690608 18:7589492-7589514 CTATCTAGAAAGATTAAAGTTGG - Intronic
1154041442 18:10859944-10859966 GCAGCTAGGAAGTTTAAAGTGGG + Intronic
1156859401 18:41818526-41818548 ACAGCTAGAGAGTTTAAAGCAGG - Intergenic
1157301365 18:46482232-46482254 CCAGCTTCAATGTATAAATTTGG - Intronic
1160405143 18:78640198-78640220 CCACCTAGACTGTCTACAGTGGG - Intergenic
1164033567 19:21433491-21433513 CCAGGTAGTATGTGTACAGTGGG + Intronic
1167999771 19:53435687-53435709 CCAGGTAGTATGTGTACAGTGGG + Intronic
925030321 2:645509-645531 CCATCTAAAATGTTTCAAGGAGG + Intergenic
925929174 2:8693807-8693829 CTAGCTAGAATGTGTTAACTGGG - Intergenic
928337370 2:30409189-30409211 CCAGTAAGAATGTTTAAAACTGG - Intergenic
928992303 2:37246562-37246584 AAAGCTAGAATGATTACAGTAGG - Intronic
935637178 2:105258306-105258328 CCAGAAAGAATGTTTAATCTGGG - Intergenic
939343269 2:140928464-140928486 CCAACTTGAATGTTTGCAGTTGG + Intronic
940918081 2:159280155-159280177 CCAGTTAAAATGTTTAAGGGAGG - Intronic
943456657 2:188116396-188116418 ACAATTAGAATGTTTACAGTTGG - Intergenic
945331970 2:208550364-208550386 TGAGCTAGATTGTTTTAAGTTGG - Intronic
948357314 2:237389262-237389284 TCAGTTCGAATGTTTAAATTTGG + Intronic
1170556269 20:17517582-17517604 ACTTCTAGAAAGTTTAAAGTTGG - Intronic
1172811562 20:37651842-37651864 CCAGCTAGAATGCTTCAACAAGG + Intergenic
1173286470 20:41675523-41675545 CAAGATAGAATTTTTAAAGAGGG + Intergenic
949641024 3:6036151-6036173 GCAGCCAGGAAGTTTAAAGTGGG - Intergenic
951060004 3:18194936-18194958 CCAGATATAATGTTTAATTTGGG - Intronic
952165933 3:30748753-30748775 GCAGCTAGAATTTTTAACCTGGG + Intronic
953274902 3:41485259-41485281 TCATCTAGCAAGTTTAAAGTGGG + Intronic
961383229 3:126509332-126509354 GCTGCTAGAATATTTAAAATTGG + Intronic
961983350 3:131104559-131104581 CCAGCTGGAATGTTCAGATTGGG + Intronic
965585082 3:170310873-170310895 ACATCCAGAATGGTTAAAGTGGG - Intergenic
971867123 4:32187538-32187560 TAAGTTAGAATGTGTAAAGTTGG - Intergenic
973039643 4:45454291-45454313 GCACTTAGAATGTTTAAAATGGG - Intergenic
974846361 4:67355139-67355161 CCAGAAATAATGTTTAATGTGGG + Intergenic
975103326 4:70539544-70539566 GCAAGTAGAATGTTTAAAATTGG - Intergenic
975860037 4:78667406-78667428 GCAGCTAGAAAGTATTAAGTGGG - Intergenic
978268725 4:106861321-106861343 ACAGCTAAATTGTTGAAAGTCGG - Intergenic
978613200 4:110566920-110566942 CCAGATATAATGTTTAATATGGG + Intergenic
980225121 4:129973565-129973587 CCATCTAGATGCTTTAAAGTAGG + Intergenic
981349260 4:143710046-143710068 CCAGCAATAATGTTTAACCTGGG - Intergenic
982349986 4:154404942-154404964 CAAGAGAAAATGTTTAAAGTGGG - Intronic
983853438 4:172612165-172612187 GCAGGAAGAATTTTTAAAGTTGG + Intronic
983943897 4:173564937-173564959 CCATCTTTATTGTTTAAAGTAGG + Intergenic
989440264 5:41463019-41463041 CCAGCTAGACTGATTTGAGTAGG + Intronic
991091350 5:62696614-62696636 CCAGCCAGATTGTTTTATGTGGG + Intergenic
991468818 5:66945431-66945453 CCTGATAGTATGTGTAAAGTTGG - Intronic
993601333 5:89928632-89928654 CCAGTTAGCATGGTTAAAGAAGG + Intergenic
993755129 5:91719805-91719827 GCAGGAAGAATGTTGAAAGTTGG + Intergenic
993847257 5:92959447-92959469 CAAGCCAGAATGCTTAAAGAAGG + Intergenic
995245480 5:109930602-109930624 TCAGCTAGAATATTTATTGTTGG - Intergenic
995819477 5:116212700-116212722 CCAGCTAGTTTTCTTAAAGTTGG - Intronic
1003694605 6:8390905-8390927 ACAGATTGAATTTTTAAAGTTGG + Intergenic
1005580101 6:27225797-27225819 CCACCTAGAATATAGAAAGTTGG + Intergenic
1007894046 6:45329987-45330009 CCAGTTAAAATGTGTGAAGTAGG - Intronic
1011874117 6:91935389-91935411 CCAGCTAGCATGTCCAGAGTTGG - Intergenic
1012609322 6:101196686-101196708 CCATAAATAATGTTTAAAGTTGG - Intergenic
1014553053 6:122811133-122811155 CCTGCAATAATATTTAAAGTTGG + Intergenic
1015999724 6:139029788-139029810 CCAGCCCGAGTGTGTAAAGTTGG + Intronic
1020437387 7:8179342-8179364 CTAGCTATAATGTTGGAAGTGGG + Intronic
1020918422 7:14229161-14229183 CAATATAGAATGTTTAAAATTGG - Intronic
1021317737 7:19171002-19171024 GCAGCTAGATTGTCTAATGTGGG + Intergenic
1022240764 7:28510524-28510546 GCAGCTAGAAGTTTTAAAGGTGG - Intronic
1024780922 7:52847211-52847233 CCTGCTATAATGTTATAAGTTGG + Intergenic
1027882052 7:83852597-83852619 ACAGCCAGAATGTTGATAGTGGG - Intergenic
1028011623 7:85650633-85650655 TAAATTAGAATGTTTAAAGTAGG - Intergenic
1030267930 7:107639745-107639767 CCAGCTGGAATTTCTAAAGGTGG - Intergenic
1031451349 7:121924384-121924406 CTAAGTAGAATTTTTAAAGTGGG + Intronic
1031479522 7:122261399-122261421 CCAGCTAAAATGTAGACAGTTGG + Intergenic
1032063132 7:128741596-128741618 CCAGCTAGAGTGATCATAGTAGG + Intronic
1033365093 7:140666976-140666998 CCAGGTAGTATGTGTACAGTGGG - Intronic
1035903857 8:3487658-3487680 CCAGATAGAATTTTCAAAGGAGG + Intronic
1036199731 8:6758880-6758902 CCAACTGGTATGTTTAATGTGGG - Exonic
1036486448 8:9183911-9183933 CCAGGCAGAAAGTTTAAAATTGG - Intergenic
1041974931 8:63787407-63787429 ACAGATAGCATTTTTAAAGTTGG - Intergenic
1042454744 8:68988152-68988174 CCAGGTAAAATGAATAAAGTTGG - Intergenic
1042860833 8:73311916-73311938 GCAACTAGAATATTTAAAGTTGG + Intronic
1043256595 8:78146410-78146432 ACAGATTGAATGTTTAAAATAGG - Intergenic
1043279352 8:78444414-78444436 CCATCTATAATTTTTAATGTAGG - Intergenic
1045579407 8:103462439-103462461 CCATCTAGAATGTAGAAAGCTGG - Intergenic
1048303228 8:133266497-133266519 CCAGCTTGAATCTTTAAAACAGG + Intronic
1051119097 9:13732101-13732123 CCACCATGAATGTTTGAAGTGGG + Intergenic
1052021365 9:23529430-23529452 TCAGCTAGAGTGTTTTAACTGGG - Intergenic
1052437680 9:28449673-28449695 TCAGCTAGAATGTTTATAAAAGG + Intronic
1053462391 9:38280860-38280882 TCAGCTAGAATGGTCAAAGTAGG - Intergenic
1054580308 9:66905701-66905723 CCAAATAGAAACTTTAAAGTTGG - Intronic
1056458966 9:86791059-86791081 CCAGATAGAATATGTAAAGTTGG + Intergenic
1060005134 9:119993065-119993087 CCAGCAACATTTTTTAAAGTGGG + Intergenic
1062381270 9:136287990-136288012 CCAGCTATAATTTTTTAGGTGGG + Intronic
1188046883 X:25435673-25435695 ACAGCTAGAAAGTGGAAAGTGGG - Intergenic
1191015403 X:55804669-55804691 GCATCTAGAAAGTGTAAAGTTGG - Intergenic
1191230202 X:58087744-58087766 CCAGTTAGAATGCTTGAAGTCGG - Intergenic
1191933919 X:66405376-66405398 CCAGGGAGTATGTTGAAAGTGGG + Intergenic
1192078651 X:68025608-68025630 CCAGAAATAATGTTTAATGTGGG - Intergenic
1195400688 X:104458174-104458196 CCAGAAACAATGTTTAAACTGGG - Intergenic
1195738609 X:108039111-108039133 CCACCTAGAATGTGTTAACTAGG + Intergenic
1198511827 X:137359783-137359805 GCTTCTAGAATCTTTAAAGTGGG - Intergenic
1198864267 X:141104805-141104827 CCAGATATAATTTTTAAAGCAGG - Intergenic
1198898422 X:141482611-141482633 CCAGATATAATTTTTAAAGCAGG + Intergenic
1199762619 X:150916674-150916696 CCAGCCAGGCTGTTTAAAGTTGG + Intergenic