ID: 914860772

View in Genome Browser
Species Human (GRCh38)
Location 1:151384067-151384089
Sequence CTATGTGTTTGCTGTGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914860772_914860774 15 Left 914860772 1:151384067-151384089 CCATCTTCACAGCAAACACATAG No data
Right 914860774 1:151384105-151384127 TTAGCTCCATTTTACAGATAAGG 0: 3
1: 59
2: 542
3: 2382
4: 6487

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914860772 Original CRISPR CTATGTGTTTGCTGTGAAGA TGG (reversed) Intergenic
No off target data available for this crispr