ID: 914862175

View in Genome Browser
Species Human (GRCh38)
Location 1:151396033-151396055
Sequence CTCACATACTAGTGCAGCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914862173_914862175 0 Left 914862173 1:151396010-151396032 CCTCAGGGGATCCTCAAGGGGGA No data
Right 914862175 1:151396033-151396055 CTCACATACTAGTGCAGCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914862175 Original CRISPR CTCACATACTAGTGCAGCCA TGG Intergenic
No off target data available for this crispr