ID: 914863632

View in Genome Browser
Species Human (GRCh38)
Location 1:151407114-151407136
Sequence CAGAAAAAGGAGAAAGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1302
Summary {0: 1, 1: 1, 2: 9, 3: 137, 4: 1154}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914863632 Original CRISPR CAGAAAAAGGAGAAAGTGGG AGG (reversed) Intronic
900423568 1:2566237-2566259 CAGAAAAGGGAGAAAAGGGGTGG - Intergenic
900626459 1:3610901-3610923 CAAAAGAAGGGGAGAGTGGGAGG + Intronic
900631044 1:3635482-3635504 AGGAAAAAGGGGAAATTGGGAGG + Intronic
900932879 1:5747793-5747815 GAGAGAAAGGAGAAAGAGGGAGG + Intergenic
901804525 1:11729721-11729743 GAGAAGAACGAGGAAGTGGGTGG - Intergenic
901854569 1:12036407-12036429 CAGAAAAAGAAAAAAGAGGCTGG + Intergenic
902255589 1:15186879-15186901 CAGACCAAGCAGAAAGTAGGGGG + Intronic
902567619 1:17322852-17322874 CAGAAGAAAGAAGAAGTGGGAGG - Intronic
902599912 1:17533945-17533967 AAGAAGAAGAAGAAAGTGGGTGG - Intergenic
903134297 1:21299237-21299259 CAGAGGGAGGAGGAAGTGGGTGG + Intronic
903644521 1:24886522-24886544 CAGAAAGAGGAGGGAGTGGCTGG - Intergenic
903959885 1:27050227-27050249 CAGATACAGGAGAAGGTGGAGGG + Intergenic
904376600 1:30085922-30085944 CAGAGAGAGGGGAGAGTGGGTGG - Intergenic
904858328 1:33516603-33516625 AAGAAAAAAGAGGCAGTGGGAGG + Intronic
904868714 1:33602788-33602810 CATAAGAAAGAGAAAGAGGGAGG - Intronic
904902618 1:33869412-33869434 CAGGAAATGGAGGAAATGGGTGG + Intronic
905264840 1:36744470-36744492 CAGAAGCAGCAGAAAGTTGGGGG + Intergenic
905330847 1:37195648-37195670 AAGAGAGAGGGGAAAGTGGGAGG - Intergenic
905524492 1:38625892-38625914 TGGAAAAAAGAGAAAGAGGGAGG + Intergenic
905838495 1:41152006-41152028 TAGAAGAGGCAGAAAGTGGGTGG + Intronic
905949116 1:41931536-41931558 CTGAAAAAGCACAAAGTTGGAGG - Intronic
906080750 1:43086654-43086676 CAGAAAAGGGGGAAAGGGGTCGG - Intergenic
906156562 1:43617419-43617441 CAGAGAATGGAGAAAGCGGGTGG - Intronic
906271935 1:44486217-44486239 CAGAACAAAGTGAAAGGGGGGGG + Intronic
906542156 1:46595413-46595435 CAGAGGAAGGAGGCAGTGGGTGG - Intronic
906544596 1:46612247-46612269 CAGGAAAAGGAGGGAGTTGGTGG - Intronic
906626781 1:47332135-47332157 AAGAAAAAGGAGAATGGGGGTGG + Intergenic
906757856 1:48337038-48337060 CATAAAAAGGAAATAGTGGTTGG - Intronic
907288500 1:53397366-53397388 GAGAAACAGGAGAAAGGGGCAGG - Intergenic
907771482 1:57469397-57469419 CAGAAAAAGGAGAAAAAAGTTGG + Intronic
907894939 1:58679206-58679228 CAGAAATAGAAGAGAGTGAGTGG - Intronic
908554014 1:65239102-65239124 AAGAAAAAAAAGAAAGTGGGAGG - Intergenic
908834424 1:68214356-68214378 AAAAAAAAGGAGTAAGTTGGTGG - Intronic
908889364 1:68826087-68826109 CAGACAAGAGAGAAAATGGGAGG + Intergenic
909286840 1:73830275-73830297 CAGAAAAAGGAGAGAGGGGAAGG + Intergenic
909656472 1:78039254-78039276 CAGAAAAATGAGAGACTAGGTGG + Intronic
909737690 1:78984906-78984928 GATAAAAAGGAAAAAGAGGGAGG + Intronic
909960342 1:81832648-81832670 AAGAAAATGAAGAAAGAGGGTGG + Intronic
910352246 1:86311370-86311392 CTGCAAAAGGTGAGAGTGGGAGG + Intergenic
910863479 1:91766024-91766046 CAAAAAAAGGAGAACTTGAGAGG - Intronic
910922173 1:92359889-92359911 CAGAGAAAGCAGAAAAGGGGAGG + Intronic
910929059 1:92424296-92424318 CATAAAAGAGTGAAAGTGGGGGG + Intergenic
911062075 1:93757333-93757355 CAGAGAAAAGAGAAAATGGGGGG - Intronic
911135875 1:94439541-94439563 CTGATACAGGAGAACGTGGGAGG + Intronic
911215756 1:95191399-95191421 CTGAAAAAGAACAAAGTTGGAGG - Intronic
911251551 1:95582101-95582123 TAGAAAAAGGAAAAGGTTGGGGG + Intergenic
911313388 1:96325725-96325747 CAGAAAAAGGAGAATGGATGGGG - Intergenic
911337320 1:96596370-96596392 CAGAAGTAGGAGAATGTGGCTGG - Intergenic
911354074 1:96794771-96794793 CAACAAAAGGAGAAATTGGGAGG + Intronic
911761334 1:101620842-101620864 CAGAAAAAGAAAAAAGAGAGTGG - Intergenic
911991741 1:104706897-104706919 CAGAAAAAGGAAAAGGGGAGGGG - Intergenic
912052584 1:105548662-105548684 GAGAAAAAGGAAAAAGTAGAAGG + Intergenic
912133549 1:106631600-106631622 CAGAAAAAGGTGAAAGGGCGAGG + Intergenic
912317760 1:108681749-108681771 GAGAAAAAGGAAAAAGTGGGAGG - Intergenic
912343104 1:108936933-108936955 CAGAAAGGGGAGAGAGTGAGTGG + Intronic
912486872 1:110035589-110035611 CTGCAAAAGGAGGCAGTGGGAGG - Intronic
912516279 1:110218474-110218496 GAGAAAAAGGAGATAACGGGTGG - Intronic
913225040 1:116691700-116691722 CAGAAAAGAGAGAATGTGGGTGG - Intergenic
913326046 1:117629833-117629855 TAGAAAAAGCAGGAAGGGGGAGG - Intergenic
914687067 1:149989746-149989768 AAGAAGAAGAAGAAGGTGGGGGG + Intronic
914801523 1:150966039-150966061 GGGAAAAAGGAGAAAGTGAGAGG - Exonic
914863632 1:151407114-151407136 CAGAAAAAGGAGAAAGTGGGAGG - Intronic
915328395 1:155093123-155093145 CAGAAGAGGGAGGAGGTGGGAGG + Intergenic
915354690 1:155249010-155249032 CTGAGAAAGGAGACAGTGGCCGG - Intronic
915542892 1:156579923-156579945 GAAAAAAAGGATAAAATGGGAGG + Intronic
915843977 1:159242789-159242811 CATAAAAAGGACAAAGCTGGAGG - Intergenic
915885366 1:159715958-159715980 GGGAAAAAGGGGGAAGTGGGAGG - Intergenic
915899446 1:159835793-159835815 TAGAAATAGGTGAAAGTGAGAGG + Exonic
916797247 1:168178800-168178822 AGGAAAAAGGAGAAAGTCAGAGG - Intergenic
916954099 1:169813674-169813696 CAGAAAAAGGAGAAGGTTAGCGG + Intronic
917065667 1:171090727-171090749 AAGGAAAAGTAGAAACTGGGTGG + Intergenic
917199004 1:172496098-172496120 CAGTAAAAGCAGAAACTGTGAGG - Intergenic
917427209 1:174927072-174927094 CAAAAAAAAAAAAAAGTGGGGGG + Intronic
917621089 1:176796797-176796819 AAGAAAGAGGAGAGAGAGGGAGG - Intronic
917622614 1:176812166-176812188 CAGAAAAAGGGTGGAGTGGGAGG - Intronic
917720928 1:177785898-177785920 CAAAAAAAGGAGATATTGAGAGG - Intergenic
917766346 1:178222326-178222348 CAGAAAATGTAGAAAATGGGTGG - Intronic
917918432 1:179728048-179728070 CAGAAAAAGGAGACAGTAGCTGG + Intergenic
918264249 1:182825828-182825850 CAGACAAAGCAGAAGATGGGTGG - Intronic
918690100 1:187468889-187468911 AAGAAAAAGAAAAAAATGGGAGG - Intergenic
918781532 1:188705766-188705788 CAGAATAAAGAGAAATCGGGTGG - Intergenic
918867145 1:189916696-189916718 CCAAAAAGGGAGAAGGTGGGAGG - Intergenic
918993221 1:191725600-191725622 GAGAAAAAAGAGAAAGAGAGAGG + Intergenic
919161742 1:193839439-193839461 GAGAAAAGAGAGAGAGTGGGAGG - Intergenic
919202715 1:194378088-194378110 AAGAAAAAGGAAAAAGAAGGAGG - Intergenic
919291519 1:195639509-195639531 AAGAAAAAGAAAAAAGAGGGAGG - Intergenic
919354018 1:196498428-196498450 CAGAATTAGAAGAAAGAGGGAGG - Intronic
919499934 1:198325337-198325359 CAAAAGAAGATGAAAGTGGGTGG + Intergenic
919832792 1:201553679-201553701 CAGAACACGGAGACAGTGGGTGG - Intergenic
919927690 1:202200825-202200847 CAGCAAAAGGACATGGTGGGGGG + Intronic
920025620 1:202992694-202992716 AAGAAAAAGTAGAAAGGGGTAGG - Intergenic
920450153 1:206054126-206054148 CAAAAAAAAAAAAAAGTGGGGGG + Intronic
920662797 1:207932098-207932120 AAGAAAAAGGATGAAGTGGAGGG - Intergenic
920706918 1:208258120-208258142 CAGTGAAAGGAGGCAGTGGGTGG - Intergenic
920776563 1:208943786-208943808 GAGAAAGAGGAGAAAGAGGGTGG + Intergenic
920820104 1:209372262-209372284 CAGGAAATGGAGGAAGTGGAAGG + Intergenic
921023053 1:211254192-211254214 TAGAAAAAGAACAAAGTTGGAGG - Intergenic
921036967 1:211389269-211389291 CAGAAAGAGGAGAAAGCAGGTGG - Intergenic
921359983 1:214322500-214322522 CACAAAAAGCAGAAAATGGGAGG - Intronic
921857660 1:220004420-220004442 CAGAAAAAGGATGAAATTGGAGG + Intronic
922020451 1:221699193-221699215 GGGAAACAGGAGAAAATGGGAGG - Intergenic
922273637 1:224056826-224056848 CGGAAAAAGGAGGAATAGGGAGG - Intergenic
922596237 1:226815635-226815657 CAGAGGAAGGAGAAAGAGGTGGG - Intergenic
922630686 1:227106992-227107014 TAAAAAAAGGACAAAGTTGGAGG - Intronic
923252539 1:232191049-232191071 AAGAAAAAGGCAAAAGTAGGGGG - Intergenic
923342101 1:233016378-233016400 CAAAAAGAGGAGAAAGGGGCAGG - Intronic
923566439 1:235079988-235080010 CAGAGGAAGGAGAAAATGGGAGG - Intergenic
923962623 1:239102498-239102520 CAGAAAAGCGAGAAAGGGGTCGG - Intergenic
924358359 1:243208725-243208747 TGGAAAAAAGTGAAAGTGGGAGG - Intronic
924370657 1:243346654-243346676 GAAGAAAAGAAGAAAGTGGGTGG - Intronic
924532621 1:244906125-244906147 CAGAAAAAGTAAATAGTGGGAGG - Intergenic
924558522 1:245137921-245137943 CACAAAAAGGATAACTTGGGGGG - Intergenic
924753368 1:246918878-246918900 CAGAAAAAAGAAAAAGTGATTGG + Intronic
1063216289 10:3928976-3928998 CAGGAGAAGGAGAAAGGGAGGGG + Intergenic
1063317657 10:5021921-5021943 CAGACAAACGAGGAAGTAGGAGG + Intronic
1063361311 10:5461543-5461565 CAGAAAAAGGAGAGATGGAGGGG + Intergenic
1063829733 10:9938552-9938574 TGGAAAAAGAAGAAAGTGAGAGG - Intergenic
1063885236 10:10570532-10570554 AAGAAAAAGGCTAAAATGGGTGG + Intergenic
1063905805 10:10779001-10779023 CAGAAAAAGAACAAAGATGGGGG + Intergenic
1064359037 10:14646775-14646797 AAAAAAAAGGAGAAAATGGAAGG - Intronic
1064697018 10:17976895-17976917 CAGAGAAAGGAGAAAGAGAAAGG - Intronic
1064971038 10:21067458-21067480 CATAAAAAAGAGAAAGCAGGAGG + Intronic
1065046970 10:21753818-21753840 GAGGAAAGGGAGAAAGTGGTTGG + Intergenic
1065159390 10:22903474-22903496 CAGAAAAAAAAAAAAGGGGGGGG - Intergenic
1065414125 10:25466076-25466098 CAGAAAAAGGAAAAGGGGAGGGG + Intronic
1065505533 10:26426707-26426729 CAGAAAAAGGATAAAAAGGTTGG + Intergenic
1065702978 10:28443587-28443609 CAGAAAGAGGAGAAACTGGAGGG + Intergenic
1066022133 10:31314387-31314409 CAGAGAAAGGAAAAAGAGAGAGG - Intergenic
1066025053 10:31348208-31348230 TAGAAAAAGGAGCAAGTTAGGGG + Intronic
1066181129 10:32961657-32961679 CTGAAAAAGGAGGAACTGGCAGG - Intronic
1066318986 10:34280766-34280788 CAGGAAAAGCAAAAAGTGAGGGG + Intronic
1066497545 10:35956788-35956810 CAGAAGAGGGAGAAAGGGAGGGG - Intergenic
1067040253 10:42948461-42948483 TTGAAAAAGGATAAAGTGGGAGG + Intergenic
1067360060 10:45571448-45571470 CAGCAAAGGGAGAAAGGGTGGGG - Intronic
1067360769 10:45575965-45575987 CAGCAAAGGGAGAAAGGGGTGGG - Intronic
1067368384 10:45658217-45658239 TATAAAAAGGAGAAATTTGGAGG + Intronic
1068129917 10:52884581-52884603 TTGAAAAAGGAGAAAGGGAGCGG - Intergenic
1068262457 10:54600249-54600271 GAGAAAGAGGAGAAAGTGGGAGG + Intronic
1068278801 10:54839557-54839579 CAGAAAAAGGAGAGAGAGAAGGG + Intronic
1068815650 10:61308215-61308237 CAGAAAAAGTAGAAATCAGGAGG - Intergenic
1069138195 10:64791454-64791476 CTGGAAAAGGAGAAAATGGCAGG + Intergenic
1069145020 10:64880812-64880834 AAGAAAAAGCAGAATGTGGAAGG + Intergenic
1069917067 10:71793707-71793729 AAGAGAAAGGAGAAAGAAGGGGG - Intronic
1070037182 10:72737814-72737836 CAGAAAAAGGGGAAATAGGCTGG - Intronic
1070223513 10:74475809-74475831 GAGAAAAAGGAGGGAGAGGGAGG + Intronic
1070299587 10:75193522-75193544 CAAAAAAAGGAGAATGTGTTTGG - Intergenic
1070418814 10:76215702-76215724 TTGAAAAAAGAGAAATTGGGAGG + Intronic
1070637092 10:78137709-78137731 GAGAAAGAGGAGAAAGAGGAAGG - Intergenic
1070835865 10:79446480-79446502 CAGAAATAGGAGAAGGGGGGGGG - Intergenic
1070896443 10:79986434-79986456 CACAAAAACTAGACAGTGGGAGG + Intergenic
1070991644 10:80738705-80738727 GAGAAAAAGGAAAAAGGGGCGGG - Intergenic
1071150635 10:82630195-82630217 CGGAATAAGAAGAAAATGGGAGG + Intronic
1071161061 10:82745843-82745865 CAGAAAAAGTAGAAAATATGTGG - Intronic
1071231985 10:83598550-83598572 CAGAAAAATGAGAATGTGTGTGG - Intergenic
1071324688 10:84501422-84501444 GAGGAGAAGGAGAAAGGGGGAGG - Intronic
1071337101 10:84609472-84609494 CAGAGAGAGGAGGAAATGGGAGG - Intergenic
1071341445 10:84652376-84652398 CAGAAGAAGCAGAGTGTGGGAGG - Intergenic
1071725690 10:88196208-88196230 AAAAAGAAGGGGAAAGTGGGAGG + Intergenic
1072108566 10:92296468-92296490 GAGAAAAATGAGAATGTCGGTGG - Intronic
1072632982 10:97159515-97159537 CAGAAAAATGAGAAAGTCTTGGG - Intronic
1072696378 10:97606682-97606704 TAAAAAAAGAACAAAGTGGGAGG - Intronic
1073225944 10:101919128-101919150 CAGAACAAGCAAAAAGGGGGAGG + Intronic
1073250821 10:102119578-102119600 CAGGAAAAGTTGAAGGTGGGGGG + Intronic
1073462274 10:103672775-103672797 CACAAAGAGGAGTAAGTGGTAGG + Intronic
1073509080 10:104031844-104031866 CAGAAAACGGAGGATGGGGGTGG - Exonic
1073554587 10:104436550-104436572 CAGGAACAGGAGAGAGTGGGAGG + Intronic
1074180917 10:111062078-111062100 CACAAAAAGGAGAAAGAGACAGG + Intergenic
1074183994 10:111085711-111085733 CAGAAGAAAGAGTAAGGGGGCGG + Intergenic
1074256770 10:111810872-111810894 CAAGAGAAGGAAAAAGTGGGTGG + Intergenic
1074486154 10:113883102-113883124 TTGAAAAAGAAGAAAGTGGGAGG - Intronic
1074498905 10:114004618-114004640 CAGAAAAAGGACACAAAGGGAGG - Intergenic
1074702722 10:116106628-116106650 CAGAACCAAGAGAAAGTGGAGGG - Intronic
1075563994 10:123490394-123490416 AAGAAAATGAAGAAACTGGGAGG - Intergenic
1075993884 10:126860857-126860879 AGGAAAAAGGGGACAGTGGGAGG - Intergenic
1076165655 10:128280514-128280536 CAGAGAAGTGAGAAGGTGGGAGG - Intergenic
1076238316 10:128883049-128883071 CAGATAAATGAGAAAGGGCGGGG - Intergenic
1076492904 10:130875660-130875682 CAGATAAGGAAGAAAGGGGGTGG - Intergenic
1076659997 10:132049330-132049352 AAGAAAGAGGAGGAAGTGGAAGG - Intergenic
1076757894 10:132583676-132583698 CAAATAAAGGAGAAAGTGTGGGG - Intronic
1076773029 10:132677394-132677416 CAGAGGAAGGAGAAAGTGCCGGG + Intronic
1076934989 10:133561932-133561954 CAGCAAAAGGAAAAAAGGGGGGG + Intronic
1077114813 11:879231-879253 AAGAAAAAGAATAAGGTGGGTGG - Intronic
1077719850 11:4617046-4617068 CTGAAACAGGAGGAAGTGGGGGG + Intergenic
1077730588 11:4725080-4725102 CTGAAGAAGGAGCAAGGGGGAGG - Intronic
1077865718 11:6219617-6219639 CAGGAAAAGGAAAAAGTAGGTGG + Intronic
1078249721 11:9607141-9607163 CAGTTAAAGCAGAAAGTGGAGGG + Intergenic
1078255626 11:9656101-9656123 AAGAAAAAGGAAAAGGTGGAGGG + Intergenic
1078377190 11:10806245-10806267 CAGTGAAAGCAGAAACTGGGTGG - Intronic
1078423271 11:11229439-11229461 CAAGAATGGGAGAAAGTGGGAGG + Intergenic
1078495755 11:11814748-11814770 CAGAAAGGGGAAAATGTGGGAGG + Intergenic
1078811030 11:14763449-14763471 CAGAGAAATGAGATAGTGGCCGG + Intronic
1079085803 11:17444113-17444135 AGGATAAAGGAGTAAGTGGGAGG + Intronic
1079271248 11:18987912-18987934 CATGAAAAGGAGAAACGGGGCGG + Intergenic
1079297573 11:19246881-19246903 CAGAAGAGGGAGAAAGAGAGAGG - Intergenic
1079844092 11:25442435-25442457 CAGAAAAAGGAGATAGTAGAGGG + Intergenic
1079873679 11:25831243-25831265 CAGAAAAATGGGAAAGTTTGGGG - Intergenic
1080379011 11:31748113-31748135 CAGAAAAAGGAAACAATTGGAGG - Intronic
1080413657 11:32049817-32049839 CCAGAAAATGAGAAAGTGGGTGG - Intronic
1080905951 11:36544857-36544879 CAGAAAAGAGAGAACGAGGGGGG - Intronic
1081022885 11:37969314-37969336 CAGCAAAAGGAGATAGGGGTAGG + Intergenic
1081357173 11:42125227-42125249 CAGCAAAAGGAGATAGGGGTGGG - Intergenic
1081390936 11:42527846-42527868 CAGAAAAAGGAGAAAATTAGGGG + Intergenic
1081486293 11:43532351-43532373 CAGAAAGACGAGAAAGCAGGAGG - Intergenic
1081778759 11:45695307-45695329 GAGAAAAAGGAAAAAGGGGTCGG + Intergenic
1081931654 11:46875685-46875707 CAGAGGAAGGAGAGGGTGGGGGG + Intronic
1083179835 11:60978204-60978226 CAGAGAAAGGACAAAGGGGGTGG + Intronic
1083655694 11:64228366-64228388 TTGAAAAAGGAGTAAGTGGCCGG + Intronic
1083885450 11:65571367-65571389 TAAAAAGAGGAGAAAGTGGGTGG - Intronic
1084493925 11:69492918-69492940 CTGAAAAAAGAGAAAGTGGCTGG + Intergenic
1085079354 11:73621246-73621268 CAAAAAAAAAAAAAAGTGGGGGG + Intergenic
1085136548 11:74094590-74094612 CAGAAGATGGAGACAGTAGGAGG + Intronic
1085688765 11:78648970-78648992 CAGAAAGAGGAGAAAAAAGGAGG + Intergenic
1085709467 11:78816008-78816030 CAGAAAAAGTGGGAAGTTGGGGG - Intronic
1086274124 11:85104905-85104927 GAGAGAAAGGAGAAAGAGGTGGG + Intronic
1086433913 11:86763077-86763099 CAGAAAAAAAAAAAAGGGGGGGG - Intergenic
1086505663 11:87501385-87501407 CAAAAAGAGGACAAGGTGGGAGG + Intergenic
1086572227 11:88298424-88298446 AAGAAAAAAGAAATAGTGGGAGG - Intronic
1086652351 11:89308234-89308256 CAGCAAAGGGATAAAGTGTGTGG + Intergenic
1086775143 11:90821365-90821387 CTGAAAAAGGAGAAAGAGATGGG + Intergenic
1087074053 11:94112106-94112128 CAGAAAAAGGAGAATGGGCATGG + Exonic
1087149856 11:94849566-94849588 CAGGAAAAGGGGAAATTGTGGGG + Intronic
1087391768 11:97544104-97544126 AAGAAGAAGGACAAAGTTGGAGG + Intergenic
1087470505 11:98568212-98568234 CAGAAATAGGAGACAGCTGGTGG + Intergenic
1087779721 11:102289512-102289534 CAGAAAAAGAAGAAAGTTGTAGG + Intergenic
1087940724 11:104093753-104093775 AAGGAGAAGGAGAAGGTGGGTGG - Intronic
1088011157 11:105002420-105002442 AAGAAAAAGGAGAAGGAAGGGGG - Intronic
1088181655 11:107120180-107120202 CAGAAAAAGGAGAGAGAGTAAGG + Intergenic
1088340363 11:108758629-108758651 CAGAAAGAGGCCAATGTGGGTGG - Intronic
1088553954 11:111042824-111042846 TAGAAAAAGGAGGAAGAGGCTGG + Intergenic
1089133166 11:116228249-116228271 CAGGAAAAGGAGATAGTGTTGGG - Intergenic
1089582034 11:119487306-119487328 CAGGAAGAGGAGTCAGTGGGAGG + Intergenic
1090342255 11:126034421-126034443 CAGAAAAAGGCAACAGTGAGGGG + Intronic
1090395646 11:126416394-126416416 CAGAAAAAGGCGACAGAGGCTGG - Intronic
1090611009 11:128470767-128470789 TTGAAAAAGTAGAAAGTTGGAGG + Intronic
1090776983 11:129974486-129974508 CAGAATAAGTAGAAGGTGAGGGG + Intronic
1091215056 11:133895971-133895993 GAGCAAAAGCAGAAAGGGGGTGG - Intergenic
1091337143 11:134780705-134780727 GAGAAGAAGGAGAAAGAGGAGGG - Intergenic
1091438529 12:494497-494519 TAGAAAATGGAGGAAGAGGGAGG - Intronic
1091995706 12:4992097-4992119 CAGAAAAAAAAAAAAGAGGGGGG - Intergenic
1092329971 12:7576420-7576442 AAGAAGAAGGACAAAGTTGGAGG + Intergenic
1092388842 12:8057196-8057218 CAGAAAAATGAGAAGGTGGTAGG + Intergenic
1092846905 12:12592037-12592059 CAGGAGAAGTAGAAAGTGGCTGG - Intergenic
1093563174 12:20567614-20567636 GAAAAAAGGGAGGAAGTGGGGGG - Intronic
1093836733 12:23840534-23840556 AAGAAAAAGTAGAAAGTTGGAGG + Intronic
1094050505 12:26215431-26215453 CAGAAAAGGCAGAAATGGGGTGG + Intronic
1094181185 12:27594094-27594116 AAGAAAAAAGAAAAAGTAGGTGG + Intronic
1094209723 12:27876554-27876576 CAGAAAAAGAATAAAGTTAGAGG - Intergenic
1094242354 12:28242892-28242914 CAGAAGTAGGAGCAAGAGGGGGG - Intronic
1094477273 12:30850881-30850903 CATTAAAAGGATAAGGTGGGAGG + Intergenic
1094529456 12:31260256-31260278 AAGAAAAAGAAGAAAATCGGGGG + Intergenic
1095085939 12:38057398-38057420 AAGAAAAAGAAAAAGGTGGGGGG + Intergenic
1095531428 12:43190748-43190770 AAGAAAGAGGAGAAAGATGGAGG - Intergenic
1095655008 12:44658903-44658925 AAGAAAAAGAACAAAGTTGGAGG + Intronic
1095970027 12:47895270-47895292 AAAAAAAAGGAGAAAGTTTGGGG - Intronic
1096092835 12:48914799-48914821 AAAAAAAAGAAGAAAGTGGGTGG - Intronic
1096221314 12:49829757-49829779 CAAAAAAATGAGAAAGCTGGTGG - Intergenic
1096343368 12:50823034-50823056 AAGAAAAAAAAAAAAGTGGGAGG - Intergenic
1096409759 12:51368701-51368723 TTGAAGAAGGAAAAAGTGGGCGG - Intronic
1096429302 12:51530149-51530171 CAGCAAAGGGACAAAGTAGGTGG - Intergenic
1096512435 12:52138483-52138505 CAGACAAGATAGAAAGTGGGAGG - Intergenic
1096527947 12:52224065-52224087 GAGAAAAAGGACAAAGTGCTAGG + Intergenic
1096659138 12:53112754-53112776 AAGAAAAAAAAGAAAATGGGAGG - Intronic
1096678690 12:53240830-53240852 CATAAAAATGAGGAAGTGAGGGG - Intergenic
1096735596 12:53651349-53651371 AAGAAAAAGAACAAAGTTGGAGG - Intronic
1096766980 12:53899321-53899343 AGGAAAAAGGAGAAGGAGGGAGG + Intergenic
1097533569 12:60837093-60837115 AAGAACAAAGAGAAAGTTGGAGG - Intergenic
1097650656 12:62293255-62293277 TAGAAAAAGAAGGAAGTGAGAGG - Intronic
1097691551 12:62738961-62738983 CATAGAAACGGGAAAGTGGGGGG + Intronic
1097698478 12:62797464-62797486 CAGGAAAATTAGAGAGTGGGTGG + Intronic
1097729169 12:63108031-63108053 CGGAAGAAGGAGAAAGAGGAAGG - Intergenic
1098379371 12:69853027-69853049 CAGAAAAAGGGGGAAATGTGGGG - Intronic
1098528711 12:71516110-71516132 GAGGAAAAGGAGAATGAGGGAGG + Intronic
1098638805 12:72816065-72816087 CAGAAAGATGGCAAAGTGGGGGG - Intergenic
1098644013 12:72875473-72875495 CTGAAAGAGAACAAAGTGGGAGG - Intergenic
1098907904 12:76180455-76180477 GAAGAAAAGGATAAAGTGGGGGG - Intergenic
1099212416 12:79808248-79808270 CAGAGTAAGGGGAAAGTGGGAGG - Intronic
1099335567 12:81352339-81352361 CAGGAAAAGGGAAAGGTGGGTGG + Intronic
1099362619 12:81724473-81724495 CAGAAAGGTGAGAGAGTGGGAGG - Intronic
1099600033 12:84723234-84723256 TGGAAGAATGAGAAAGTGGGAGG - Intergenic
1099899486 12:88690490-88690512 CAGAAGAAGGAGAGAATGAGTGG + Intergenic
1100025822 12:90126686-90126708 AGGAAAAAGAACAAAGTGGGAGG + Intergenic
1100160262 12:91851498-91851520 GAAAAAAAGGACAAAGTTGGTGG + Intergenic
1100490341 12:95072840-95072862 GAGAGAAAAGTGAAAGTGGGGGG + Intronic
1100688906 12:97017752-97017774 ATGAAACAGGAAAAAGTGGGGGG + Intergenic
1100759867 12:97795539-97795561 CAAAAAATGGACAAAATGGGTGG + Intergenic
1101324845 12:103706510-103706532 AAGAAAAATGAGAAAGGAGGAGG - Intronic
1101359685 12:104014582-104014604 CAGGGAGAGGAGAAAGAGGGTGG + Intronic
1101409909 12:104458814-104458836 CAGTGAAAGGAGAAGGCGGGAGG - Intronic
1101645387 12:106626703-106626725 AAGAAATTGGAGAAACTGGGAGG + Intronic
1102206898 12:111096986-111097008 AAGAAAAAGAAGAAGTTGGGAGG + Intronic
1102320187 12:111926575-111926597 CAGAAGAAGGATCAAGAGGGAGG - Intergenic
1102500308 12:113347562-113347584 TATAAAAAGGAGAAAGGGGCTGG + Intronic
1102827216 12:115958932-115958954 CAAAAAAAGGGGAAATGGGGAGG - Exonic
1103032945 12:117632520-117632542 TAGAAAAAGGAGTAGGTGGCAGG - Intronic
1103044826 12:117727395-117727417 CAGAAAAAGAAGAAAGAAGAAGG + Intronic
1103552238 12:121746183-121746205 CAAAAAAAAAAAAAAGTGGGGGG - Intronic
1103793819 12:123490037-123490059 CAGGAGAAGGAGAAAGGGGATGG - Intronic
1103884624 12:124191338-124191360 CACAGAAAGGAGTGAGTGGGGGG - Intronic
1103894581 12:124264588-124264610 AAAAAAAAGGAGGAAGTGGATGG - Intronic
1103896613 12:124277664-124277686 GAGAAAGAGGAGGAAGGGGGCGG - Intronic
1103974227 12:124691728-124691750 CTTTAAAAGGTGAAAGTGGGTGG - Intergenic
1104232486 12:126898637-126898659 AAGAAAGAGGAGAAAAAGGGAGG + Intergenic
1104280427 12:127371818-127371840 AGGAAAAAAGAGAAAGTAGGGGG - Intergenic
1104379110 12:128291517-128291539 CAGAAATAGGTGAAAGGGGGAGG + Intronic
1104451875 12:128875876-128875898 CAGAGAAAGGAGAAGATGAGGGG - Intronic
1104758878 12:131285426-131285448 GAGAGAGAGGAGAAAGTTGGGGG - Intergenic
1105281415 13:18964871-18964893 CACTTAGAGGAGAAAGTGGGGGG - Intergenic
1105352915 13:19632106-19632128 CAGTTAAAGGAAAAAGAGGGAGG - Intergenic
1105806675 13:23955495-23955517 CAGGAGAGGGAAAAAGTGGGTGG + Intergenic
1105985858 13:25566522-25566544 ATGGAAAAGGAGAAAGTGGCAGG + Intronic
1105993206 13:25643696-25643718 AAGAAAAAGAACACAGTGGGAGG - Intronic
1106048656 13:26169288-26169310 CAAAAAAAGGAGAGAGTGTATGG + Intronic
1106494116 13:30259341-30259363 AAGAAAAAAAAAAAAGTGGGGGG + Intronic
1106987209 13:35369324-35369346 CAGAAAAAGGACAAAGCTGCAGG - Intronic
1107264290 13:38533872-38533894 CAGAAGAAGAAGAAAGGGGGAGG + Intergenic
1107296477 13:38914480-38914502 CAAACAAGGGAGAAAGGGGGTGG - Intergenic
1108031194 13:46231497-46231519 AAGAAAAAAGAAAAAGTGTGTGG - Intronic
1108038727 13:46320073-46320095 AAGAAAAAGGAGGAAGAGGCCGG + Intergenic
1108147184 13:47490903-47490925 CAGATAAAGGAGGAATTAGGAGG - Intergenic
1108266800 13:48718610-48718632 AAGCAAAAGGACAAAGTTGGAGG - Intergenic
1108304029 13:49113061-49113083 GAGAAATAGGAGAAAGGGGGAGG - Intronic
1108453786 13:50593275-50593297 CTGAAAAAGAAGAATGTTGGGGG - Intronic
1108879213 13:55088580-55088602 CAGAGAAAGGAGAAAGGGTTTGG - Intergenic
1108910515 13:55545406-55545428 GAGAAAAAGGAGAAAATGGTAGG + Intergenic
1108977553 13:56467575-56467597 CTGAAAAAAGAGGATGTGGGAGG + Intergenic
1109039132 13:57309079-57309101 AAGAAAAAGGAGAAAGAAGTGGG - Intergenic
1109082525 13:57923344-57923366 CAAAAAAGGGAGCAAGTTGGGGG + Intergenic
1109282409 13:60372260-60372282 CAGAGACAGGAGAAAGCGGTAGG - Intergenic
1109520478 13:63503784-63503806 AAAAAAAAGAAAAAAGTGGGGGG + Intergenic
1109694469 13:65935079-65935101 AAGAGAGAGAAGAAAGTGGGAGG + Intergenic
1109842645 13:67940101-67940123 CAGAAAAAGGAGAAAGACCATGG + Intergenic
1109977643 13:69860370-69860392 CAGAAAAAAGAGAATGTTAGTGG + Intronic
1110063111 13:71066723-71066745 AAGGAAAAGGAGAAAGAGAGAGG - Intergenic
1110501652 13:76235200-76235222 AACAAAAAGAAGAAAGTTGGAGG - Intergenic
1110870217 13:80443533-80443555 GAGAAAAAGAAGAAAGGAGGAGG - Intergenic
1111193822 13:84845329-84845351 CAGGAAAAAAAAAAAGTGGGGGG + Intergenic
1111775538 13:92656708-92656730 CAAAAACAGGCCAAAGTGGGAGG + Intronic
1111782767 13:92750471-92750493 CAGAAAAAGGAGAAAATGAGAGG + Intronic
1111800977 13:92980377-92980399 CCGAAAAAGGAAAAAGTAAGTGG + Intergenic
1112894874 13:104286513-104286535 CACAAAAAGGAGAGTGTGGAGGG - Intergenic
1113281019 13:108787894-108787916 CAGATGATGGAGATAGTGGGAGG - Intronic
1113596948 13:111540164-111540186 CAGAGAGAGGAGCAAATGGGAGG - Intergenic
1114274862 14:21133811-21133833 AGGAAAAAGGAGAAAGTTGGGGG + Intergenic
1114525388 14:23364771-23364793 AAGAAAAAGGAGAATGGGGAGGG + Intronic
1114658021 14:24327706-24327728 CAGAGACAGGAGGAAGTGGGGGG + Intronic
1115011608 14:28554538-28554560 AAGACAAAGTAGAAAATGGGTGG - Intergenic
1115027780 14:28764415-28764437 CTGTAAGAGGAGAAATTGGGAGG + Intergenic
1116158889 14:41240990-41241012 TAGAAACAGGAGAAAGTCTGTGG - Intergenic
1116214054 14:41987810-41987832 CAGAAATAGAAGAGAGTGGTGGG - Intergenic
1116504167 14:45657971-45657993 AAGGAAAAGGACAAAGTTGGAGG - Intergenic
1116654118 14:47629433-47629455 CAAAAAAAGGAAATAGTGGAGGG + Intronic
1116678488 14:47936630-47936652 GAGAAAAAGGAGAAAATATGAGG + Intergenic
1117822766 14:59668156-59668178 CAGAAAAAGAACAAAGCTGGAGG + Intronic
1118632652 14:67720319-67720341 AAGATAAATGAGAAACTGGGGGG - Intronic
1118808947 14:69260147-69260169 CAGAAAAAGGAGAGAGGTGGGGG - Exonic
1119104298 14:71909603-71909625 GAGAGAAAGGAGAGAGAGGGGGG + Intergenic
1119335851 14:73833054-73833076 AAGAAAAGGGAGAAAGAAGGAGG + Intergenic
1119586717 14:75842690-75842712 TGGAAAAAGTAGAAAATGGGTGG + Intronic
1119790655 14:77346912-77346934 CACAAAAAGGAGTATGTGAGGGG - Intronic
1120222139 14:81746724-81746746 AAGGAAAAGCAGAAAGGGGGTGG - Intergenic
1120462600 14:84816048-84816070 CACAAAAAGGGGAATGTGGGTGG - Intergenic
1120556526 14:85934546-85934568 CAGAAAAAGGAAAAGGGGAGGGG + Intergenic
1120625936 14:86826556-86826578 CAGAAGAAAGAGAAAGAGGAGGG + Intergenic
1120778627 14:88464987-88465009 CAGAAACAGGAGGAGGAGGGAGG - Intronic
1120819355 14:88897718-88897740 CAGAAAATGGATTAGGTGGGGGG - Intergenic
1120868959 14:89320134-89320156 AAGAAAAAGGGGAAAGTCAGAGG + Intronic
1120999992 14:90444663-90444685 CACAGAAAGGAGAAAGGAGGAGG - Intergenic
1121204125 14:92147383-92147405 TAGAAAAAGGAGTAAGTTGGAGG + Intronic
1121506146 14:94479077-94479099 CATGGGAAGGAGAAAGTGGGAGG + Intronic
1122131890 14:99609059-99609081 CTGAAGCAGGAGGAAGTGGGTGG - Intergenic
1122146794 14:99694795-99694817 AAGAAAGAGGAGAAATTGGCTGG - Intronic
1122189862 14:100032746-100032768 CAGAAAAAAGAGAAATTTTGTGG - Intronic
1122633183 14:103117311-103117333 AAGAAAAAGAAAAAAGTGGCCGG - Intergenic
1123892733 15:24797657-24797679 CACAAAAGGCAGAAAATGGGTGG - Intergenic
1124029762 15:25999784-25999806 CAAAAAAAGGAGAGAGAGAGAGG - Intergenic
1124791922 15:32735780-32735802 AAAAAAAAGAAGAATGTGGGAGG + Exonic
1124969308 15:34469380-34469402 CAAAAACAGGCCAAAGTGGGAGG + Intergenic
1125301788 15:38262520-38262542 CAGAAAGAAGAAAAAGTTGGAGG + Intronic
1125413642 15:39430276-39430298 GAGGAAATGGAGAAAATGGGGGG + Intergenic
1125880202 15:43186746-43186768 GACAAAAATGAGAAAGTGGGTGG - Intronic
1126330827 15:47529295-47529317 AAGAAAGTTGAGAAAGTGGGAGG + Intronic
1126843582 15:52739748-52739770 CAGAAAAGTGGGAAAGTGGTCGG - Intergenic
1126859460 15:52870105-52870127 CAGAAAAGGGTGTAAGTGTGAGG + Intergenic
1127053240 15:55106414-55106436 CAGAAGAAAGAGAGAGTGAGGGG - Intergenic
1128885052 15:71279131-71279153 CAGGAAAGGGAGAAAATGGAGGG + Intronic
1128896415 15:71377599-71377621 GAGGATAAGGAGAAAGAGGGCGG + Intronic
1129174086 15:73827406-73827428 GAGATAAAGGAGATGGTGGGAGG - Intergenic
1129259157 15:74354417-74354439 CAGCAAAAGGAGATAGGGGTGGG - Intronic
1129543818 15:76374094-76374116 CAGAAAAATTAGAAAGCTGGGGG + Intronic
1130286695 15:82561339-82561361 CAGCTAAAGCAGAAAATGGGGGG + Intronic
1130505689 15:84539085-84539107 CAAAAAAAAGGGAGAGTGGGAGG - Intergenic
1130571433 15:85048483-85048505 CAGAAAAAGCATAAACTGGAGGG - Intronic
1130795137 15:87199860-87199882 AAGAAAAAGAAGAAAGAGGAAGG + Intergenic
1130889473 15:88121120-88121142 TAGAAAAAGAAGCAAGTGTGTGG - Intronic
1131006415 15:88982353-88982375 AAAAAAAAGAACAAAGTGGGAGG + Intergenic
1131424628 15:92335422-92335444 CAGAAAAAGAAGAGAGAGGGAGG - Intergenic
1131816952 15:96231923-96231945 TAGGAGGAGGAGAAAGTGGGGGG + Intergenic
1131821174 15:96275524-96275546 CAGAAAAAGAAGGAAGCGTGTGG - Intergenic
1131827307 15:96331753-96331775 CAGAACGTGGAGAAAGAGGGAGG - Exonic
1132166109 15:99592680-99592702 GAGAAGCAGGAGAGAGTGGGTGG + Intronic
1132262843 15:100441434-100441456 CAGAAAAGCGAGAAAGGGGTTGG - Intronic
1133191970 16:4140488-4140510 CAGAAGCAGGAGAAAGAGAGAGG - Intergenic
1133385681 16:5368415-5368437 AAGAAAAACAAGGAAGTGGGAGG - Intergenic
1133460684 16:5983983-5984005 GAGAAGAAGAAGAATGTGGGAGG - Intergenic
1133580514 16:7140205-7140227 CAGAAAATGGACAAATTGGGAGG - Intronic
1133823242 16:9255503-9255525 AAGAACAAAGAGAAAGTTGGAGG + Intergenic
1134076182 16:11293072-11293094 CAGAAAAACGGGAATGTGGCTGG + Intronic
1134246395 16:12543410-12543432 CTGAAAGGAGAGAAAGTGGGTGG + Intronic
1134395269 16:13856642-13856664 AAGAAAGAGAAGAGAGTGGGTGG + Intergenic
1134425621 16:14141107-14141129 CCGGAGATGGAGAAAGTGGGAGG - Intronic
1134772957 16:16826510-16826532 AATTAAAAGGAGAAAGAGGGTGG - Intergenic
1135010550 16:18873866-18873888 AGAAATAAGGAGAAAGTGGGTGG - Intronic
1135177343 16:20242342-20242364 AGGAAAAAGGAGAAAGGTGGAGG + Intergenic
1135297996 16:21300193-21300215 CAGAGAATTGAGAAAGTGAGAGG - Intronic
1135317424 16:21461451-21461473 AGAAATAAGGAGAAAGTGGGTGG - Intergenic
1135370322 16:21893263-21893285 AGAAATAAGGAGAAAGTGGGTGG - Intergenic
1135375647 16:21944690-21944712 CAGAGAATTGAGAAAGTGAGAGG - Intergenic
1135441467 16:22477438-22477460 AGAAATAAGGAGAAAGTGGGTGG + Intergenic
1135494486 16:22939679-22939701 CAGAAGAGTGAGAATGTGGGAGG + Intergenic
1135494597 16:22940291-22940313 CAGAAGAGTGAGAATGTGGGAGG + Intergenic
1135521429 16:23181686-23181708 GAGAGAAAGAAGAAAGAGGGAGG + Intergenic
1135693873 16:24569498-24569520 CAGAAAAAGAAGAAAAGGGGAGG + Exonic
1135963420 16:27016402-27016424 AAGAAGAAGGAGGAAGTGGGGGG - Intergenic
1136240078 16:28938157-28938179 AAGAAAAAGAAGAAACTGGAGGG - Intronic
1136314213 16:29441191-29441213 AGAAATAAGGAGAAAGTGGGTGG - Intergenic
1136327652 16:29542956-29542978 AGAAATAAGGAGAAAGTGGGTGG - Intergenic
1136442340 16:30282956-30282978 AGAAATAAGGAGAAAGTGGGTGG - Intergenic
1136574398 16:31114916-31114938 AAGAAAAAGAAAAAAGAGGGAGG - Intergenic
1137485579 16:48887817-48887839 CAGAAAAAGGAGGTGGTTGGGGG + Intergenic
1137518412 16:49170851-49170873 CAGAGCAAGGAGAAAGTTGAAGG - Intergenic
1137769847 16:51007344-51007366 GAGAAGAGGTAGAAAGTGGGTGG - Intergenic
1137820391 16:51439125-51439147 GAGAAAAAGAAAAAAGAGGGAGG + Intergenic
1137935113 16:52627517-52627539 CAGAAAAATGAAAAATTAGGGGG + Intergenic
1138380703 16:56600390-56600412 CAGGAAAAGAACAAAGTTGGAGG - Intergenic
1138402477 16:56758070-56758092 CAGAAAAAAAAAAAAGTTGGGGG + Intronic
1139264306 16:65624693-65624715 GAGACAGAGGAGAAAGAGGGTGG - Intergenic
1139725129 16:68891581-68891603 AAGAGAAAGAAAAAAGTGGGTGG - Intronic
1139840348 16:69873525-69873547 CAGCACAAGGATACAGTGGGTGG - Intronic
1139889145 16:70236676-70236698 AGAAATAAGGAGAAAGTGGGTGG - Intergenic
1140345521 16:74209328-74209350 AAGAAAATGGAGGAAGAGGGAGG + Intergenic
1140724446 16:77799368-77799390 GAGAAAGAGGAGAGAGAGGGAGG - Intronic
1140872784 16:79122272-79122294 AAGAAAAGGGAGGAGGTGGGAGG + Intronic
1140973203 16:80033349-80033371 GAGAAAAAGGGGAAAGAGGAAGG + Intergenic
1141042661 16:80685152-80685174 CAGAAAACAGAGAGAGAGGGAGG + Intronic
1141220585 16:82065733-82065755 CAGATGAAGGAGAAGGTGGCTGG + Intronic
1141304423 16:82848069-82848091 AAGAACAAAGAGAAAGTTGGAGG + Intronic
1142131977 16:88435290-88435312 CAGAAAAAAGAGAAGGCCGGAGG + Exonic
1142150171 16:88509200-88509222 AAGAAAAAGGAGTGAGGGGGAGG - Intronic
1143165418 17:4895048-4895070 CAGAAGGAGGAGGAGGTGGGAGG - Intronic
1143254629 17:5546520-5546542 CAGACAAAGGAGAAATTGGCGGG - Intronic
1143282110 17:5762675-5762697 CACAATGAGGAGAGAGTGGGAGG - Intergenic
1143284772 17:5780988-5781010 GAGAAAAAGGAGAGACGGGGAGG + Intronic
1143377253 17:6474096-6474118 CAGGAGAAGGAGAGGGTGGGAGG + Intronic
1143381377 17:6498369-6498391 CAGGAAGAGGGGAAAGTGGTCGG + Intronic
1143658861 17:8312679-8312701 CTGAAAACGGAGAAGATGGGTGG - Intronic
1143711492 17:8739104-8739126 AAGAAAAAAGAGAAAGAGAGGGG + Intronic
1143887611 17:10076399-10076421 AAGAAAAAAGAAAAAGAGGGAGG + Intronic
1143934975 17:10474203-10474225 CAGAACAATGAAAAAGTGGAGGG + Intergenic
1143998677 17:11032316-11032338 GAGAGAAAGGAGAAACGGGGTGG - Intergenic
1144038888 17:11391053-11391075 CAGGAAAAGAAGAAAGTGACGGG + Intronic
1144126150 17:12204815-12204837 AAGAAAAAGAAAAAAATGGGAGG - Intergenic
1144315974 17:14061966-14061988 CAGAAAAAGGAAAAAGCAGGAGG - Intergenic
1144378433 17:14668705-14668727 GAGATTAAGGAGAAAGTGGGTGG - Intergenic
1144425186 17:15134720-15134742 AAGCAAAAGGAAAAAGTGTGGGG + Intergenic
1144445626 17:15325187-15325209 TGGAAAAAGAAGAAAGTTGGAGG - Intronic
1144755255 17:17676302-17676324 CTGGAATAGGAGAAAGTGGAGGG - Intergenic
1144876154 17:18398533-18398555 CAGATAAAGGAGAAACAAGGTGG - Intergenic
1145156074 17:20545887-20545909 CAGATAAAGGAGAAACAAGGTGG + Intergenic
1145262420 17:21362432-21362454 CAGATAAAGGAGAAGATGGATGG + Intergenic
1145887174 17:28390403-28390425 AAGAAAAAGAAAAAAATGGGGGG + Intronic
1146020139 17:29270919-29270941 CAAAAAAAGGGGAAAGTGCAGGG - Intronic
1146030447 17:29361689-29361711 CAGAAAAGGGGAAATGTGGGGGG - Intergenic
1146105294 17:30030095-30030117 CAGAAAAAGGTGAAAATCGATGG - Intronic
1146171465 17:30637592-30637614 CAGTAAAAGGAAAAAATTGGCGG + Intergenic
1146344926 17:32053615-32053637 CAGTAAAAGGAAAAAATTGGCGG + Intergenic
1146493867 17:33303204-33303226 AAGAGAAAAGACAAAGTGGGTGG + Intronic
1147133637 17:38422935-38422957 CAGAGAAAGGAGGGAGAGGGTGG - Intergenic
1147336782 17:39730822-39730844 CAAAAGAAAGAGAAAGTGGTGGG + Intergenic
1147957192 17:44142452-44142474 AAAAAAAAGTAGAAAGTGTGGGG - Intronic
1148206432 17:45783189-45783211 CTGAAAAGGGAGAAACTGGGAGG - Intergenic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1149059299 17:52403545-52403567 GTGAACAAGGAGAAAGTGTGGGG + Intergenic
1149399525 17:56280783-56280805 CAAAAAAAGAACAAAGTTGGAGG + Intronic
1150153927 17:62834767-62834789 GAGAAAAAGGAAAAAGTTTGGGG - Intergenic
1151617311 17:75221945-75221967 AAGAAATAGAAGAATGTGGGAGG + Intronic
1151808731 17:76423150-76423172 CAGGAAAAGGAGGAAGAGGTAGG + Intronic
1152138356 17:78520929-78520951 ACAAAAAAGGATAAAGTGGGAGG + Intronic
1152547954 17:81012232-81012254 GAGAAAAAGGAAAAAGGGGTGGG + Intergenic
1153139104 18:1952220-1952242 CAGATAAAAGAGAGAGAGGGAGG - Intergenic
1153432650 18:5035707-5035729 TAGAAAAAGAACAAAGTTGGAGG - Intergenic
1153589085 18:6654272-6654294 AAGAAAAAGAAGGTAGTGGGAGG + Intergenic
1153815401 18:8786120-8786142 CAGAAAAAGGAGGGGGAGGGCGG - Intronic
1153978988 18:10293532-10293554 GAGAAAAAGAAGAAAAGGGGAGG + Intergenic
1154989182 18:21583997-21584019 GAGAAAAAGGAGATGGTGGAAGG + Intronic
1155096517 18:22560685-22560707 CAGCCAAAGGAGAAAGTGGAGGG - Intergenic
1155311182 18:24525434-24525456 CAAAAAAAAAAAAAAGTGGGGGG - Intergenic
1155645309 18:28070506-28070528 CACAAAAAGGAGACAGGGAGAGG + Intronic
1155650823 18:28139397-28139419 AAGAAAAAGAAGAAATTGGGTGG - Intronic
1155685074 18:28538550-28538572 CATAGAAGGGACAAAGTGGGAGG - Intergenic
1155728610 18:29122599-29122621 CAGAAAAAGGAGACATTGCTAGG - Intergenic
1156170957 18:34484993-34485015 CAGAAAGTGAGGAAAGTGGGAGG + Intergenic
1156279826 18:35626118-35626140 CACAAAAAAGAGAAACTGGTGGG - Intronic
1156443039 18:37210949-37210971 CAGAAGAATCAGAAAGTGTGTGG - Intronic
1156487012 18:37472765-37472787 CAGAGAAGGGAGAAATTGGGAGG + Intronic
1156618930 18:38825582-38825604 CAGAAAAGTGGGAAAGTGGGAGG - Intergenic
1157177377 18:45463946-45463968 CAGAAAAATTAGAAATAGGGTGG - Intronic
1157401027 18:47387758-47387780 GAGGAAAAGCAGAAAGTTGGAGG - Intergenic
1157470405 18:47983925-47983947 GAGAAAAAGGAGAGAGGGGGAGG - Intergenic
1157785971 18:50482971-50482993 CAGGAAAGGGATAAAGTGTGTGG - Intergenic
1158071053 18:53470839-53470861 CAAGAGAAGGACAAAGTGGGAGG - Intronic
1158143407 18:54281870-54281892 CAGTAAAAGCAGTAAGTTGGAGG - Intronic
1158249651 18:55473335-55473357 AAGAAAAAGGAGAAAGCAAGAGG - Intronic
1158355618 18:56615455-56615477 CAGAAAAAGAAAAAATGGGGGGG + Intronic
1158428726 18:57363828-57363850 GAGAAAATGGAGAAACAGGGAGG + Exonic
1158610127 18:58932175-58932197 AAGCACAAGGAGAAAGAGGGAGG - Intronic
1158701021 18:59746880-59746902 AAGTAGAAGGAGAAAGTTGGAGG - Intergenic
1159114349 18:64095692-64095714 CAGAACACAAAGAAAGTGGGTGG + Intergenic
1159134265 18:64318638-64318660 GAGAGGAAGGAGAAAGAGGGAGG - Intergenic
1159157790 18:64606771-64606793 GAGAAAAATGAGAAAATGGCTGG + Intergenic
1159306198 18:66646042-66646064 GAGAAAATGGAGAAATTGAGTGG + Intergenic
1159862377 18:73664098-73664120 CAGCAAAAGAAAAAAGTGGCCGG + Intergenic
1159979377 18:74758452-74758474 CAGTAACAGGACAAAGTAGGGGG - Intronic
1160208608 18:76858357-76858379 CAAAAAAGGGAGAAGGGGGGAGG - Intronic
1160211555 18:76884786-76884808 CAACAAAAGAAGAACGTGGGAGG - Intronic
1160337678 18:78057249-78057271 CAGAAAAAGGAGAGAGTGGCTGG + Intergenic
1160361657 18:78287856-78287878 CAGAGAAAGCAGAAAATGAGGGG - Intergenic
1161351807 19:3797240-3797262 AAGAAAAAGTAGAAAGTGGGGGG - Intronic
1161585518 19:5103405-5103427 CAGGAAAATGAGAAAGCGGGCGG - Intronic
1161712648 19:5858153-5858175 CAGCAAAGGGAGATAGGGGGTGG - Intergenic
1161848881 19:6728494-6728516 CAGACAAAGAAGGAAGTGGGAGG - Intronic
1161935375 19:7368625-7368647 CAGATGCAGGAGAAAGAGGGAGG + Intronic
1162127676 19:8508059-8508081 CAGAGAATGGAGAAAGGAGGAGG + Intergenic
1163596298 19:18222998-18223020 CAGAAAAAAAAGAAATGGGGAGG - Intronic
1163600378 19:18245649-18245671 AAGAAAAAAGAGAAAATGTGGGG - Intronic
1163719925 19:18894135-18894157 CAGAAAAAGGGGACAGGAGGCGG + Intronic
1163927441 19:20359433-20359455 CAGCAAAAGGAGATAGGGGTGGG - Intergenic
1164658367 19:29941059-29941081 CATAAAAAGGAAAAAAAGGGTGG + Intronic
1164794293 19:31014015-31014037 GAGAAACAGGAGAAAGAGGAGGG + Intergenic
1164795358 19:31022483-31022505 CAGAAAGAGGAAGAAGAGGGAGG - Intergenic
1164815322 19:31195045-31195067 GAGAAAAAGAAAAAAATGGGGGG + Intergenic
1164851942 19:31491280-31491302 AAAAAAAAAGAAAAAGTGGGTGG + Intergenic
1164973023 19:32548755-32548777 AAGAAAAAGGTGAATGTGGCCGG + Intergenic
1165079391 19:33298818-33298840 CAGACACAGGACAGAGTGGGGGG + Intergenic
1165182650 19:33985914-33985936 GAGAAAAAGGAAAACTTGGGAGG - Intergenic
1165249898 19:34521847-34521869 AAAAAAAAGGAGAAAGAGAGAGG - Intergenic
1165281983 19:34805570-34805592 CTGGAAATGGAGAAAGTGGCTGG - Intergenic
1166500980 19:43341079-43341101 CAGAAAAGAGAGAGAGTGAGGGG - Intergenic
1166595381 19:44043971-44043993 CAAAAGAAGAATAAAGTGGGAGG - Intergenic
1166649371 19:44560134-44560156 AAAGAAAAGGAGAAAGAGGGAGG + Intergenic
1166969426 19:46554674-46554696 TAGAAAAAGAAGAAACTGAGTGG + Intronic
1167157644 19:47749160-47749182 CAAAAAAAAAAAAAAGTGGGGGG + Intronic
1167444754 19:49530989-49531011 GAGAAAGGGGAGAGAGTGGGAGG + Intronic
1168675486 19:58275030-58275052 CAAATAAGGGAGAAAGGGGGTGG + Intronic
925031615 2:654199-654221 CAGACACTGGAGAAGGTGGGAGG + Intergenic
925188027 2:1862891-1862913 GAGAAGAAGGAGAAAGGAGGAGG + Intronic
925515087 2:4673221-4673243 CAGAAAAAGGAAAAGGGGAGGGG - Intergenic
925559981 2:5181106-5181128 AAGAAAAGAGAGAATGTGGGAGG + Intergenic
925869249 2:8254914-8254936 CAGAGCCAGGAGAAAGTGAGGGG - Intergenic
926516737 2:13855885-13855907 CAGAAAAGGGAGAAAGGGGCTGG + Intergenic
926638743 2:15212398-15212420 CACCAAAAGAAGAAAGTGGAAGG - Intronic
926726928 2:16005675-16005697 AAGAAAGAGGAGAAGGAGGGTGG - Intergenic
927078907 2:19608642-19608664 GAGAAGGAGGAGAAAGTGGGAGG - Intergenic
927399211 2:22691270-22691292 CAGAAAAAGAAGAAAAAGGGAGG + Intergenic
927525077 2:23732266-23732288 AAGAAAAAGGAGAGACTGAGGGG + Intergenic
928343771 2:30470704-30470726 CTGAAAAAGAACAAAGTTGGAGG - Intronic
928489371 2:31765581-31765603 TAGATAAAGGTGAGAGTGGGTGG - Intergenic
928744368 2:34394379-34394401 CAGAAAATGGAGAAAATAAGTGG + Intergenic
929052108 2:37846412-37846434 CAGAGAGAGGAGAAAGAGAGAGG - Intergenic
929251299 2:39758449-39758471 CAGAAAAAGGAACATGTGTGGGG + Intronic
929253221 2:39781276-39781298 AAGAAAGAGGAGAAAGTAAGGGG - Intergenic
929453405 2:42050765-42050787 CAGGAAAAGTGAAAAGTGGGGGG + Intronic
929496240 2:42446598-42446620 AAGAAACTGGAGTAAGTGGGAGG + Intronic
929777484 2:44938105-44938127 CAAAACAAGGAGAGAGTGGGAGG + Intergenic
929799924 2:45091033-45091055 TTGAAAAAGGAAAAAGAGGGTGG - Intergenic
929913075 2:46109134-46109156 CTGAAGAAGAAGAAAGTTGGGGG - Intronic
930296048 2:49555299-49555321 CAGAATAAAGAGTAAGTGGCAGG - Intergenic
930642007 2:53862896-53862918 AGGGAAAAGGAGAAAGGGGGTGG - Intergenic
930956842 2:57213066-57213088 AAAAAAAAGGAAAAATTGGGAGG - Intergenic
931028793 2:58146427-58146449 CAGAAAGAGGAGAAACTGATTGG + Exonic
931150069 2:59563118-59563140 AAGAAAAAGGTGAAAGAGGTAGG + Intergenic
931395453 2:61884604-61884626 TAAAAATAGTAGAAAGTGGGTGG - Intronic
932072760 2:68637237-68637259 CAGATAGAGGAGGAGGTGGGAGG + Intergenic
932300570 2:70664070-70664092 CAGAGAAAGGAGAAGGCGTGAGG + Intronic
932324497 2:70848400-70848422 CCGAAAAAGGAAAAACTGGAAGG + Intergenic
932726492 2:74184093-74184115 CAGACAAGGGGGAAAGTGAGGGG + Intergenic
932993603 2:76819853-76819875 CTGAAAAAGCAAAAAGTAGGTGG - Intronic
933161458 2:79028403-79028425 AAGAAAAAGGAAAAAGAAGGAGG - Exonic
933649697 2:84840637-84840659 CAGAAAAAAGTTAATGTGGGCGG - Intronic
933831258 2:86211083-86211105 CAGGAAGAGTAGAAATTGGGTGG + Exonic
933982938 2:87568419-87568441 GAGGGAAAGGAGAAAGAGGGAGG - Intergenic
934105966 2:88694678-88694700 GAGAGAAAGGAGCAAGTGGAAGG - Intronic
934142148 2:89056843-89056865 CAGCAAAGGGAGATAGTGGTGGG - Intergenic
934494393 2:94784568-94784590 CAGAAAGATGAGGGAGTGGGAGG - Intergenic
934819475 2:97359711-97359733 AGTAAAAAGGAGCAAGTGGGAGG - Intergenic
934875000 2:97909472-97909494 GAGAAAAAGTAGGAAGTTGGAGG + Intronic
935314329 2:101816630-101816652 GAGCAAAAGGAGAAGGTAGGTGG - Intronic
935819856 2:106884103-106884125 CAGAAAGAAGAGAAACTCGGGGG + Intronic
936041892 2:109156122-109156144 CAGACAATGCAGAAATTGGGAGG - Intronic
936272923 2:111065057-111065079 TTGAAAAAGAATAAAGTGGGAGG + Intronic
936310903 2:111382376-111382398 GAGGGAAAGGAGAAAGAGGGAGG + Intergenic
936351533 2:111716436-111716458 GAGAAAATGGAGAAAGAGAGGGG + Intergenic
936949857 2:117966989-117967011 CAGAAAAAAAAGGCAGTGGGAGG - Intronic
937110583 2:119364063-119364085 CAGAGATAGGAGAAAGGGGGAGG + Intronic
937140041 2:119592128-119592150 TACAAAGAGGAGAAAGAGGGAGG + Intronic
937147971 2:119663612-119663634 TATAAAATGGAGAAATTGGGCGG + Intergenic
937514721 2:122640456-122640478 CAAAGAAAGCAGAAAATGGGAGG - Intergenic
937568234 2:123323369-123323391 CAGTTAAAGGAGAAAGTGCATGG + Intergenic
938028530 2:127971585-127971607 GATAGAAATGAGAAAGTGGGTGG - Intronic
938057593 2:128228356-128228378 CAGAGAAAGGAAAAAGAGAGAGG + Intergenic
938212946 2:129483848-129483870 CAGAAAGAGGAAAATGGGGGAGG - Intergenic
938601276 2:132842834-132842856 CAGAAAAAATGGAAATTGGGTGG - Intronic
938803713 2:134786969-134786991 CAGAAGCAGGAGAAAGTTGAAGG + Intergenic
938822949 2:134977178-134977200 CAAAAAAAAAAAAAAGTGGGTGG - Intronic
939288884 2:140167875-140167897 CAGAAAAAGCAGAAACTGACAGG + Intergenic
939481472 2:142753363-142753385 GAGAAAGAGAGGAAAGTGGGAGG - Intergenic
939524227 2:143272283-143272305 CAGAAAAAGCAGAAAGAGTATGG - Intronic
939582992 2:143973492-143973514 TAGAAAAATGAGAAATTGGCCGG + Intronic
939651280 2:144765604-144765626 GAGAAAAAAGAGGATGTGGGTGG + Intergenic
940164056 2:150748397-150748419 AAGAAAAAGAAGAAAGAGGAAGG - Intergenic
940187857 2:151006501-151006523 CTGAAAAAGGTACAAGTGGGAGG + Intronic
940315480 2:152323679-152323701 AAAAAAAAGGACAAAATGGGAGG - Intergenic
940332468 2:152490178-152490200 CAAAAAAAGGGGAAAGAGGAGGG + Intronic
940421960 2:153489497-153489519 AAGAAAAAGAAGACAGTTGGTGG + Intergenic
940658863 2:156521546-156521568 CACAAAAAGTAGAAATTTGGTGG - Intronic
940670584 2:156662187-156662209 CAGAAAAAGCAGAAACTAGTAGG - Intergenic
941231967 2:162921466-162921488 AAGAAAGAGGAGAAAGAGGAAGG + Intergenic
941430320 2:165406788-165406810 TGGAAAAAGGAGAAAGAGAGAGG + Intergenic
941437710 2:165492040-165492062 TAGAAAGAGGACAAAGTGGAGGG - Intronic
941650100 2:168083214-168083236 AAAAAAAAGGAGAATGTGGAAGG - Intronic
941831332 2:169963446-169963468 TAGAAAAAGGATGAAGTGGTAGG - Intronic
942002717 2:171664930-171664952 CAGACACAGGAGAAAGTCTGTGG + Intergenic
942465676 2:176205089-176205111 CAGAAACAGGAGAAACATGGGGG + Intergenic
942492026 2:176498992-176499014 CAGAGAGGGGAGAAAGTGGAGGG - Intergenic
942500617 2:176586619-176586641 CTGAAAAAGGAAAAATTTGGAGG - Intergenic
942635305 2:177997785-177997807 CAGAAGAAGCAGAAAATGGAGGG - Intronic
942743099 2:179202258-179202280 GAGAAAAAGCAGAAAGTAGCGGG - Intronic
943577136 2:189643072-189643094 AAAAAAAAGGAGAAGGAGGGAGG - Intergenic
944015211 2:195027653-195027675 CAGAATGAAGAGAAAGTTGGTGG + Intergenic
944158841 2:196638083-196638105 TTGAAAAAGGACAAAGTTGGAGG + Intergenic
944191430 2:197008639-197008661 CAGAAGAAGGTAAAAATGGGCGG + Intronic
944224226 2:197334055-197334077 CAGAAAAAGGAGCAGGTTTGGGG + Intergenic
944652122 2:201841489-201841511 AAGAAAAAGAAAAAAATGGGAGG - Intronic
945012887 2:205483590-205483612 GAGAAAAAGGAGAGAGGGGAGGG - Intronic
945403022 2:209410783-209410805 TAGAAAAAGAACAAAGTTGGAGG + Intergenic
945582377 2:211611312-211611334 CAGAAAAAGGAAAAGGGGAGGGG + Intronic
946071492 2:217037955-217037977 AAGATAAAGGAGAAAGTGGGTGG - Intergenic
946189923 2:218002755-218002777 CAGCAAAAGGATAAGGTGGCAGG + Intronic
946291657 2:218749983-218750005 CAGAAAAAGGATAAAAAGAGTGG - Intronic
946794468 2:223335207-223335229 AAGAAAAAGAAGAAAGCTGGAGG + Intergenic
946960192 2:224976822-224976844 CAAAAGAAGGAGGAAGAGGGTGG - Intronic
946964944 2:225027608-225027630 CAGGAGAAGGAGAGAGAGGGAGG - Intronic
947285169 2:228506166-228506188 CAGAAAGTGGACAAAGTGGGTGG + Intergenic
947308808 2:228777825-228777847 CAGAAAAAGTTGAATGAGGGAGG + Intergenic
947348358 2:229217475-229217497 CAGAAAATGGAGAGAGATGGAGG + Intronic
947660871 2:231866594-231866616 CTGAAAAAGAAGACAGTTGGAGG + Intergenic
948049102 2:234966080-234966102 GAGAAAGAGGAGAAAGAGGCTGG + Intronic
948183885 2:236003779-236003801 CAGAAAAAAAAAAAAGTGGTAGG - Intronic
948236122 2:236391968-236391990 AAGAAAAAGGACAAGGTGAGTGG - Exonic
948416456 2:237809370-237809392 CAAAGAAAGGAGACAGTCGGGGG - Intronic
1168820432 20:769292-769314 GAGAAAGAGGCCAAAGTGGGGGG - Intergenic
1168940347 20:1706258-1706280 CAGAAAAATTAGAAAGTGCAGGG - Intergenic
1169148902 20:3273947-3273969 AAGTAAAGGGAGTAAGTGGGGGG - Intronic
1169371829 20:5033907-5033929 AAGAAAAATCAGAAAGTGGGTGG - Intergenic
1169548248 20:6673337-6673359 CAGAAGAAGAAGGAAGTTGGGGG - Intergenic
1169949618 20:11029021-11029043 AAGAAAAAGGAGAAAGGGCTGGG - Intronic
1170311116 20:14993044-14993066 AAGAGAAGGGAGAAAGAGGGAGG - Intronic
1170402326 20:16001367-16001389 AAGAAAAAAGAGAAAAAGGGAGG + Intronic
1170652511 20:18255881-18255903 AAGAACAAAGAGAAAGTTGGGGG - Intergenic
1170692743 20:18629834-18629856 CAGAAATAAGAGAAAGCAGGGGG + Intronic
1172559896 20:35877569-35877591 AAAAAAAAAAAGAAAGTGGGAGG - Intronic
1173051610 20:39567736-39567758 CAGAAAAAAGAGAGAGAGGGGGG - Intergenic
1173209858 20:41023733-41023755 AGGATATAGGAGAAAGTGGGTGG - Intergenic
1173237681 20:41262447-41262469 GAGAAAGAGGATAAAGTGAGAGG - Intronic
1173905592 20:46626346-46626368 GAGAGACAGGAGAAAGAGGGAGG - Intronic
1174211100 20:48878632-48878654 CAGAAAAAGGGGAATGTGGCCGG - Intergenic
1174372265 20:50099494-50099516 CAGGAAATAGAGAAAGTAGGGGG - Intronic
1174523365 20:51151773-51151795 CACAGAAAGGACAAAGTTGGAGG + Intergenic
1174536849 20:51257932-51257954 CAGAAAAAAAAGAAAGTGCTAGG + Intergenic
1174670989 20:52307543-52307565 CAGAAAAAGCAGAAGGGTGGGGG - Intergenic
1174684882 20:52445183-52445205 GAGAAAAGGGATAAAATGGGAGG - Intergenic
1175080716 20:56418161-56418183 CAGAAAGAGGAGAAAACAGGGGG + Intronic
1175267344 20:57710417-57710439 GAGAAATTGGAGAAAGGGGGAGG + Intronic
1175326726 20:58134626-58134648 CAAAAAAAAAAAAAAGTGGGGGG + Intergenic
1175438036 20:58968340-58968362 GAGAAAAAAGGGCAAGTGGGAGG + Intergenic
1176742588 21:10617515-10617537 AAGAAAAGGGAGAAAGGGTGGGG + Intergenic
1176878120 21:14155383-14155405 CAGAAAGAGAAGAGAGTGTGGGG + Intronic
1177085837 21:16702870-16702892 CTGAAAAAGGAGTAATTGGATGG - Intergenic
1177343332 21:19834643-19834665 AAGAAAAAGGACAAAGAAGGAGG - Intergenic
1178130305 21:29564549-29564571 CGGTAAATGGAGAAAGTGTGGGG + Intronic
1178452086 21:32711304-32711326 CAGAAAAAAGAAAAAGGTGGAGG - Intronic
1178585430 21:33867125-33867147 CAGATAAATGAGATAATGGGTGG + Intronic
1178895125 21:36551400-36551422 CAAGAAAAGGAGGCAGTGGGAGG - Intronic
1179091303 21:38268567-38268589 AAAAAAAAAAAGAAAGTGGGAGG + Intronic
1179510518 21:41870049-41870071 CAAAAGAAGAATAAAGTGGGAGG - Intronic
1179806560 21:43841876-43841898 TTGAAAAAGAAGAAAGTTGGGGG - Intergenic
1179929397 21:44557510-44557532 CAGAGGAAGGAGAGAGGGGGAGG + Intronic
1180186923 21:46144731-46144753 CAGAAAAGAGAGAGAGAGGGAGG - Intronic
1180675321 22:17582376-17582398 AAAAAAAAGGAGAATGTGGTAGG + Intronic
1180721453 22:17911838-17911860 CAAAAAAAGAAAAAAGTAGGTGG + Intronic
1180756792 22:18167988-18168010 CATCAAAAAGAGAAAGTGGGAGG - Exonic
1181776221 22:25161751-25161773 CAGGAAAAGGAGAAGGGGAGGGG - Intronic
1181903818 22:26177311-26177333 AAGAAAAATTAAAAAGTGGGAGG + Intronic
1181922142 22:26328762-26328784 GAGAAAAGGGAGAAAGGAGGAGG + Intronic
1182001853 22:26926363-26926385 CAGAAAGAGGAGAGAATGGGAGG - Intergenic
1182106755 22:27695205-27695227 CAGGAAGAGGAGAAAGAGGCGGG + Intergenic
1182427606 22:30283203-30283225 CACACAGATGAGAAAGTGGGGGG - Intergenic
1182723755 22:32426240-32426262 CAGGAAAAGGATCAAGTGGGTGG - Intronic
1182731806 22:32501967-32501989 GAGGAAAAGAAGAAAGTGGTTGG - Intergenic
1183258452 22:36778275-36778297 AACAAAAGGGAGACAGTGGGTGG - Intergenic
1183266921 22:36833582-36833604 CAGAAATAGCAGTAAGTGGCAGG + Intergenic
1183659704 22:39211990-39212012 CAGAAGCACGAGAGAGTGGGGGG - Intergenic
1183731152 22:39619284-39619306 CAGAGAAAGGAGAGAGAGTGAGG - Intronic
1184037342 22:41925021-41925043 CTGAAAAAAGACCAAGTGGGAGG - Exonic
1184387135 22:44182635-44182657 CTGAAAAGGGAGGAAGAGGGAGG + Intronic
1184458169 22:44623075-44623097 TAGAAAAATGAGAAAGAGGCCGG + Intergenic
1184586540 22:45451978-45452000 CAGAAAAAGAAGGAACTGGACGG - Intergenic
1184728211 22:46358226-46358248 CAGAAACATGAGTAGGTGGGAGG + Intergenic
1184773299 22:46610387-46610409 CAGAAACAGGTGGCAGTGGGTGG - Intronic
1184832850 22:47000714-47000736 AAGAAAAAGGTGAGAGTAGGAGG + Intronic
1185207138 22:49546389-49546411 CAGAAAAAGAAGTATGTGTGTGG - Intronic
949908840 3:8883087-8883109 GAGAAAAAGGAGTATGTGAGGGG + Intronic
949924570 3:9031163-9031185 CACAAAAGGCAGAAAGTGGAAGG - Intronic
950248257 3:11441641-11441663 AAAAAAAAGGAGAAAGGGGAAGG - Intronic
950642379 3:14356713-14356735 TAGTAAAAGGAGAAACTGGCCGG + Intergenic
950665503 3:14492612-14492634 GAGGAAGAGGAGAAAGAGGGAGG - Exonic
950895038 3:16440874-16440896 CAGAAATAGGAAGAAGTGCGGGG - Intronic
951679936 3:25284060-25284082 CAGCAAAATGAGAAGGAGGGAGG - Intronic
951781521 3:26368581-26368603 CAGTAAAAGGAGGAAGTGGGGGG + Intergenic
952013476 3:28929862-28929884 CAGAGAAAAGAGAAATTGAGTGG - Intergenic
952242113 3:31542113-31542135 CAAAAATACAAGAAAGTGGGTGG + Intronic
952484217 3:33793278-33793300 CAGAATAAGGAGAGGGTGGAGGG - Intergenic
952853454 3:37748450-37748472 CAGAAAAAGAAGGAAGCTGGCGG + Intronic
953589379 3:44236865-44236887 CTGAATAAGGAGAAAGGAGGGGG - Intergenic
953639015 3:44688245-44688267 CAAATAAGGGAGAAAGGGGGTGG - Intergenic
953762193 3:45697570-45697592 CATAAAAAAGAAAAAGTGGTTGG - Intronic
954912745 3:54122542-54122564 CAGAAAAAGGAGCGGGTGGGGGG - Intronic
954914378 3:54136317-54136339 GAGGAAAAGGAGAAGGTTGGAGG - Intronic
955092682 3:55768045-55768067 CAGAAAAAGGAGGAAGAGAGTGG - Intronic
955307450 3:57848549-57848571 AAGAAAAAGGAGAAGGAGGGAGG - Intronic
955671808 3:61410270-61410292 AAGGAAAAGGAGAAAGAAGGAGG + Intergenic
955867186 3:63397485-63397507 TAGAAAAAGGAGAATGCAGGAGG - Intronic
956147837 3:66210116-66210138 TAGAAAAGGGAGAAGGAGGGAGG - Intronic
956202630 3:66722314-66722336 AAGAAGAAGGAGAAAGAGGGAGG - Intergenic
956545637 3:70399139-70399161 CAGCAAAAGGAGAAAAGAGGAGG - Intergenic
956657573 3:71567162-71567184 AAGAAAAATGAGAAAGTGGACGG + Intronic
956678468 3:71755650-71755672 TGGAAGCAGGAGAAAGTGGGGGG + Exonic
956811289 3:72866339-72866361 TAGAAGATGGAGAAAGAGGGAGG - Intergenic
956840239 3:73133315-73133337 GAGGAAAAGGAGAAAGAAGGTGG - Intergenic
956919697 3:73913924-73913946 CAAACAAGGGAGAAAGGGGGTGG - Intergenic
957150486 3:76480024-76480046 TAGAAAAAGGAGGAAGAAGGAGG + Intronic
957151351 3:76490141-76490163 CATAAAAAGGAGGAAGTGGAAGG - Intronic
957255281 3:77827923-77827945 CAGCAAAAGGAAAAGGTGTGTGG + Intergenic
957368830 3:79263771-79263793 GGGAAAAAGAAGAAAATGGGAGG - Intronic
957399841 3:79696037-79696059 AATAAAAATGAGAATGTGGGAGG + Intronic
957523037 3:81345564-81345586 CAGAATAAGGGGAAGGTGGATGG + Intergenic
957825038 3:85430592-85430614 GCGAATAAGGAGAAAGGGGGCGG + Intronic
958452568 3:94292522-94292544 AAGAACAAAGAGAAAGTTGGGGG - Intergenic
958531963 3:95344466-95344488 CAGCAAAAAGAGAAAGTAGTGGG - Intergenic
958863872 3:99477808-99477830 AAGTAAAAAGAGAAAATGGGTGG - Intergenic
958920080 3:100095170-100095192 GAAAAAGAAGAGAAAGTGGGAGG - Intronic
958971047 3:100610585-100610607 CTGGAAAAGGAGGACGTGGGAGG + Intronic
959188300 3:103075593-103075615 TTGAAAAAGGAGAAAATGGAGGG + Intergenic
959302775 3:104623620-104623642 AAAATAAAGGAGAAAGTGAGAGG + Intergenic
959388940 3:105748821-105748843 CAGAAGAAGGAGCCAGTGGGGGG - Intronic
959485935 3:106927265-106927287 CAGAAAAGTGAGAAAGGGGTTGG + Intergenic
959730525 3:109596236-109596258 CAGAGAAAGGTGAGAGTGAGGGG + Intergenic
959794473 3:110407726-110407748 AATAAGAAGAAGAAAGTGGGAGG - Intergenic
959825222 3:110786341-110786363 CAGAAAAAGAACAAAGTGGTAGG - Intergenic
959835944 3:110918020-110918042 CAAAAAAAAGGGAAAGTGGGAGG + Intergenic
959898876 3:111637705-111637727 CAGAAAAAGGCCAGAGTTGGGGG - Intronic
960016806 3:112900204-112900226 TAGAAAAAGGAGTATGTGGAGGG + Intergenic
960121677 3:113953672-113953694 CAGAAAAAGCACAAAGAGGAGGG - Intronic
960243295 3:115371142-115371164 GAGAGAAAGGAGAATGTGGAAGG - Intergenic
960540064 3:118851904-118851926 CAGAAAAAGGAAAAGGGGAGGGG + Intergenic
960707810 3:120497381-120497403 CAGAAAAGGGGGAAGGTGAGTGG - Intergenic
960735561 3:120775681-120775703 CAGACAAAGAAGATCGTGGGTGG + Intronic
961716155 3:128858879-128858901 CCAAAAAAGGAGGAAATGGGAGG - Intergenic
962141411 3:132794433-132794455 TTGAAAAAGAAGAAAGTTGGAGG + Intergenic
962714826 3:138116812-138116834 TGGAAAAAAGAGAAAGAGGGAGG - Intergenic
962825582 3:139097374-139097396 CTGAAAAAGAACAAAGTTGGAGG - Intronic
962832517 3:139157219-139157241 CAGAAATAGGAGAAAGGAGGTGG - Intronic
962910086 3:139840134-139840156 CAGAAAAGGGGAAAATTGGGAGG + Intergenic
962952186 3:140229486-140229508 GAGAAAAAGGAAAAGGAGGGTGG - Intronic
963303088 3:143620613-143620635 TTGAAAAAGGAGAAACAGGGGGG + Intronic
963327347 3:143877129-143877151 GAGGAAAAGGAGAAGGTGTGGGG - Intergenic
963438255 3:145300307-145300329 CAGAAAAAGGAGAGTCCGGGCGG - Intergenic
963559908 3:146851313-146851335 AAGGAAAAGGAGAAAGGAGGAGG + Intergenic
963635410 3:147788805-147788827 CAGAAAAAGGAGAAACTAATAGG - Intergenic
963887396 3:150597782-150597804 CAGAAAATAGTGAAAGTGGCTGG - Intronic
963893519 3:150661301-150661323 CACAAAAAGGAAAAGGTGAGGGG - Intronic
964016122 3:151949104-151949126 AAGCAAAAGGACAAAGTTGGGGG + Intergenic
964181725 3:153895612-153895634 CAGAATAATGAGAATGTGGAAGG - Intergenic
964403177 3:156320567-156320589 GAGAAAATCTAGAAAGTGGGAGG + Intronic
964447138 3:156771340-156771362 CAGCAGAAGGAGAAAATGTGAGG - Intergenic
964595260 3:158420018-158420040 GGGTAAAAGGAGGAAGTGGGGGG - Intronic
964742705 3:159984325-159984347 AAGAAAAAGAAAAAAATGGGGGG - Intergenic
964960472 3:162417693-162417715 CAGGTAAAGGAGATTGTGGGAGG - Intergenic
965874807 3:173303419-173303441 CATAGAGAGGAGAAAGAGGGAGG + Intergenic
965906494 3:173713980-173714002 AAGAAAAAGGAGAAAGATGAAGG + Intronic
965993045 3:174844433-174844455 CAGAAAAAGAACAAAGCTGGAGG - Intronic
966035473 3:175408107-175408129 CAGAAACAGGGGAAAGGGGAAGG + Intronic
966055782 3:175687828-175687850 CAGAAACAAGAGAAAGGTGGGGG - Intronic
966268775 3:178080184-178080206 CATGAAAAGGAGAAGGTGGGAGG - Intergenic
966374948 3:179286852-179286874 CAGAGAAATGAGAAAGTTGGGGG + Intergenic
966473320 3:180317087-180317109 CAGGCAAAGCAAAAAGTGGGAGG - Intergenic
966895108 3:184439084-184439106 AAGGAGAAGGAGAAAGGGGGAGG + Intronic
966932594 3:184685467-184685489 CAGATAAAGCAGGCAGTGGGTGG + Intergenic
966987393 3:185194123-185194145 CTGAAAAAGAACAAAGTTGGAGG + Intronic
967095530 3:186174445-186174467 GAAAAAAAGGAGAAGGTTGGGGG + Intronic
967111142 3:186295070-186295092 CAGCAAAAAGAGAAACTGGAAGG - Intronic
967198702 3:187052010-187052032 CAGAAAAAGGCAAATGTTGGTGG - Intronic
967316553 3:188155710-188155732 CAGTTAAAGGAAAAAGTGTGTGG + Intronic
967375232 3:188793476-188793498 CAGTATAATGAGAAAGTGGCCGG - Intronic
967489364 3:190072069-190072091 CTGAGAAAGGAGAACCTGGGAGG - Intronic
967607326 3:191462984-191463006 AAGAAAAAGAAAAAAGAGGGAGG - Intergenic
967746098 3:193057073-193057095 CAGAAATGGGAGAAAGTGTTTGG + Intergenic
967853688 3:194100757-194100779 AATAAAAAGGAGAGAGAGGGAGG + Intergenic
967862098 3:194160065-194160087 GAGAAAATCCAGAAAGTGGGTGG - Intergenic
968016754 3:195341986-195342008 CAGAAAGGGGGGAAGGTGGGAGG + Intronic
968041419 3:195592257-195592279 GAGAGAAAGGAGAAGGAGGGAGG + Intergenic
968119702 3:196117144-196117166 CAAAAAAAAAAAAAAGTGGGGGG - Intergenic
968257305 3:197287618-197287640 AAGAAAAAGGAAAAAGGAGGAGG + Intronic
968726590 4:2250747-2250769 CAGAAAAGGGAGAAATGGGCTGG - Intronic
968738021 4:2308750-2308772 AAGAAAAGAGAGAAAGAGGGAGG + Intronic
969003978 4:4004777-4004799 CAGAAAAGCGAGAAAGGGGTTGG + Intergenic
969506454 4:7591184-7591206 GAGAAGAAGGAGAAGGTGGGAGG - Intronic
969660867 4:8526663-8526685 CAGGAAAAGCTGAATGTGGGAGG + Intergenic
969809953 4:9640048-9640070 CAGAAAAGCGAGAAAGGGGTTGG - Intergenic
970511338 4:16784748-16784770 CGGAAGAAGGAGAGAGTGGTGGG - Intronic
970620655 4:17814407-17814429 AAGAAAAAGAAGGAAGTTGGTGG + Intronic
970780784 4:19734991-19735013 GAGGAAAAGGAGAAAGTGAAAGG + Intergenic
970852535 4:20618170-20618192 CAGACAAAGGAGAAGGAGGAAGG - Intronic
971388166 4:26160692-26160714 GAGTAAAAGGAGAAAGAGTGTGG + Intergenic
971655248 4:29336000-29336022 AAGAAAAAGGAGGAAGGAGGAGG - Intergenic
972017658 4:34266270-34266292 AAGAAAAAAGAAAAAGTGGGAGG + Intergenic
972247417 4:37259805-37259827 GAGAAAAGGCAGAGAGTGGGAGG + Intronic
972447132 4:39155337-39155359 AAGAAAAAGAAAAAAGTTGGAGG + Intergenic
972830034 4:42803791-42803813 CTGGAGCAGGAGAAAGTGGGGGG + Intergenic
972986624 4:44773315-44773337 CAGGAGTAGGAGTAAGTGGGAGG - Intergenic
972994171 4:44859501-44859523 AAGAACAAAGAGAAAGTGAGAGG - Intergenic
973246049 4:48012510-48012532 CAGCAAAAGGAAAAAGAGGAAGG - Intronic
973632189 4:52829967-52829989 GAGAAAAAGGAGAAAGGAAGAGG - Intergenic
973832858 4:54779392-54779414 CAGAGAAAGGAAAAAATGGAGGG + Intergenic
974032794 4:56790981-56791003 CAGAAGAGGGAGGGAGTGGGAGG - Intergenic
974525564 4:63046110-63046132 CAGAAAAAGTAGAAAGAGATGGG - Intergenic
974723754 4:65773694-65773716 CAGTATAGGGAGGAAGTGGGTGG + Intergenic
974738116 4:65966891-65966913 CATAAAAAAGAGAAAATGTGTGG + Intergenic
974939719 4:68451904-68451926 CAGACAAAGGAGACATTGTGAGG - Intronic
975074589 4:70189801-70189823 CAGAAAATCCAGAAATTGGGAGG + Intergenic
975818115 4:78240948-78240970 CAGTTAAAGGAGTAAGTGGGAGG + Intronic
975838835 4:78453250-78453272 AAGAAAAAGGAGGCAGTGGCAGG + Intronic
975996039 4:80316764-80316786 TTAAAAAAGAAGAAAGTGGGAGG + Intronic
976095822 4:81507141-81507163 AAGATAAAGGACAAAGTGGAGGG - Intronic
976241674 4:82964348-82964370 AAGAAAAAAGAGTAAGTGGCTGG - Intronic
976697038 4:87927748-87927770 AAGAAAAAAGAGACAGAGGGAGG - Intergenic
976986250 4:91302690-91302712 CAGAGAAAAGGGAAAGTGGCTGG - Intronic
977007882 4:91594918-91594940 CAGAGAAAGGGAAAAGTAGGAGG - Intronic
977065163 4:92304884-92304906 CAGAAAACTGAGCAAGTGTGAGG - Intronic
977157096 4:93588209-93588231 TATAAAAAGAAGAAAGGGGGAGG + Intronic
977784812 4:101020460-101020482 CAGAAAAAGGAGATAAGTGGTGG - Intergenic
978914886 4:114112328-114112350 CAGGAAGACTAGAAAGTGGGAGG + Intergenic
979243457 4:118470792-118470814 TGGAAAAAAGTGAAAGTGGGAGG + Intergenic
979361002 4:119765022-119765044 TTGAAAAATGAGAAAGTGTGTGG + Intergenic
979405014 4:120299168-120299190 AAGAAAAAGGAGAAAGAGGAAGG - Intergenic
979580761 4:122356741-122356763 AAGAAAAAGAAAAAGGTGGGTGG + Exonic
979754488 4:124324348-124324370 TATAAATAGGAGAAAGTGGGGGG - Intergenic
979757092 4:124354480-124354502 AAGAAGAAGAAGAAAGTTGGAGG - Intergenic
980189510 4:129505997-129506019 CAGAAACAGAAGAAACTGAGTGG + Intergenic
980190911 4:129523886-129523908 CATAAAAAGGGGAGAGTAGGTGG + Intergenic
980581770 4:134763475-134763497 AAGAAAGAGCAAAAAGTGGGAGG - Intergenic
981021181 4:140030527-140030549 GACAAAAAGGAAAAGGTGGGAGG - Intronic
981023408 4:140052092-140052114 GAAAAAAATGAGAATGTGGGAGG + Intronic
981046623 4:140270676-140270698 CAGAGAAAGGAGGTAATGGGTGG + Intronic
981083082 4:140654455-140654477 GAGAAAAAGAAGAAAGGGGTGGG + Intronic
981660163 4:147157513-147157535 CAGGAAATGAAGAAAGTGGCAGG - Intergenic
981661461 4:147171943-147171965 CAGAGAAAGGGGACAGTGGAAGG - Intergenic
981775239 4:148359664-148359686 TAAAATATGGAGAAAGTGGGAGG - Intronic
981966968 4:150615605-150615627 GAGAAAAAAGAGAATGTGAGAGG + Intronic
982253524 4:153431214-153431236 CAGAAAAAGGAGTAGGTTGTAGG + Intergenic
982465159 4:155721460-155721482 CAGAGGAAGCAGAAAGTGGAAGG - Intronic
982663961 4:158238318-158238340 CAGATAAAGGAGAATTTGGAGGG + Intronic
982829011 4:160037018-160037040 AGCAAAAAGGACAAAGTGGGAGG + Intergenic
982989084 4:162247394-162247416 CAGATAATTAAGAAAGTGGGTGG - Intergenic
983375574 4:166923186-166923208 CAAAAACAGGAGAAAGTGATAGG - Intronic
983897855 4:173100693-173100715 AAAAAAAAGGAAAAAGGGGGTGG + Intergenic
984632567 4:182076187-182076209 AAGAAGAAGGAGAAAGAGGCTGG - Intergenic
984803297 4:183733779-183733801 CAGAAAAGGAAGAAAGGGGAAGG - Intergenic
985752639 5:1690116-1690138 AAGAAAAAGAACAAAGTTGGAGG - Intergenic
986140542 5:5025963-5025985 CAGAAAAAGGAAAAGGGGAGGGG - Intergenic
986227142 5:5826448-5826470 CAGAAAAGGGAGCAAATGGGAGG + Intergenic
986423624 5:7608979-7609001 CATAAAAAAGGGGAAGTGGGTGG - Intronic
986585179 5:9309052-9309074 CAGAAGAAAGAGTAAGTGGAAGG + Intronic
986630938 5:9773036-9773058 CAGAAAAATAACAAAGTGGCAGG - Intergenic
986865516 5:11981859-11981881 CAGAGAAAGTAGAATGTGGAAGG - Intergenic
987183695 5:15392526-15392548 TAGAAAAAGGAGAAATCGGCCGG + Intergenic
987186712 5:15428543-15428565 TAGAAAAAGAATAAAGTAGGAGG - Intergenic
987214638 5:15721535-15721557 CAGAGAGAGGAGAAAGGGGAAGG - Intronic
987452596 5:18104892-18104914 AAGAAAAAGGAAAAAAAGGGGGG - Intergenic
987503954 5:18746306-18746328 CAGAAAAAGGAAAAGGGGAGGGG - Intergenic
987906980 5:24089819-24089841 CAGAAAAGAGAGAGAGTGAGAGG + Intronic
988092940 5:26566806-26566828 AATAAAAAGGAAAAAGTGGAAGG + Intergenic
988101103 5:26680009-26680031 AAGAAAGAGGAGAAAGAGGGAGG - Intergenic
988115172 5:26877784-26877806 TAGATAGAGGTGAAAGTGGGAGG + Intergenic
988220211 5:28335363-28335385 CAGAAGGATGGGAAAGTGGGAGG + Intergenic
988459355 5:31418733-31418755 CAGAAAAGGGAGATAGAGAGAGG + Intronic
988844142 5:35112503-35112525 GAGAAAGAGGAGAAAGCAGGAGG + Intronic
988911811 5:35851122-35851144 GACAAAAAGGAGAAAGTGACGGG - Intergenic
988914652 5:35880396-35880418 AAGAAAAAGTAGGAAGGGGGAGG - Intergenic
988977443 5:36529011-36529033 CTGAAAATGGAGAGACTGGGTGG - Intergenic
989270474 5:39527097-39527119 CGGAGAAAGGAGAGAGAGGGTGG + Intergenic
989301861 5:39904129-39904151 CAGAAAGAGGAAAAACTGGCTGG - Intergenic
989512697 5:42306533-42306555 CAGACAAAGGAGAAGTTGGAAGG + Intergenic
990414556 5:55573805-55573827 CAGTAATAGGAGAAACTGTGGGG + Intergenic
990643727 5:57819183-57819205 TAGAAAAAGAACAAAGTTGGAGG - Intergenic
990729615 5:58794237-58794259 AAGAAAAAGAAAAAAATGGGGGG - Intronic
991195756 5:63930236-63930258 GAGAAAAAGGAAAAGTTGGGGGG + Intergenic
991331706 5:65499602-65499624 CAGAAAGAGGAGAAAGTGGGTGG - Intergenic
991439853 5:66635492-66635514 CAGAAAAACAAGAAAGTTTGGGG + Intronic
991592334 5:68266029-68266051 CTGACCAAGGAGAAAGTGAGTGG - Intronic
991651531 5:68860141-68860163 CAAAAAAAGAACAAAGTTGGAGG + Intergenic
991665059 5:68991363-68991385 GAGAAAAAGAAGAAAGAAGGTGG - Intergenic
991929022 5:71733391-71733413 CTGAATTAGCAGAAAGTGGGTGG + Intergenic
991942924 5:71871670-71871692 CAGATGAAGAAGAAAGTGGTTGG + Intergenic
992132848 5:73711269-73711291 CTGAAAAAGAAGAAAGTTGGAGG - Intronic
992384423 5:76270044-76270066 GAGACAAAGGAGAAAGGGGATGG + Intronic
992528470 5:77633141-77633163 CAGAAAAAAGAAAGAGGGGGAGG + Intronic
992753793 5:79885700-79885722 CAGACATGGGGGAAAGTGGGAGG + Intergenic
992885776 5:81158622-81158644 GAGAAAAAAGAAAAAATGGGTGG + Intronic
992913605 5:81424127-81424149 CAGAAAAAAGAGCAACTGGCCGG + Intronic
993015169 5:82527322-82527344 CCGACAAAGGAGAAAATGGATGG + Intergenic
993361508 5:86982168-86982190 CAGCAAAAGGGGAAAGAGGAAGG - Intergenic
993491776 5:88560662-88560684 CTAAAAAAGGAGCAAGTTGGAGG + Intergenic
993537703 5:89107194-89107216 AAGAAAAAGAACAAAATGGGAGG + Intergenic
993554509 5:89318664-89318686 CAGAAAAAGTAGAAAATAGGTGG + Intergenic
993554961 5:89325253-89325275 CTGATAAAGGAGGAAGTGGAAGG - Intergenic
994013518 5:94937496-94937518 CAAATAAAGAAGAAAGTAGGTGG - Intronic
994868662 5:105315445-105315467 CAGAAAAGGGAGTTAGAGGGAGG - Intergenic
994997205 5:107079025-107079047 CAAAAAAAGAGGAAAGGGGGAGG + Intergenic
995099461 5:108280906-108280928 CAGTAAAAAGAGAAAGAGAGAGG + Intronic
995422527 5:111983157-111983179 AAGAAAAAGGAACAACTGGGTGG + Intronic
995541990 5:113194680-113194702 AAGAAAAAGAAGAAAGGGGAAGG + Intronic
995714495 5:115068784-115068806 CAGAAAAAGGAGAAGAGGAGGGG - Intergenic
996199800 5:120657817-120657839 AACAAAAAGCAGAAGGTGGGAGG - Intronic
996343751 5:122467583-122467605 AAGAAAAAGAAGAAAGAAGGAGG + Intergenic
996501395 5:124220560-124220582 AAGAAAAAGAAGAAAGAGGAGGG - Intergenic
996682612 5:126244289-126244311 GATAAAAAGGTGAAAGTGTGTGG + Intergenic
997291708 5:132741162-132741184 TTGAAAAAGAAGAAAGTTGGAGG - Intergenic
997434282 5:133863073-133863095 CAGAAATAGGGGAAGGTGGCAGG - Intergenic
997475066 5:134138036-134138058 CTGAAAAATGAGAAGGAGGGTGG - Intronic
997650409 5:135513436-135513458 AAGAAAAAGGATATAGTGGCTGG - Intergenic
998010849 5:138694544-138694566 GAGAAAAAGGAGCAAGTGAAAGG + Intronic
998173407 5:139885669-139885691 CAGAGAAAGGAGTGAGTTGGTGG + Intronic
998359633 5:141573803-141573825 CAGGCAAAGGAGGAGGTGGGGGG + Exonic
998805418 5:145913580-145913602 CAGAAAAAGGAGAAAATTTCCGG - Intergenic
998819246 5:146043168-146043190 CAGAGAAGAGAGAAACTGGGTGG - Intronic
998961031 5:147487221-147487243 CAAAGACAGGAGAAAGGGGGAGG - Intronic
999110908 5:149120908-149120930 CAGAAAAAGAAGAAAGCAAGAGG + Intergenic
999547895 5:152651051-152651073 AGGAAAATGGAGAAAGTGGAGGG - Intergenic
999595535 5:153199863-153199885 AAGAAAAAAGAGAGAGAGGGAGG + Intergenic
999788097 5:154910690-154910712 CAAAAAAAAGAGAAAGTAAGAGG - Intronic
999869134 5:155731096-155731118 AAGAAAAAGGAGAAAGACAGAGG + Intergenic
1000717982 5:164670256-164670278 AAAAAAAAGGATAATGTGGGAGG - Intergenic
1000933045 5:167275299-167275321 TTAAAAAAGAAGAAAGTGGGAGG - Intergenic
1001514846 5:172348227-172348249 AAGACAAAGTAGAAAGTGTGTGG + Intronic
1001635310 5:173205956-173205978 CATAAAAAGGAGCAAGTGTCTGG + Intergenic
1001681293 5:173558974-173558996 AAATATAAGGAGAAAGTGGGGGG - Intergenic
1001695900 5:173669598-173669620 CAGAAAAAGAGGAAAGAAGGAGG - Intergenic
1002167249 5:177355853-177355875 CAGCTGAAGGAGAAAGAGGGAGG + Intergenic
1002254942 5:177951687-177951709 CAAAAAATAGAGAAAGTTGGAGG - Intergenic
1002383016 5:178843877-178843899 AAGAAAAAGAAGATATTGGGTGG - Intergenic
1002483141 5:179516717-179516739 CAAAAAATAGAGAACGTGGGAGG + Intergenic
1002657615 5:180763532-180763554 CTGAAAAAGAAGAAAATGGGAGG - Intergenic
1002925261 6:1602102-1602124 AGGGAAAAGGAGAGAGTGGGTGG - Intergenic
1002969677 6:2001590-2001612 CAGAAAAAGAACAAAGTTGGAGG + Intronic
1003000088 6:2324109-2324131 CAGGAAGAAGAGAAAGTAGGGGG - Intergenic
1003355957 6:5370237-5370259 AAGAAAAAGGAGAGAAGGGGAGG - Intronic
1003389821 6:5703964-5703986 CAGAGGAAGGAGGAAGAGGGAGG - Intronic
1004208076 6:13611028-13611050 TAGAAAAAAGAGAAAGAGGAAGG - Intronic
1004439431 6:15634612-15634634 CAAAAAAAATAGAAAGTGGTTGG - Intronic
1004539901 6:16539955-16539977 CAAAAAAAGGAGAAAAGGAGAGG + Intronic
1004873878 6:19935782-19935804 CAAATAAAGGAGAAAGAGTGTGG - Intergenic
1005430176 6:25748458-25748480 AAGAAAAGGGAAAAAATGGGAGG + Intergenic
1005446562 6:25930112-25930134 CAGGAAAAGGAGAACATGGCCGG - Intronic
1005955539 6:30660886-30660908 AAGAAAAAAGAAAAAGTGGAAGG + Intronic
1006024208 6:31137158-31137180 AAGAAAAAGAAGAAAGAGGCCGG + Intronic
1006123551 6:31822378-31822400 CAGAAAGAGGGGAAAGGAGGGGG - Intergenic
1006546278 6:34784599-34784621 CAAAAAAGGAATAAAGTGGGAGG + Intergenic
1006752306 6:36386475-36386497 GAGAAAATGAAGAAAGTGGCAGG + Intronic
1006960153 6:37921124-37921146 CAGACAAAGGAGGAAAGGGGAGG - Intronic
1007004556 6:38348210-38348232 CAGAAAAAGCAGAAAGAGAGAGG - Intronic
1007126892 6:39433050-39433072 CAGAAAAAGCAGAGCCTGGGAGG - Intronic
1007132833 6:39492644-39492666 GACAAAAAGGAGGAAGGGGGAGG - Intronic
1007228333 6:40330246-40330268 GAGAAAAAGCAGTGAGTGGGTGG - Intergenic
1007343004 6:41204190-41204212 CACAAAGAGGAGAAAGTGATGGG - Intergenic
1007552811 6:42743273-42743295 AAGAAAAAAAAGAAAGGGGGTGG - Intergenic
1007734899 6:43975522-43975544 GAGAAAAAGAATAAAGTGTGAGG - Intergenic
1007765578 6:44157930-44157952 CCCAGAAAGGAGAAAGGGGGAGG + Intergenic
1007868745 6:45007730-45007752 CAAAAAAAAAAAAAAGTGGGGGG - Intronic
1007950272 6:45866023-45866045 CAGAAAAAGGAGAGAAGGGAAGG - Intergenic
1008135289 6:47769253-47769275 CAGAATATGAAGAAAGTGAGAGG - Intergenic
1008154406 6:47996169-47996191 CAGAATCAGGAGAGAGTGGCTGG + Intronic
1008234864 6:49032452-49032474 TAGAAAAAGAACAAAGTTGGAGG + Intergenic
1008415699 6:51237453-51237475 CAGGGAAGGGAGAAGGTGGGAGG + Intergenic
1008593626 6:53018777-53018799 GAGAGAAAAGAGAAAGTGGAAGG + Intronic
1008730440 6:54475688-54475710 CTCAGAAAGGGGAAAGTGGGAGG + Intergenic
1008914967 6:56777536-56777558 AAGAAAGAGGAAAAAGTGAGTGG + Intronic
1009394265 6:63179633-63179655 AAGAAAAAGAAGAAAGTGATAGG + Intergenic
1009672351 6:66772550-66772572 GAGAAAAAGGTGAAAGAGAGAGG - Intergenic
1011134255 6:84082806-84082828 GACAAAAAGGAGAAAGGGGTGGG - Intronic
1011164634 6:84432007-84432029 CAGAAGAAGAAGAGACTGGGAGG - Intergenic
1011360419 6:86518413-86518435 CTAAAAAAGAAGAAAATGGGAGG + Intergenic
1011407045 6:87026489-87026511 AAGAAGAAGAAGAAAGTGAGGGG + Intergenic
1011559826 6:88603002-88603024 AAGAAAAATGAGAAAATAGGAGG - Intergenic
1011566268 6:88676108-88676130 TAGAAAAAGAACAAAGTTGGAGG + Intronic
1011675742 6:89731805-89731827 GAGAAAAAGGAAAAGGTGGGGGG - Intronic
1012034287 6:94111670-94111692 CAGAAAGAAGAGACGGTGGGAGG - Intergenic
1012036834 6:94152612-94152634 CAGAAAAAGGAGAAAATAAGGGG - Intergenic
1012334961 6:98044181-98044203 CATGAAAAAGAGAAAGGGGGAGG + Intergenic
1012436096 6:99216491-99216513 CTGATAAAGCATAAAGTGGGAGG + Intergenic
1012592162 6:100995506-100995528 GAGAAAATGGAAAAAGTGTGAGG - Intergenic
1012666767 6:101980877-101980899 AAAAAAAAGGAAAAAATGGGAGG - Intronic
1012871557 6:104678764-104678786 CTGAAAAAGAACAAAGTTGGAGG + Intergenic
1013124833 6:107172827-107172849 CAGAAATAGGATAGAGTGGCTGG + Intronic
1013172428 6:107648745-107648767 CAGAAATAGGAAAAGGTGGATGG - Intronic
1013325235 6:109039081-109039103 GAGGAAAAGGAGAAGGAGGGAGG + Intronic
1014224244 6:118829872-118829894 CAAAAAAGAGAGAAAGAGGGAGG + Intronic
1014247854 6:119085863-119085885 CAGGAGAAAGAGAGAGTGGGGGG + Intronic
1014281798 6:119449616-119449638 GAAAAACAGGAGAAAGTGGGGGG - Intergenic
1014503097 6:122217780-122217802 CTGAAAAAGTAGAAAGTGAATGG - Intergenic
1014653092 6:124065555-124065577 CAGAAATAGGGCAAAATGGGAGG - Intronic
1014844235 6:126256645-126256667 TCAAAAAAGGGGAAAGTGGGAGG + Intergenic
1015035693 6:128651557-128651579 CAGGAGACAGAGAAAGTGGGGGG - Intergenic
1015149008 6:130018993-130019015 AAGAGAAAGGAAAAAATGGGGGG + Intronic
1015292029 6:131548070-131548092 CAGAAAAAGGGGAAAGGAAGAGG + Intergenic
1015436472 6:133195378-133195400 CTGAAAAAGTGGAAGGTGGGAGG + Intergenic
1015682312 6:135822051-135822073 AAAAAAAAGGAGAAAGTGTAGGG - Intergenic
1015788841 6:136945953-136945975 CAGTGAAATGAGAACGTGGGTGG - Intergenic
1015854662 6:137610571-137610593 AAGATAAAGGAGAAAGTGTCAGG + Intergenic
1015989511 6:138922539-138922561 CAGAAAAAGAAGAAAAAGAGAGG + Intronic
1016156035 6:140809541-140809563 CAGAAAAAGAAATAAGTGGGAGG + Intergenic
1016204371 6:141453980-141454002 CAGAAAATTGAGAAAGGGGTCGG - Intergenic
1016370310 6:143366636-143366658 CAGAAATAAGAGAATGTTGGAGG - Intergenic
1016374037 6:143402318-143402340 CAGGACAACGGGAAAGTGGGGGG + Intergenic
1016464264 6:144310009-144310031 ATGAAACAGGATAAAGTGGGTGG - Intronic
1016643104 6:146373393-146373415 CAGAAAAGAGAGAAAGTGAAGGG + Intronic
1017224880 6:152009179-152009201 AGGAAAAATGAGAAAGTGGGTGG - Intronic
1017804198 6:157929209-157929231 CAAACAAAGGAGAAGGAGGGAGG - Intronic
1018336172 6:162792302-162792324 CAGAAATAGGAGTAAGGGGCAGG + Intronic
1018441101 6:163814116-163814138 GAGAAGAAAGAGAAAGTGGTGGG - Intergenic
1018536734 6:164828187-164828209 CAGAAAAGTGAGAGAGTGAGAGG - Intergenic
1018719269 6:166560623-166560645 CAGAAAAAAGAGAAATGGGGTGG + Intronic
1018788266 6:167125680-167125702 CAGAACCAGAAGAAAGAGGGAGG - Intronic
1018925327 6:168201841-168201863 AAGAAAGAGGGGAATGTGGGTGG + Intergenic
1019410963 7:906640-906662 AAGGGAAAGGAGAAAGGGGGCGG + Intronic
1019754065 7:2755204-2755226 TTGAAAAAGAATAAAGTGGGAGG - Intronic
1019779294 7:2930105-2930127 CAGAGAAAGGAGAAGGGGGCCGG + Intronic
1019790190 7:3007013-3007035 CAGAAAAAGGTGGTGGTGGGTGG + Intronic
1020339755 7:7097122-7097144 AAGAAAAAAGAGAAGGTTGGAGG + Intergenic
1020473860 7:8571408-8571430 CAGGAAAAGGGGAAATTTGGGGG + Intronic
1020734541 7:11931279-11931301 CAGAACAAAGAGAAAGTATGGGG - Intergenic
1020811643 7:12856224-12856246 CAAAAGAAGGAGGAAGTGGAGGG + Intergenic
1020848947 7:13324571-13324593 CAGAACAAGGAAAAATTCGGGGG - Intergenic
1020932180 7:14411757-14411779 CAGAAAAAAAAGAAAGAGGTAGG - Intronic
1021065546 7:16167993-16168015 CATAAAAAGAAGAAAGGGGAAGG - Intronic
1021158857 7:17246846-17246868 GAGAAAAAGGAGAAGGTGAAAGG - Intergenic
1021316003 7:19147708-19147730 AAGAAAAAGGAGTAAGGGGGAGG - Intergenic
1021343453 7:19491660-19491682 TAGAAAAAAGGGAAAGTGGAAGG - Intergenic
1021377454 7:19925354-19925376 CAGAAGAGGGAAAAAGTGGATGG + Intergenic
1021443773 7:20710367-20710389 CAAAAAAAAAAAAAAGTGGGGGG + Intronic
1021764375 7:23932030-23932052 CAGAAAAAGGACAAAATTGAGGG + Intergenic
1022016619 7:26355260-26355282 TTGAAAAAGAATAAAGTGGGAGG - Intronic
1022359735 7:29646601-29646623 CACAAAAACTAGACAGTGGGAGG - Intergenic
1022604782 7:31800675-31800697 TTGAAAAAGGAAAAAGTTGGAGG - Intronic
1022845619 7:34206892-34206914 GAGAAAAAAGAGAAAATGGCAGG + Intergenic
1023308498 7:38856601-38856623 CAGAGAAAAGAGAAAGGGTGGGG + Intronic
1023322895 7:39018789-39018811 GAGTAAAAGTTGAAAGTGGGAGG + Intronic
1023545277 7:41311993-41312015 CAGTAAAAGAAGAGAGTGTGAGG + Intergenic
1023655928 7:42420831-42420853 GAGAAAGAGGAGAAAGAGGGAGG + Intergenic
1024594868 7:50923642-50923664 CACAAAAAGTAGAAACTGGATGG - Intergenic
1024846275 7:53646450-53646472 AAGAAAAAGAAGAAAGATGGTGG - Intergenic
1025227483 7:57177892-57177914 CAGACAAAGGAGATATGGGGAGG + Intergenic
1026104169 7:67407900-67407922 CAGAAGGAGAAGGAAGTGGGAGG - Intergenic
1026158951 7:67852217-67852239 AAGAGAAAGGAGAAAGAGGAGGG + Intergenic
1026159082 7:67852903-67852925 AAGAACAAGGAGATAGAGGGGGG + Intergenic
1027784686 7:82566105-82566127 AAGAAAGAGGAGAAAGTGGCCGG - Intergenic
1027851009 7:83451970-83451992 CAGAAGAAGGAGAACGAGTGTGG - Intronic
1027882216 7:83855132-83855154 AAGAAGAAGGAGAAAGAGGCAGG + Intergenic
1028607811 7:92674073-92674095 AAAAAAAAGAAGAAAGGGGGAGG - Intronic
1028739258 7:94253403-94253425 CTGAAAAGGGAGAAAGGGTGTGG - Intergenic
1028995231 7:97092788-97092810 GACAAAAATGGGAAAGTGGGAGG + Intergenic
1031253695 7:119420769-119420791 CAGAAAAAGAAGTAAGTAAGAGG + Intergenic
1031554837 7:123161520-123161542 CAAGGAAAGGAGAAAGTGGAAGG - Intronic
1031691209 7:124790125-124790147 GAGAAGAGGGATAAAGTGGGTGG - Intronic
1031694935 7:124839010-124839032 AAGAAAAAGAAGAAAGTTGCAGG + Intronic
1032167457 7:129556646-129556668 CTGATAAAGAAGAAAGGGGGTGG + Intergenic
1032834362 7:135659682-135659704 CAGAAAAACCAGGAAGTGGGTGG + Intergenic
1032855569 7:135830761-135830783 CAGAGAAAGGAGAAAGCAGAAGG + Intergenic
1032865968 7:135924684-135924706 CAGAAAAAAAAAAAAGTGGAGGG - Intergenic
1033140267 7:138820369-138820391 AAGACAAAGGAGAAAGTGAGAGG - Intronic
1033152343 7:138926264-138926286 AAGAAAAAGGAAAAAGTTGCTGG - Intronic
1034657892 7:152743857-152743879 CAAAAAAAAAAAAAAGTGGGGGG - Intergenic
1034687933 7:152989984-152990006 GAGAAAAAGGAAAAAGGGGTGGG - Intergenic
1034743574 7:153501452-153501474 AAGAAAAAGAACAAAGTTGGAGG + Intergenic
1034952992 7:155313543-155313565 CAGAATGAGGAGAAAAGGGGAGG - Intergenic
1034981397 7:155479990-155480012 CAAAAAAAAAAAAAAGTGGGGGG + Intronic
1035070413 7:156140568-156140590 CAGAGAGAGGAGAAAGAGGCAGG + Intergenic
1036394451 8:8356739-8356761 TAGAAAAAGAACAAAGTTGGAGG + Intronic
1036448446 8:8843648-8843670 GAGAAAAAGAAGAAAGTGAAAGG + Intronic
1036527756 8:9551081-9551103 AAGTAAAAGGAGATAGTGGGTGG + Intergenic
1036623346 8:10443847-10443869 GAGAAAAAGGAGGAACAGGGTGG + Intergenic
1036987982 8:13557930-13557952 AAGAACAAGGAGAAGGTTGGAGG + Intergenic
1037240225 8:16768959-16768981 TTGAAAAAGAAGAAAGTTGGAGG - Intergenic
1037440356 8:18909947-18909969 CAGCGAAAGGAAAAAGTGGCAGG + Intronic
1037501925 8:19494866-19494888 CAGTAAAAACAGAAAATGGGCGG + Intronic
1037638545 8:20722163-20722185 GAGACAAAGCAGAAAGCGGGAGG + Intergenic
1037658911 8:20910621-20910643 AAGAAAACGGAGACAGTGAGTGG + Intergenic
1037946106 8:22990604-22990626 CAGAAGGAGGAGGAAGAGGGTGG + Intronic
1038310545 8:26443118-26443140 CACTGAAAGGAGAAAGGGGGAGG + Intronic
1038908869 8:31938571-31938593 CAGAAAAAAGAAAAATTGGAAGG + Intronic
1039161299 8:34624760-34624782 CAAAAACAGGAGCAAGAGGGTGG + Intergenic
1039680811 8:39733925-39733947 CTGAAAAAGAACAAAGTTGGAGG + Intergenic
1039827001 8:41183149-41183171 CAGAAAAAGCAGAAGATGAGTGG - Intergenic
1040279398 8:46030991-46031013 GAGAAAAAGGAAAAAGAAGGGGG + Intergenic
1040435465 8:47386848-47386870 GAAAATAAGGAGGAAGTGGGGGG + Intronic
1040641893 8:49344799-49344821 TATAAAAAAGAGAAAGGGGGTGG - Intergenic
1040793634 8:51264726-51264748 TTGAAGAAGGACAAAGTGGGAGG - Intergenic
1040944338 8:52867502-52867524 GAGAAAAAGAATAAAGTAGGAGG - Intergenic
1041503236 8:58562396-58562418 TCGAAAAAGAACAAAGTGGGAGG + Intronic
1041549454 8:59083173-59083195 AGGAAAAAAGAGAAAGTGGAAGG + Intronic
1041552119 8:59114722-59114744 AAGAAAAAGGAAAAGATGGGAGG - Intronic
1041886708 8:62817431-62817453 CAGAAGAAGGTGAATCTGGGAGG - Intronic
1042171838 8:65999198-65999220 TAGAATAAGGAGAAAGTGGGAGG - Intergenic
1042328121 8:67549459-67549481 CACAAAAAGAAGAGTGTGGGAGG - Intronic
1042552200 8:70004092-70004114 GAGAAAAGGGAGAAAGTGGTAGG + Intergenic
1042972055 8:74420094-74420116 CAGAAAAAGAACAAAGTTGGAGG - Intronic
1042996432 8:74704527-74704549 AAGAAAAAGGGGAAAGTCTGAGG - Intronic
1043114623 8:76234827-76234849 TCAAAAAAGGAGAAAGTGGGAGG - Intergenic
1043796672 8:84550234-84550256 AAGGAAAAGGAGAAAGTGGAGGG - Intronic
1043916930 8:85933747-85933769 CAGCAAATGAAGAAAGTGTGAGG - Intergenic
1044855369 8:96469907-96469929 CAGAAAAAATAGAAAGGTGGTGG - Intergenic
1045616698 8:103921897-103921919 TAAAAGAATGAGAAAGTGGGAGG - Intronic
1045873239 8:106949559-106949581 CAGAAAAAGAACAAAGTGTCTGG + Intergenic
1045982426 8:108206343-108206365 AAGAAAAAAGAAAAAGTGGAAGG + Intronic
1046599594 8:116300672-116300694 GTGAAAAAGGAGATAGTTGGAGG - Intergenic
1046885681 8:119364408-119364430 CTGAGAAAGGGGAAAGGGGGAGG - Intergenic
1046966832 8:120176863-120176885 AATAAGGAGGAGAAAGTGGGAGG - Intronic
1047706855 8:127507775-127507797 GAGAAAAAAGAGAAAGTAAGAGG + Intergenic
1048221769 8:132548833-132548855 CAGAAAAGGGTGAAAGTAAGAGG - Intergenic
1048331424 8:133473376-133473398 CAGGTAAAGGAGAAACTTGGGGG - Intronic
1048385153 8:133905219-133905241 TAGAAAAAGGATAGTGTGGGAGG + Intergenic
1048403759 8:134097269-134097291 AAGAAAAAGGAGAAATAGGGAGG + Intergenic
1048897772 8:139008903-139008925 AAGAAAAAGAACAAAGTTGGAGG + Intergenic
1049176087 8:141193532-141193554 CCGAAAAGGGAGAAATTGGAAGG + Intronic
1049328461 8:142037320-142037342 CAGAAAAAGAAGAAAGGAAGAGG + Intergenic
1050061826 9:1717425-1717447 CAAAGAAAGGAGAAAATGGTGGG + Intergenic
1050081252 9:1918156-1918178 CTGAAAAAGGAGACCTTGGGTGG + Intergenic
1050099191 9:2100113-2100135 CAGAAAAGGGAGACAGCCGGTGG + Intronic
1050141157 9:2517117-2517139 AAGCAAAAGGACAAAGTTGGAGG - Intergenic
1050210195 9:3245372-3245394 CAGAAAGAGTAGGAAGTGGGAGG + Intronic
1050266062 9:3891080-3891102 AAGAAGAAGAAGAAAGTAGGAGG + Intronic
1050327618 9:4512575-4512597 ATGAAAAAGAAGAAAGTTGGAGG + Intronic
1050481089 9:6087417-6087439 GAGAAAAAGGAAAAAGGGGTGGG - Intergenic
1050681012 9:8111472-8111494 TTGAAAAAGGAAGAAGTGGGTGG - Intergenic
1050831170 9:10015710-10015732 CAGAAAGAAGAGAAAGAGGTGGG + Intronic
1050833687 9:10048889-10048911 CAGAAAGAGCAGAAAGGTGGTGG + Intronic
1050995974 9:12218103-12218125 GAGAAATATGAGGAAGTGGGGGG - Intergenic
1051056338 9:12991616-12991638 CAGAAAAAGGGGATAGTAGGTGG + Intergenic
1051155090 9:14133994-14134016 AAGAAAATGGAGAAATTGAGAGG - Intronic
1051173582 9:14343295-14343317 GAGAAAAATGAGAAAGTAGGGGG - Intronic
1051216452 9:14803195-14803217 AAGAGAAAGAAGAAAGAGGGAGG - Intronic
1051338618 9:16090959-16090981 AAGAAAATGAAGAAAGAGGGTGG - Intergenic
1051409848 9:16778100-16778122 CAGAAAATAGAGAAAAGGGGAGG - Intronic
1051548535 9:18303902-18303924 CAGAGAAAGGAGGAAGTGAAAGG - Intergenic
1051647692 9:19285992-19286014 TGGAAAAAGAAGAAAGTTGGAGG - Intronic
1051888880 9:21923562-21923584 CTGCTATAGGAGAAAGTGGGAGG - Intronic
1051917607 9:22226478-22226500 TAGAAAAAAGAAAAAGGGGGAGG - Intergenic
1052036826 9:23692144-23692166 CAGAAAAAGGAAAAAAAGGGGGG + Exonic
1052138701 9:24949456-24949478 CAGTACATGCAGAAAGTGGGAGG + Intergenic
1052190437 9:25655332-25655354 CAGAAAGAGGATCAAGTAGGTGG - Intergenic
1052201282 9:25784261-25784283 AAGAAAATGCAGAAAGTGGAGGG - Intergenic
1052251939 9:26408777-26408799 CAGACAAAGGAGAGAGTTAGAGG + Intergenic
1052443369 9:28527277-28527299 CAGAAACAGAAGAAAATGGGAGG - Intronic
1052560166 9:30075328-30075350 CAGAAAAAGGAAAAGGGGAGGGG - Intergenic
1052565768 9:30148864-30148886 CAGATAAAAGAAAAATTGGGTGG + Intergenic
1053205077 9:36179326-36179348 AAGAGAAAGAACAAAGTGGGAGG + Intergenic
1053429128 9:38030395-38030417 TAGAGAAAGCAGCAAGTGGGAGG - Intronic
1053836457 9:42141419-42141441 CAGAAACAGGAGAAAGAAGGAGG + Intergenic
1054726475 9:68656902-68656924 AAGAAAGAGGAGAAAATGGAGGG + Intergenic
1055002584 9:71469541-71469563 AAGAAAAAGAATAAAGTTGGAGG - Intergenic
1055502413 9:76914887-76914909 CAGAAACAGAAGAAATTGGGTGG - Intergenic
1056008458 9:82300355-82300377 CACAAAAAGGAGAAAGAGAAAGG - Intergenic
1056215515 9:84402688-84402710 CAGAATAGGGACAAAGTGGCAGG - Intergenic
1056519415 9:87386261-87386283 TGGAAACAGGAGAAAGTTGGTGG - Intergenic
1056657614 9:88522196-88522218 GAGAAAAAGAAGAAAATGAGAGG - Intergenic
1057021146 9:91698642-91698664 GAGAAAAAGGAGCAGGTGGAAGG - Intronic
1057056371 9:91964465-91964487 CAGAAAAAGCAGAATGGAGGTGG - Intergenic
1057500251 9:95591451-95591473 CTGAAAAAGAACAAAGTTGGAGG + Intergenic
1057641822 9:96831102-96831124 GAGAAAAGGGAGAAAGGGAGGGG + Intronic
1058485490 9:105439737-105439759 AGGAAAAGGGAAAAAGTGGGTGG - Intergenic
1058944258 9:109841765-109841787 GAGAGAAAGGAGAGGGTGGGGGG + Intronic
1059268448 9:113057489-113057511 AAGAAAAAAGAAAAGGTGGGAGG + Intergenic
1059397381 9:114045654-114045676 TAGAAAAAGGACAACGTTGGAGG - Intronic
1059468624 9:114486203-114486225 CTTAAAAAGAAGAAAGTTGGGGG - Intronic
1059692101 9:116695595-116695617 CAGGAGAAGGAGGAAGTGGAGGG - Intronic
1059712767 9:116884812-116884834 CAAAAAAAAAAAAAAGTGGGTGG - Intronic
1060561446 9:124548126-124548148 CAGAAAGAAGAGCAAGGGGGAGG + Intronic
1060738053 9:126079195-126079217 CAGAAAAATGGGAAAGGGGTTGG + Intergenic
1060765228 9:126290688-126290710 CAGAAAAATAATAAAGGGGGTGG + Intergenic
1060853191 9:126894559-126894581 CCGAAAAAGGCCAAAGTGGATGG + Intergenic
1061309517 9:129753069-129753091 CAGGGAAAGCACAAAGTGGGAGG + Intergenic
1061541617 9:131280532-131280554 CTGAAAAATGAGAAAGAGGAGGG + Intergenic
1061748770 9:132759853-132759875 CCGAAGAAAGACAAAGTGGGAGG - Intronic
1062527890 9:136985616-136985638 CAAAACAAGGAGCAGGTGGGCGG - Exonic
1062700105 9:137895279-137895301 AAGAAAAAGAATAAATTGGGAGG - Intronic
1203491355 Un_GL000224v1:108419-108441 CTGGAGCAGGAGAAAGTGGGTGG + Intergenic
1203503979 Un_KI270741v1:50289-50311 CTGGAGCAGGAGAAAGTGGGTGG + Intergenic
1185502511 X:608476-608498 AAGAAAAAGGAGAGAGGGAGGGG - Intergenic
1185603480 X:1354577-1354599 AAGAAAACGGAGAAAGAGGAGGG + Intronic
1185603490 X:1354616-1354638 GAGAAAATGGAGAAAGAGGAGGG + Intronic
1185611105 X:1394206-1394228 AAGAAAAAGGAAAAGGAGGGAGG - Intergenic
1185617549 X:1432531-1432553 AAGAAAAGGGAGAAAGGGGCCGG + Intronic
1185952363 X:4451341-4451363 CAGAAAAAGGATCATCTGGGGGG + Intergenic
1186459946 X:9740034-9740056 CAGGAGAAGGAGAAAGTGGGAGG + Intronic
1186615567 X:11183623-11183645 AGGAAAAAGGAGACAGAGGGAGG - Intronic
1187072872 X:15905660-15905682 CAGATAAAGGAGAAAAAGGCTGG - Intergenic
1187097726 X:16165112-16165134 GAGAGAAAGGAGAGAGGGGGTGG - Intergenic
1187211414 X:17236108-17236130 AAGAAAAAGAAGAAAGGAGGAGG - Intergenic
1187416138 X:19094900-19094922 AAAAAGAAGGAGAAAGTGGACGG - Intronic
1188036461 X:25322941-25322963 GAGAAAAAGGAGAAAGAGGAAGG - Intergenic
1188101840 X:26097492-26097514 CATAAAAAGTAGAAAGGGGTGGG + Intergenic
1188330786 X:28868652-28868674 TAGAAAATGGTGCAAGTGGGCGG - Intronic
1188451386 X:30310729-30310751 CAGCAAAAAAAGAAAGAGGGAGG - Intergenic
1188468705 X:30512443-30512465 CAGAAAGAGAAGAAAGAGTGGGG + Intergenic
1188609611 X:32079631-32079653 AAGAAAAAAAAGAAAGAGGGAGG + Intronic
1188627249 X:32299896-32299918 CACAAAAAGCAGAAACTAGGAGG - Intronic
1188640308 X:32493105-32493127 TTTAAAAAGGATAAAGTGGGAGG - Intronic
1189136113 X:38551930-38551952 CAGCAAAAGGAGATAGGGGTGGG - Intronic
1189551621 X:42099417-42099439 GAGAAGAAGGAGAAAGGAGGAGG - Intergenic
1189989975 X:46585241-46585263 GAAAAAAAAGAGAAAGTGGGAGG - Intronic
1190713586 X:53086558-53086580 CAGAGATAGGAGACAGTGGGTGG + Intronic
1190856306 X:54298073-54298095 AAAAAAAAGGAGAAAATGAGAGG + Intronic
1191105773 X:56771218-56771240 CAGAAGAACAAGAAAGAGGGAGG - Intergenic
1191106766 X:56776620-56776642 CAGAAGAACAAGAAAGAGGGAGG - Intergenic
1191666977 X:63713535-63713557 CAGATAAAGGAGAGATTGGAGGG + Intronic
1192006155 X:67215167-67215189 TAGCAAAAAGAGAAAATGGGTGG + Intergenic
1192095861 X:68209978-68210000 AAAAAAAAGGAGAAACTGAGAGG - Intronic
1192607419 X:72533297-72533319 CTGAAAAAGAATAAAGTTGGAGG - Intronic
1192613330 X:72590127-72590149 AAGAAAAAGAAGAAAGCTGGAGG + Intronic
1192741773 X:73900300-73900322 AAAAAAAAGGGGAGAGTGGGAGG + Intergenic
1193940556 X:87676753-87676775 AGGAAAAAGGAGAAAAAGGGGGG + Intergenic
1193944268 X:87713034-87713056 CACAAAAAGAATAAAGTTGGAGG + Intergenic
1194105440 X:89761714-89761736 CATAAAAAGGAAAAATTGGAAGG + Intergenic
1194122428 X:89976983-89977005 GAGAAAAAGGAAAAAGTAGGTGG - Intergenic
1194218584 X:91164393-91164415 CAAAAAAACTAAAAAGTGGGTGG - Intergenic
1194403307 X:93463790-93463812 GCCAAAAAGGAGAAAGAGGGAGG + Intergenic
1194585217 X:95724522-95724544 CAGAACAAGAAGAAATTGAGAGG - Intergenic
1194700985 X:97113074-97113096 CACTAAAAGGAAAAAGTGGCCGG - Intronic
1194766880 X:97851982-97852004 CAGTTAAAGGTGAAAATGGGTGG + Intergenic
1194849868 X:98857231-98857253 AGGCTAAAGGAGAAAGTGGGAGG - Intergenic
1194917306 X:99722141-99722163 CTGGAAAAGGGCAAAGTGGGAGG + Intergenic
1194941989 X:100021841-100021863 CAAAAAAGGTAAAAAGTGGGGGG + Intergenic
1195313495 X:103656144-103656166 CAAAAAAAAGAAAAAGTGTGTGG + Intergenic
1195584344 X:106547399-106547421 TTGAAAAAGAATAAAGTGGGAGG - Intergenic
1195789650 X:108569526-108569548 AAGGAAAAGGAGAAAGGGGAGGG - Intronic
1195797476 X:108666702-108666724 TAGGAAAAGGGGAAAGTGTGTGG - Intronic
1195832971 X:109080516-109080538 TAAAACAAGGAGAAAGTGGAAGG - Intergenic
1196040077 X:111193299-111193321 CAGAAGAAGGAAAAACTGGGAGG + Intronic
1196141545 X:112268169-112268191 AAGAAAAAGAAGAGAGTGGTTGG - Intergenic
1196318588 X:114260742-114260764 CAGAAGATGGAGAGAGTGGATGG - Intergenic
1196431568 X:115632743-115632765 AAGAAAAAAAAAAAAGTGGGGGG - Intronic
1196600301 X:117594050-117594072 GAGAAAAAGAACAAAGAGGGAGG + Intergenic
1196820605 X:119697428-119697450 AAGAAAGAGAAGAAAGTTGGAGG + Intergenic
1197418207 X:126203004-126203026 AACAAAAAGGAAAATGTGGGAGG + Intergenic
1197433305 X:126393528-126393550 CAGAAGAAGGAGGAAGGAGGAGG + Intergenic
1197515034 X:127416800-127416822 CTGAAAATGAGGAAAGTGGGAGG - Intergenic
1197520492 X:127490947-127490969 CAGGAGCAGGAGGAAGTGGGGGG + Intergenic
1197551774 X:127900762-127900784 AAGAAATGGGAGAAAGTGAGAGG - Intergenic
1197846941 X:130813432-130813454 AAGAAAATGAAGAAAGGGGGTGG + Intronic
1197856798 X:130921751-130921773 GAGAAAAAGGAGGAAGAGGAAGG - Intergenic
1198003213 X:132462223-132462245 GAGAAACAGGAGAGAGAGGGAGG - Intronic
1198117227 X:133555912-133555934 CTGAAAAAGGGGAACCTGGGAGG - Intronic
1198388336 X:136148333-136148355 CAGAATAAGGAGGGAGGGGGAGG + Intronic
1198692091 X:139295438-139295460 CAGCAAAAGGGGAGAATGGGAGG - Intergenic
1199288360 X:146078536-146078558 TAGAGAAAGGAGAAAGAAGGTGG + Intergenic
1199423769 X:147677127-147677149 CAGAAACGGGAGAGAGTGGAAGG - Intergenic
1199743100 X:150754261-150754283 CTGAAAAAGAACAAAGTAGGAGG - Intronic
1199992579 X:152995865-152995887 CAGAAAAAAGAGAGAGAGAGAGG - Intergenic
1200457405 Y:3409531-3409553 CATAAAAAGGAAAAATTGGAAGG + Intergenic
1200475289 Y:3634422-3634444 GAGAAAAAGGAAAAAGTAGGTGG - Intergenic
1200555096 Y:4628150-4628172 CAAAAAAACTAAAAAGTGGGTGG - Intergenic
1200686456 Y:6263948-6263970 CAGATCAAGGAGAAAGAGGATGG + Intergenic
1201454013 Y:14148437-14148459 GAGAAAAAGGAGAAAGGGGTTGG - Intergenic
1201553539 Y:15244275-15244297 GAAAAAAAAGAGAAAGAGGGTGG + Intergenic
1201741150 Y:17325709-17325731 GAGAAAGAGGAGAAAGAGAGAGG + Intergenic
1202118398 Y:21498083-21498105 GAGGAAAAGGAGAAAATGGGAGG - Intergenic
1202120850 Y:21521623-21521645 GAGGAAAAGGAGAAAATGGGAGG - Intronic
1202123301 Y:21545164-21545186 GAGGAAAAGGAGAAAATGGGAGG - Intronic
1202155705 Y:21884217-21884239 GAGGAAAAGGAGAAAATGGGAGG + Intronic
1202158153 Y:21907758-21907780 GAGGAAAAGGAGAAAATGGGAGG + Intronic
1202184606 Y:22172683-22172705 GAGGAAAAGGAGAAAACGGGAGG + Intronic
1202206754 Y:22413718-22413740 GAGGAAAAGGAGAAAACGGGAGG - Intronic
1202594133 Y:26519504-26519526 CAGGAGAAGGAGAAAGATGGGGG - Intergenic