ID: 914866345

View in Genome Browser
Species Human (GRCh38)
Location 1:151433024-151433046
Sequence TAGTCATTATTTTAACTGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 319
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 293}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914866344_914866345 30 Left 914866344 1:151432971-151432993 CCTTTTGAAATTTATGGTTGAAA 0: 1
1: 0
2: 3
3: 44
4: 630
Right 914866345 1:151433024-151433046 TAGTCATTATTTTAACTGCTAGG 0: 1
1: 0
2: 0
3: 25
4: 293

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914866345 Original CRISPR TAGTCATTATTTTAACTGCT AGG Intronic
901398117 1:8996687-8996709 TAGTCAGTATTTTAAATTTTAGG + Intergenic
901502170 1:9659307-9659329 TATTTTTTATTTTAAGTGCTGGG - Intronic
901706980 1:11081401-11081423 AAACCATTATTTTAACAGCTGGG + Intronic
905516139 1:38563386-38563408 TAGTCACTTTTTCATCTGCTGGG + Intergenic
906158168 1:43626478-43626500 TAGTCATTATCCTAGGTGCTTGG + Intergenic
907856020 1:58304254-58304276 TGGTCATGGTTTTACCTGCTGGG + Intronic
908187406 1:61665701-61665723 TATTCATTATTTTAAAAGGTGGG - Intergenic
908471354 1:64447073-64447095 TAGTCCTTATTTTAGCAACTAGG - Intergenic
908497345 1:64707835-64707857 TAGTCAGTCTTTTAACGGATTGG - Intergenic
909129865 1:71721405-71721427 TAGTCATTACTTTAAAAGCTGGG + Intronic
909301785 1:74021895-74021917 TATTCATTATTTTCCATGCTGGG - Intergenic
910042546 1:82870639-82870661 TAGGAGTTATGTTAACTGCTTGG + Intergenic
910182443 1:84500352-84500374 TAGACATTATTTTACCTTCTGGG + Intronic
911543607 1:99188537-99188559 AGTTCATTTTTTTAACTGCTAGG + Intergenic
912231668 1:107800206-107800228 TAGTCAGTAATATAAGTGCTAGG + Intronic
913016589 1:114742755-114742777 TAGTCTTGATCTTAACTGTTTGG - Intronic
914866345 1:151433024-151433046 TAGTCATTATTTTAACTGCTAGG + Intronic
915389233 1:155526164-155526186 TATTCATTGTTTCAGCTGCTGGG - Intronic
916989805 1:170230804-170230826 TGGTTATTACTTTAACTACTAGG + Intergenic
917000760 1:170355796-170355818 TAGTCAGTTTTTTAGCTACTTGG + Intergenic
918628945 1:186692316-186692338 TAGTCATTTTTCTAGGTGCTTGG - Intergenic
919279700 1:195472985-195473007 TAATCAATATTTTATATGCTGGG - Intergenic
919674573 1:200368460-200368482 TAGAAATAATTTTAAGTGCTTGG + Intergenic
1063018084 10:2098073-2098095 TATTCAAGATTTTAACTGATAGG + Intergenic
1063732606 10:8716047-8716069 TAGTTCTTTTTTTAAATGCTTGG + Intergenic
1064954858 10:20896570-20896592 TAGTCATTTTTTTAACATTTTGG - Intronic
1065577027 10:27131329-27131351 TAGGCCCTATTTTAGCTGCTGGG - Intronic
1065583026 10:27190702-27190724 GAGTCATTCTTTTAACTGTGTGG + Intergenic
1066215924 10:33287520-33287542 TTGTCATTATTTTAGAAGCTTGG + Intronic
1068242476 10:54321325-54321347 CAATCATTATTTTAAATGGTGGG - Intronic
1068486103 10:57660927-57660949 TAGTGATTCTTTTAACTGTTAGG - Intergenic
1069212985 10:65784955-65784977 TATGCATCATTTTAATTGCTTGG - Intergenic
1069314750 10:67083308-67083330 TAATCATTATATTGATTGCTTGG - Intronic
1071782717 10:88864235-88864257 TAGTCAGGATATTAAATGCTAGG + Intergenic
1071967006 10:90861759-90861781 CAGTAATTTTTTTAAATGCTAGG - Intergenic
1074116709 10:110461608-110461630 TAATGGTTATTTTAACTGCTGGG + Intergenic
1075088248 10:119428427-119428449 ATGTCATTATTTGAACTCCTAGG - Intronic
1077318224 11:1928630-1928652 TAGTCATTCCATGAACTGCTGGG + Intronic
1077984713 11:7340488-7340510 TGGGTATTCTTTTAACTGCTGGG + Intronic
1078039871 11:7850347-7850369 TAGTCATTTTTTCAACAGCCAGG + Intergenic
1078911334 11:15735250-15735272 GAGGCATTATTTTGACTCCTGGG - Intergenic
1079093918 11:17498917-17498939 CAGGCATTATGTTAAGTGCTGGG - Intronic
1080280487 11:30551170-30551192 TAGTGATTATTTTTATTACTGGG - Intronic
1081024954 11:37999934-37999956 AAGTTATTATTTTAATTGCTAGG - Intergenic
1081054577 11:38393203-38393225 TATTAATTATTTTAACTTCTAGG + Intergenic
1081391735 11:42537485-42537507 TAGTCACTATTTAAACGGGTTGG + Intergenic
1081511996 11:43784337-43784359 TTATTATTATTTTAACTGCCAGG + Intronic
1081916463 11:46734440-46734462 TAGTAATTTTTTAAACTGCATGG - Intronic
1083068539 11:59951035-59951057 TAGTGATTATTATAAATGTTTGG - Intergenic
1083395377 11:62387826-62387848 GAGGCATTGTTTTAAGTGCTGGG - Intronic
1086647142 11:89237049-89237071 TGGCCATTATTTTAACAACTAGG - Intronic
1088164642 11:106918821-106918843 TATTGATTATTTGAAATGCTAGG - Intronic
1088350579 11:108882981-108883003 TAATCATTATTTGAAATGATAGG - Intronic
1088475044 11:110227433-110227455 TAATCATTATTTTAAATATTTGG - Intronic
1090941861 11:131394108-131394130 AAGTCATTATTTCAGCTGATTGG - Intronic
1091903462 12:4164492-4164514 TTGTCATCATTTTCACTGCCTGG + Intergenic
1092914689 12:13179346-13179368 TAGCAATTATTTTTTCTGCTGGG - Intergenic
1093286488 12:17269976-17269998 TAGACATTACATTCACTGCTGGG - Intergenic
1095346524 12:41156554-41156576 TTGTCTTTATTTTAAGTTCTGGG + Intergenic
1095717875 12:45368126-45368148 TATTCATTATCTGAAATGCTTGG + Intronic
1098225100 12:68313131-68313153 CAGGCATTGTTTTAAGTGCTGGG - Intronic
1099113243 12:78588511-78588533 TAGCCATTGTATTAATTGCTAGG - Intergenic
1099125175 12:78745804-78745826 TTGTCATTATTTAACCTGCCTGG + Intergenic
1101255029 12:102968223-102968245 TAGTCATTATTTCCACTGCATGG + Intergenic
1101291656 12:103376554-103376576 TAATTATTATTTTAAGTTCTGGG - Intronic
1101976850 12:109367035-109367057 TATCCCTTATTTGAACTGCTTGG - Intronic
1104986412 12:132600146-132600168 ATGTCATTATTTTAGCTGCTGGG - Intergenic
1106164914 13:27235666-27235688 TAGAGATTATTTAAACTGTTAGG + Intergenic
1106592071 13:31106422-31106444 TTATCTTTATTTTACCTGCTGGG - Intergenic
1106715179 13:32381206-32381228 TAGACAGTGTTTTAAGTGCTGGG + Intronic
1109060332 13:57609814-57609836 AATTCATCATTTTAACTGATAGG + Intergenic
1109549577 13:63875567-63875589 TGTACATTTTTTTAACTGCTGGG + Intergenic
1109769410 13:66951540-66951562 GAATGATTATTTTAAATGCTGGG + Intronic
1111208492 13:85044285-85044307 TAGTGAATATTTTGACTGATTGG + Intergenic
1111525185 13:89459195-89459217 TATGGATTATTTTAACTGTTAGG - Intergenic
1111726451 13:92015812-92015834 TATTCATTCATTTATCTGCTTGG - Intronic
1111761206 13:92467692-92467714 GAGTCGTATTTTTAACTGCTGGG + Intronic
1114685166 14:24522390-24522412 TAATCATTCTTTAAACTGATGGG - Intergenic
1114776307 14:25486186-25486208 TAGTCATTATTACAACTGTATGG - Intergenic
1115163066 14:30417362-30417384 TAGTCATTATTTGAATAACTTGG + Intergenic
1118650111 14:67882357-67882379 TCCTCATCATTTTAACTTCTAGG + Intronic
1119082511 14:71709095-71709117 TAGTCATTATTGGAACTTTTAGG + Intronic
1120335044 14:83144012-83144034 TACTCTTTATTTTAAATGGTTGG + Intergenic
1120632570 14:86908805-86908827 TATTTATTATTTTAAATACTTGG - Intronic
1123399545 15:19970802-19970824 TAGTCATTTTTTTAAGTGTAGGG + Intergenic
1123509345 15:20980841-20980863 TAGACATTATTTAAACTACATGG + Intergenic
1123566569 15:21554581-21554603 TAGACATTATTTAAACTACATGG + Intergenic
1123602830 15:21991874-21991896 TAGACATTATTTAAACTACATGG + Intergenic
1125277466 15:38008362-38008384 TTGTCAATATTTTAGCTGCAGGG + Intergenic
1125391765 15:39200116-39200138 CAGTTATTATTTTCACTGGTGGG - Intergenic
1126450460 15:48802972-48802994 TAGTCCTGATTTTCACTGCCTGG - Intronic
1127402944 15:58609379-58609401 TAAACATCATTTTAAATGCTGGG + Intronic
1130739731 15:86586302-86586324 TTGCCATTAGTTTACCTGCTTGG + Intronic
1132283209 15:100638684-100638706 TAATTATTATTTTAAGTTCTGGG + Intronic
1202974932 15_KI270727v1_random:281676-281698 TAGACATTATTTAAACTACATGG + Intergenic
1134390113 16:13811846-13811868 TTATCATTATTTTAAATGATAGG - Intergenic
1134471562 16:14530830-14530852 TAGTCATTATTCTACATCCTTGG - Intronic
1134674464 16:16079709-16079731 TGGGCACTATTTTAAGTGCTGGG - Intronic
1138037412 16:53623071-53623093 CAGACATTGTTTTAACTGTTGGG + Intronic
1138754193 16:59462864-59462886 TAGTCTTTATTTTAATAACTTGG + Intergenic
1138787573 16:59865217-59865239 TAATCATCAGTTTAAATGCTTGG - Intergenic
1138999415 16:62491245-62491267 AAGTCATTTTTTTAAATTCTAGG - Intergenic
1141000776 16:80305764-80305786 AAGTTATTATTTTATCTACTGGG + Intergenic
1144083586 17:11786557-11786579 TAATCAGTATTTTACCTTCTAGG - Intronic
1144252665 17:13435340-13435362 TAGTCTTTATTACAACTACTCGG + Intergenic
1144287881 17:13796138-13796160 GAGTAATGATTTTAAGTGCTGGG - Intergenic
1146131949 17:30285310-30285332 TAATCATTACTTTAACAGATGGG + Intronic
1146531971 17:33615605-33615627 TAGTTTTAATTTTAACTTCTGGG + Intronic
1146777684 17:35636146-35636168 TATTTATTATTTGAACTGATAGG - Intronic
1148251970 17:46089702-46089724 TAGTAATCACTTTAAGTGCTTGG - Intronic
1149529852 17:57386504-57386526 TAGGCATTCTTTTAGGTGCTAGG + Intronic
1150466421 17:65396668-65396690 TATTTATTATTTTAAGTTCTGGG - Intergenic
1150960120 17:69903498-69903520 TAGTCATTTTTTTAACTCTTTGG - Intergenic
1151011453 17:70502683-70502705 TATTCTTACTTTTAACTGCTTGG + Intergenic
1154073935 18:11180385-11180407 AAGTCATTATTATGAATGCTGGG + Intergenic
1156415450 18:36883675-36883697 TAGCCCTTATCTAAACTGCTTGG - Intronic
1157497305 18:48165502-48165524 TAGTCCTTGTTGTAACTGCTGGG + Exonic
1157760724 18:50263075-50263097 TAGGCATTATGTTCAATGCTAGG - Intronic
1158275520 18:55762926-55762948 TAATAATTATTTTAAAAGCTTGG + Intergenic
1158569781 18:58588416-58588438 TAATTTTTATTTTAACTTCTGGG + Intronic
1158755667 18:60321281-60321303 CAGTCATTGTTCTAGCTGCTGGG - Intergenic
1159801865 18:72910070-72910092 TATTCCTTATTTGAATTGCTTGG - Intergenic
1162179443 19:8857689-8857711 TAGTCACTATTTGATCTGTTTGG + Intronic
1166073914 19:40402859-40402881 CAGACATTATCTTAGCTGCTTGG - Intronic
1166698855 19:44870280-44870302 GAGTCACTATTCTAACAGCTTGG + Intronic
1167243569 19:48359964-48359986 TGGCCCTTATTTTAAGTGCTGGG - Intronic
1168397479 19:56061250-56061272 TAGTCATTGGTTTAACTCTTTGG + Intronic
929343271 2:40849156-40849178 TACTTATTATTTTCACTGCCTGG + Intergenic
930009150 2:46922432-46922454 TAGTTATTTTTTTAACTTGTGGG + Intronic
931872402 2:66475578-66475600 CAGTCTTTGTTTTAGCTGCTAGG - Intronic
931954515 2:67405558-67405580 CAGTCATTGTATTAAGTGCTGGG - Intronic
933127547 2:78628537-78628559 TTGTGATCATTTTAACAGCTAGG - Intergenic
933384780 2:81596532-81596554 TAGACATCATTTTGGCTGCTTGG - Intergenic
935984156 2:108656108-108656130 TAACCAATATTTTGACTGCTTGG + Intronic
936136592 2:109899762-109899784 TAACCAATATTTTGACTGCTTGG + Intergenic
936208105 2:110471723-110471745 TAACCAATATTTTGACTGCTTGG - Intronic
937179615 2:119980306-119980328 AAATGATTATTTTAACTTCTGGG + Exonic
937541271 2:122957049-122957071 TGGTCATTATATTACCTGCTGGG - Intergenic
937691690 2:124763083-124763105 TAGTCAATATTTTATTTGCATGG + Intronic
937714838 2:125020470-125020492 TGGTAATTATTTTATCTGCTAGG + Intergenic
938149784 2:128872295-128872317 TGGTCAATAATTTAACTTCTAGG + Intergenic
938212459 2:129480250-129480272 TAGAAATTATTTTAACCGATAGG - Intergenic
938887914 2:135672116-135672138 AAGGCATTTTTTTAAGTGCTTGG + Intronic
938970977 2:136432087-136432109 CAGGCATTATTTTACATGCTGGG + Intergenic
939345396 2:140959457-140959479 TAGTAATTATTTTAATTGCCAGG - Intronic
939717778 2:145606852-145606874 CAACCACTATTTTAACTGCTGGG + Intergenic
939741111 2:145907557-145907579 TAGTCATTCTTTCATTTGCTGGG - Intergenic
939961961 2:148572996-148573018 TATTCCTTATTTGAAATGCTTGG + Intergenic
940355979 2:152742155-152742177 TAGTCAGTATTTTAACATTTTGG + Intronic
940686579 2:156858310-156858332 TAGTAATTAGTTTAAATGCTAGG - Intergenic
941522917 2:166571095-166571117 TTGTCATTATTTTTTCTACTAGG - Intergenic
941609439 2:167642832-167642854 TAGCCAATGTTTTAAGTGCTGGG - Intergenic
941757996 2:169208957-169208979 TAGTAATTTTTTTAAATGCCTGG - Intronic
942110855 2:172681563-172681585 CAGACATTATTCTAAGTGCTGGG + Intergenic
942590640 2:177542864-177542886 TAGCCATTATTTTAAATGAGTGG + Exonic
942822241 2:180127803-180127825 TACTCCTTATTTGAAATGCTTGG + Intergenic
943185345 2:184599170-184599192 TACTCATTTTTTTATCTGGTGGG + Intronic
943415760 2:187601545-187601567 TATTGATTAATTTAATTGCTTGG - Intergenic
944850565 2:203714937-203714959 CAGTAATTATTTAAACTTCTGGG + Intronic
945937465 2:215917495-215917517 TAGGCATTGTTTTATTTGCTGGG + Intergenic
947758533 2:232586997-232587019 AAGTCATTATTTTGATTGTTGGG + Intergenic
949054671 2:241921419-241921441 TTTTCATTATTTTAAGTTCTGGG - Intergenic
1169267475 20:4175338-4175360 ATCTCATTATTTTAACTTCTGGG + Intronic
1170278333 20:14618135-14618157 CAGGCATTATTTTAGCTGCTTGG - Intronic
1171836191 20:30151314-30151336 AAGTGAATATTTTGACTGCTTGG + Intergenic
1173987646 20:47274903-47274925 TCCTCATTATTTTAACTCTTGGG + Intronic
1174890613 20:54388125-54388147 TAGTTATTATTTTTAATGATGGG + Intergenic
1176962582 21:15175855-15175877 TAGTCATGATTTTAACCATTAGG - Intergenic
1177465154 21:21468221-21468243 AAGTCATTATCTTTACTGGTAGG + Intronic
1177678919 21:24338772-24338794 TATTAACTATTTTAACTGGTGGG - Intergenic
1177898950 21:26889846-26889868 TAATCATTATTTTATTTTCTAGG - Intergenic
1178465083 21:32840685-32840707 TAGTCATTATTTTAGCTGAGCGG + Intergenic
1183089674 22:35513082-35513104 CTGTCATTAATTTAACAGCTAGG + Intergenic
949123599 3:418351-418373 TAGACACTATGTTCACTGCTTGG + Intergenic
949812923 3:8026710-8026732 TTGTCATTATTTGAACTGTCTGG - Intergenic
951702134 3:25507364-25507386 CAGTCATTCGTTTATCTGCTAGG + Intronic
951856807 3:27206265-27206287 TAGTCACTCTTCTACCTGCTTGG + Intronic
952053741 3:29418161-29418183 AAGTCATTATTTGACCTGCTGGG + Intronic
954529653 3:51308005-51308027 TTGTTATTATTTGACCTGCTTGG - Intronic
955310547 3:57882206-57882228 CAGGCATTATTTTAACTGTTGGG + Intronic
956139947 3:66136315-66136337 TAGTCATGATTTTACCTTTTTGG + Intronic
957012193 3:75019981-75020003 AGGTCATTATTTTTACTGCATGG + Intergenic
957105847 3:75885729-75885751 TAGTCCTTCTTTTAGTTGCTTGG - Intergenic
957128443 3:76193143-76193165 TAACCAGTATTTTAACTGATGGG - Intronic
958563023 3:95772879-95772901 TAGGCATTATGTTCACTTCTTGG - Intergenic
961250650 3:125502023-125502045 TATTGATTACTTTTACTGCTAGG - Intronic
961591873 3:127987262-127987284 TAGTGCTTATTTTAAGTTCTTGG + Exonic
963618820 3:147578113-147578135 GAGTCATTATCTTAACCTCTAGG - Intergenic
963705497 3:148682314-148682336 TAGTATTGATGTTAACTGCTTGG - Intergenic
964353295 3:155824290-155824312 TAGTCATTCTTTCAATTACTTGG + Exonic
964634257 3:158843229-158843251 TAGGCAGCATTTGAACTGCTTGG + Intergenic
964871435 3:161317726-161317748 CAGACATTATTCTAAATGCTTGG + Intergenic
965133784 3:164736081-164736103 ACCTCATTATTTTAACTCCTGGG - Intergenic
966126565 3:176583827-176583849 TTGTCATTATTTGAACTGTCTGG + Intergenic
966556698 3:181269981-181270003 TAGTCATCATTTTAATTTCTAGG + Intergenic
967704353 3:192632466-192632488 TAGTTGTCATTTTACCTGCTTGG - Intronic
969646662 4:8434037-8434059 TTATTATTATTTTAACTCCTAGG - Intronic
970505467 4:16724880-16724902 TAGTCATTTAGTTAACTGATAGG + Intronic
971103225 4:23493247-23493269 GAGTCAATTTTATAACTGCTGGG + Intergenic
971371297 4:26021357-26021379 TACTCTTTCTTTTAACTTCTGGG - Intergenic
971606049 4:28659545-28659567 TATTCTTTAGTTTAGCTGCTAGG + Intergenic
972294511 4:37723840-37723862 TAGTGGATATTTTAACTGCATGG - Intergenic
974827620 4:67151288-67151310 TTTTCATTATTTTAATTGTTAGG + Intergenic
974928529 4:68332731-68332753 TAGTCATTATTTTTCCTTATTGG - Intronic
976293400 4:83445288-83445310 TAGGCACTATTTTAAGTGCTAGG - Intronic
976402303 4:84621233-84621255 TAGTTATTGTTTTAGCTCCTAGG + Intronic
977498595 4:97808905-97808927 TATTAATTATTTTAACTTCCTGG - Intronic
977587734 4:98793098-98793120 TAATCACAATTTTAAATGCTAGG - Intergenic
977814803 4:101402524-101402546 TAGTTTTTATTTTAAGTTCTGGG - Intergenic
978848376 4:113303057-113303079 TAGCCATTAATTTTAATGCTAGG - Intronic
979178946 4:117701447-117701469 TAGTCATTATTCTTTCTACTTGG - Intergenic
979522416 4:121684279-121684301 TTGTCATGATTTTAACTAATGGG - Intronic
979800831 4:124906776-124906798 TGGTCACTATTTAAATTGCTTGG + Intergenic
980402282 4:132306879-132306901 TAGGCACTATTTTAACTTTTTGG + Intergenic
980689581 4:136278034-136278056 TAGTCATTCCTTTAACTTATGGG - Intergenic
981936100 4:150241554-150241576 CAGGCATGATTTTAAGTGCTAGG + Intronic
983176789 4:164597467-164597489 TAATGAATATGTTAACTGCTTGG + Intergenic
983654742 4:170071552-170071574 TGGGCTTTATTTTAACTGCAAGG + Intronic
984073476 4:175146781-175146803 CAGTCAATTTTTTAACTTCTTGG + Intergenic
984336016 4:178391692-178391714 AATTCATAATTTTAACTACTTGG - Intergenic
985140749 4:186838549-186838571 CAGTCATTAATTTAGCTACTAGG - Intergenic
986305490 5:6511244-6511266 TAGTTATCATTTGAAGTGCTGGG + Intergenic
986683737 5:10257497-10257519 CAGACATTATTTCAAGTGCTAGG + Intronic
988613757 5:32753421-32753443 TAGTCCATATTTTAAGTGATCGG - Intronic
988715322 5:33821117-33821139 TTGTTATTATTTTAACTTTTAGG - Intronic
989171934 5:38479947-38479969 GAATCCTGATTTTAACTGCTAGG - Exonic
989421847 5:41249366-41249388 TTGTTATTATTTTAACTATTGGG - Intronic
990689856 5:58351691-58351713 TAGTCATTATGTCTACTGTTGGG + Intergenic
991480503 5:67073383-67073405 TAGTCTATATTCTAACTGCAAGG + Intronic
992279859 5:75163178-75163200 TATTCTTTATTTGAAATGCTTGG + Intronic
992729202 5:79641763-79641785 TATTCATTATCTAAAATGCTTGG + Intronic
993700220 5:91110296-91110318 TTTTCAATATTTTAACTGATAGG - Intronic
994309658 5:98253900-98253922 TATTCATTATTTTATCAGTTTGG - Intergenic
994645128 5:102458991-102459013 TAGTCAATACATTAAATGCTAGG + Intronic
994735763 5:103553772-103553794 AGGTCATTGTCTTAACTGCTGGG - Intronic
994745681 5:103675360-103675382 GAGGCATTCTCTTAACTGCTGGG - Intergenic
994804054 5:104420718-104420740 TAGTTATTATTTGTACTTCTAGG - Intergenic
995290428 5:110444919-110444941 TTGTCTTTATTTTACTTGCTGGG + Intronic
995428572 5:112050043-112050065 TGGTCATTACTTTTACTGTTTGG + Intergenic
996224492 5:120974556-120974578 TAATAATTATTTCAGCTGCTTGG - Intergenic
996390213 5:122952208-122952230 TAGCCCTTATTTGAAATGCTTGG - Intronic
998309213 5:141110393-141110415 TTGTCATTATTTGATCTGTTTGG + Intronic
998343812 5:141442490-141442512 TTGTGATTATTCTAATTGCTTGG + Intronic
999550408 5:152680292-152680314 TTGTCATTATTTGATCTGTTTGG + Intergenic
1002794226 6:457872-457894 TAGTCTTTTTTTTAAGTTCTGGG + Intergenic
1003122868 6:3332241-3332263 TTGTCATTATTTTATGAGCTTGG + Intronic
1005687571 6:28269726-28269748 TAGTCAGACTTTTAACTGCTTGG + Intronic
1006279384 6:33036572-33036594 TTGTCATTATTTTACCTGTCTGG - Intergenic
1008907128 6:56690951-56690973 TAGTCATTATATTATCTGAAGGG - Intronic
1010968198 6:82236176-82236198 TGTTCATTAATTTAATTGCTTGG + Intronic
1012415748 6:99011284-99011306 TAGTCATTATTTTAAAATTTGGG - Intergenic
1012625267 6:101397261-101397283 CAGTCATTATTATCTCTGCTAGG + Intergenic
1013601035 6:111705110-111705132 TAAGCATTATTGTAACTGCTGGG + Intronic
1015953308 6:138575390-138575412 TAGTTATCATTTTGGCTGCTTGG - Intronic
1017844979 6:158249401-158249423 TAGTAATTATTTTTAATACTGGG + Intronic
1018298311 6:162373033-162373055 TATTAATTATTTTTAGTGCTAGG - Intronic
1018729573 6:166638425-166638447 TGTTCATTTTTTTATCTGCTTGG - Intronic
1019493912 7:1327883-1327905 TTATTATTATTTTAACTCCTAGG - Intergenic
1021068872 7:16212260-16212282 TAGTCAGTATTTTAATTGGATGG - Intronic
1021086303 7:16424122-16424144 GAGTCATTATTTTGCCTACTTGG - Intergenic
1022455796 7:30557222-30557244 TACTCAATAGTTTACCTGCTCGG - Intergenic
1023172787 7:37405700-37405722 CAGTCTGTATTTTAACTGCCAGG - Intronic
1023558915 7:41451956-41451978 GAGTCATTAGTTTAACATCTAGG + Intergenic
1024120842 7:46237593-46237615 TAGTGATTATGCTAACTGCTTGG - Intergenic
1024440074 7:49406719-49406741 TAGTTTTTATAGTAACTGCTTGG + Intergenic
1024640988 7:51328297-51328319 ATGTCATTATTTTCACTGTTAGG + Intergenic
1026402914 7:70034148-70034170 TAGATATTCTTTTAACTGTTTGG + Intronic
1027543830 7:79501530-79501552 TAGTCTTTCTTTTTATTGCTGGG + Intergenic
1027583960 7:80033785-80033807 TAGTCATATTTTTCACTGGTTGG + Intergenic
1027815836 7:82969456-82969478 TAGCAATTATTTAAAATGCTAGG - Intronic
1027846947 7:83392166-83392188 AAGTGAATATTTTAACTCCTAGG - Intronic
1027987894 7:85318403-85318425 TAGTTATTATTTTTAGTTCTGGG + Intergenic
1028020455 7:85764962-85764984 TAGTCATCCTGTCAACTGCTTGG + Intergenic
1030294997 7:107915267-107915289 TAGGCAATATTTTAGCTTCTAGG - Intronic
1030655217 7:112160105-112160127 TAGTCTTTATCTGAAATGCTTGG - Intronic
1037552037 8:19984285-19984307 TAGTCATTATTTGAACAATTAGG + Intergenic
1038178569 8:25204688-25204710 TAGTCTTTCTTCTAACTTCTTGG + Intronic
1039407052 8:37322252-37322274 CAGACATTATTTTGCCTGCTGGG - Intergenic
1040795416 8:51285238-51285260 TATTCATTTTTTCAACTGATTGG - Intergenic
1040833469 8:51705401-51705423 TAGTCCTTAATTTAATTTCTTGG - Intronic
1041206109 8:55499265-55499287 TTATCATTATTTTAAATGCCTGG + Intronic
1041633936 8:60121163-60121185 TATTCATTATCTAAAATGCTGGG - Intergenic
1041978694 8:63830153-63830175 TAGTCTTTATCATTACTGCTTGG - Intergenic
1043440268 8:80270606-80270628 TAGGCATTATTTCCAATGCTGGG + Intergenic
1043798799 8:84579656-84579678 AAGTCATTATTTTAGTTACTTGG + Intronic
1044295778 8:90525580-90525602 TGGTTATTATTTTAGCTGCATGG - Intergenic
1044484357 8:92733373-92733395 TACTCCTTATTTCAACTGATTGG + Intergenic
1045635281 8:104179043-104179065 TAGACATTATCTGAACTGATGGG + Intronic
1046256429 8:111702784-111702806 TAATCATCATTTTAACTGGGTGG + Intergenic
1046300420 8:112278898-112278920 AAATCATTATTTTAAATGTTGGG - Intronic
1047137337 8:122094812-122094834 CAGTCATTATTTTTATAGCTGGG + Intergenic
1047957376 8:129985936-129985958 GACTCAGTATTTTAACAGCTGGG - Intronic
1048098235 8:131317948-131317970 TAGTCGTTATGTTACCTACTAGG + Intergenic
1049129502 8:140825377-140825399 TAGTCATTATTTTCATTTCTAGG - Intronic
1049920800 9:362346-362368 TGGCCATTATTTTAACAGATTGG - Intronic
1050629241 9:7541474-7541496 TAGTCATTCTTTTGAATGGTGGG + Intergenic
1052688846 9:31789300-31789322 CAGTCATGATTTTAGCTGGTGGG - Intergenic
1055533604 9:77213293-77213315 TAGTGATTATGATAACTCCTTGG + Exonic
1060142766 9:121224794-121224816 TATTTATTATTTTAAGTGTTTGG - Intronic
1060738329 9:126080711-126080733 TATTCACTATTTTAACTCCCAGG - Intergenic
1186688032 X:11945936-11945958 TAGCCATGATCTTAAATGCTAGG - Intergenic
1186907743 X:14130089-14130111 TAGTGATTACTTTAAGTTCTGGG + Intergenic
1189241128 X:39525535-39525557 TAGTTATTACTCTAACTTCTGGG - Intergenic
1189831103 X:44973985-44974007 TAGTCATTATTTTTTCTTTTAGG + Intronic
1191586124 X:62828528-62828550 TAGTCACTAGTGTGACTGCTTGG + Intergenic
1194069717 X:89306321-89306343 TTGTCATTATTTGACCTGTTTGG - Intergenic
1194076590 X:89401374-89401396 TAGTTATTATTATAATTACTGGG - Intergenic
1194461695 X:94177515-94177537 TAGTGATTTCTTTAAATGCTTGG - Intergenic
1194771173 X:97907886-97907908 AGGTCATTATTAGAACTGCTAGG + Intergenic
1195405371 X:104507313-104507335 AAGTCTTCATTTTAACTTCTTGG - Intergenic
1195599616 X:106730834-106730856 AAATCATTAATTAAACTGCTTGG - Intronic
1196895569 X:120332458-120332480 TAGTAATTATTTTAACTGGGGGG - Intergenic
1197604185 X:128565074-128565096 TACTCATTATTTTACCTCCCAGG - Intergenic
1198053483 X:132971230-132971252 TTGTCCTAATTTTAAGTGCTGGG + Intergenic
1198456367 X:136821657-136821679 TAGTTATTGTTCTAATTGCTGGG - Intergenic
1199264422 X:145813932-145813954 TAGTCGATTTTTTAAATGCTTGG - Intergenic
1200429231 Y:3056894-3056916 TAGTTATTATTATAATTACTGGG - Intergenic
1200723864 Y:6640462-6640484 TTGTCATTATTTGACCTGTTTGG - Intergenic
1201261956 Y:12167563-12167585 CAGTAAACATTTTAACTGCTAGG - Intergenic