ID: 914868897

View in Genome Browser
Species Human (GRCh38)
Location 1:151457627-151457649
Sequence CGGCCGGGTTTTACTTCTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 37
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 34}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914868897_914868905 14 Left 914868897 1:151457627-151457649 CCTACAGAAGTAAAACCCGGCCG 0: 1
1: 0
2: 0
3: 2
4: 34
Right 914868905 1:151457664-151457686 CGCCTGTAATCCCAGCACTTTGG 0: 121435
1: 268139
2: 223994
3: 153979
4: 220861
914868897_914868908 18 Left 914868897 1:151457627-151457649 CCTACAGAAGTAAAACCCGGCCG 0: 1
1: 0
2: 0
3: 2
4: 34
Right 914868908 1:151457668-151457690 TGTAATCCCAGCACTTTGGGAGG 0: 288135
1: 266162
2: 155564
3: 133776
4: 191789
914868897_914868906 15 Left 914868897 1:151457627-151457649 CCTACAGAAGTAAAACCCGGCCG 0: 1
1: 0
2: 0
3: 2
4: 34
Right 914868906 1:151457665-151457687 GCCTGTAATCCCAGCACTTTGGG 0: 215700
1: 270647
2: 186590
3: 142154
4: 223611
914868897_914868913 28 Left 914868897 1:151457627-151457649 CCTACAGAAGTAAAACCCGGCCG 0: 1
1: 0
2: 0
3: 2
4: 34
Right 914868913 1:151457678-151457700 GCACTTTGGGAGGCCAAGGCGGG 0: 56485
1: 171609
2: 226607
3: 184242
4: 115036
914868897_914868910 24 Left 914868897 1:151457627-151457649 CCTACAGAAGTAAAACCCGGCCG 0: 1
1: 0
2: 0
3: 2
4: 34
Right 914868910 1:151457674-151457696 CCCAGCACTTTGGGAGGCCAAGG 0: 79234
1: 201556
2: 232767
3: 156913
4: 93134
914868897_914868912 27 Left 914868897 1:151457627-151457649 CCTACAGAAGTAAAACCCGGCCG 0: 1
1: 0
2: 0
3: 2
4: 34
Right 914868912 1:151457677-151457699 AGCACTTTGGGAGGCCAAGGCGG 0: 55360
1: 145174
2: 158991
3: 100124
4: 51656

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914868897 Original CRISPR CGGCCGGGTTTTACTTCTGT AGG (reversed) Intronic
901643156 1:10703262-10703284 TGGCCCGGTTCTACTGCTGTGGG - Intronic
914868897 1:151457627-151457649 CGGCCGGGTTTTACTTCTGTAGG - Intronic
1062911384 10:1214620-1214642 CGGCCAAGTTTCAATTCTGTAGG + Intronic
1064458467 10:15510360-15510382 CGACCGGATTTAACTTCTATTGG - Intergenic
1071953141 10:90727866-90727888 CAGCTGGGGTTCACTTCTGTTGG - Intergenic
1085743977 11:79099237-79099259 CTGCTGGGATTTCCTTCTGTGGG + Intronic
1099192012 12:79570563-79570585 CGGCCTGGATTTACTTGTGTAGG - Intergenic
1103431036 12:120886684-120886706 CTGCCGGGTTTTCTTTCAGTGGG - Intronic
1113671314 13:112177244-112177266 TGGTTGGGTTTTTCTTCTGTAGG + Intergenic
1113858827 13:113467744-113467766 CGGCCCGCTTTTAATTCTTTTGG - Intronic
1124266652 15:28241522-28241544 CGGCCTGCTTTTACTTCTTTTGG - Intronic
1138948082 16:61876170-61876192 CGGCCAGGTTTTCTTTCTTTAGG + Intronic
1150873299 17:68939660-68939682 GGGCAGAGATTTACTTCTGTTGG + Intronic
1154038804 18:10833494-10833516 CGGTGGGTTTTTATTTCTGTTGG + Intronic
1155453212 18:25984489-25984511 TGGCAGGGTTTTAATTCTCTAGG + Intergenic
1156706899 18:39893687-39893709 CAGCAGGGTGTTTCTTCTGTTGG - Intergenic
931442009 2:62296660-62296682 CGCCTGGGTGTTACTTCAGTTGG + Intergenic
931587217 2:63841516-63841538 CGGCCGGGTTTCACTGCTCGAGG + Intronic
937954165 2:127410238-127410260 CGGCAGGGTTTTAGATTTGTAGG + Intergenic
940962173 2:159798015-159798037 CGGCCGGGTGTTGCGTCTGCGGG + Intronic
1172936903 20:38626969-38626991 CATCTGGGTTCTACTTCTGTTGG + Intronic
1173141323 20:40486494-40486516 CAGCTGGGTGTTTCTTCTGTTGG - Intergenic
1177791519 21:25727515-25727537 TGGGCAGGTTTAACTTCTGTAGG - Intronic
967952989 3:194855021-194855043 AGGCTGGGTTTGACTTCAGTGGG - Intergenic
971949775 4:33329848-33329870 CGGCCGAGGTTAACTTCTTTTGG + Intergenic
989166842 5:38440747-38440769 AGGACTGGTTTAACTTCTGTAGG - Intronic
991860946 5:71012646-71012668 CCGCTGGGTTTTACTTCACTGGG - Exonic
992691182 5:79241596-79241618 CTGCCGAGTTTTATATCTGTGGG + Intronic
1004519876 6:16351748-16351770 AGGCCTGGTTTCCCTTCTGTTGG - Intronic
1010779670 6:79930996-79931018 CGACAGGGTTTGACTTCAGTTGG - Intronic
1012244013 6:96906097-96906119 CTGCCGAGTTTCATTTCTGTTGG + Intergenic
1017240787 6:152166002-152166024 CGTCCTGCTTTTACATCTGTAGG + Intronic
1024619457 7:51145311-51145333 CGGCCTGTTTTTAATTCTTTTGG + Intronic
1026858152 7:73768553-73768575 TGGCCCGGTTTTACTTTTGGTGG + Intergenic
1061098742 9:128475939-128475961 CGGCCGAGTTCAACTTCTTTAGG + Intronic
1190701032 X:52990039-52990061 GGGCCAGGTTTTAGTGCTGTTGG - Intronic
1192892214 X:75402572-75402594 CTGATGGTTTTTACTTCTGTGGG - Intronic