ID: 914869120

View in Genome Browser
Species Human (GRCh38)
Location 1:151458811-151458833
Sequence GCGCGCGCGCGCGCCGCGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 600
Summary {0: 1, 1: 0, 2: 5, 3: 90, 4: 504}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914869108_914869120 28 Left 914869108 1:151458760-151458782 CCGAGCGTGCGTGTGGACGTCGG 0: 1
1: 0
2: 0
3: 1
4: 27
Right 914869120 1:151458811-151458833 GCGCGCGCGCGCGCCGCGGCGGG 0: 1
1: 0
2: 5
3: 90
4: 504
914869117_914869120 -8 Left 914869117 1:151458796-151458818 CCGTGGGGCGCGAGTGCGCGCGC 0: 1
1: 0
2: 0
3: 7
4: 77
Right 914869120 1:151458811-151458833 GCGCGCGCGCGCGCCGCGGCGGG 0: 1
1: 0
2: 5
3: 90
4: 504

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914869120 Original CRISPR GCGCGCGCGCGCGCCGCGGC GGG Intronic
900126730 1:1072046-1072068 GCGGGCGCGGGCGGCTCGGCAGG + Exonic
900162827 1:1232420-1232442 GCGCGCGCGGGCGCGGGGGGAGG - Exonic
900190086 1:1349526-1349548 GCGGGCCCGCGCGCGGGGGCGGG - Intergenic
900393445 1:2443664-2443686 GGGGGCGCGGGCTCCGCGGCGGG - Intronic
901017955 1:6242458-6242480 GGGCGGGCGGGCGGCGCGGCCGG - Intergenic
901050824 1:6425139-6425161 TTGCGGGCGCGGGCCGCGGCGGG - Exonic
901064943 1:6490123-6490145 GCCCGGGCGCGCGGCGTGGCTGG - Intronic
901489279 1:9588621-9588643 GCGCGGGGGCGCTCCCCGGCCGG + Intergenic
901628230 1:10635536-10635558 GAGTGCCCGCGCGCCGGGGCTGG + Intergenic
901641433 1:10694890-10694912 GCGAGCGCGCGCGCGGCCGCCGG - Intronic
902067469 1:13700218-13700240 GCGGCCGCGGGCGCCGGGGCCGG + Intronic
902348430 1:15835920-15835942 GCGCGCGCGCTCGCCGTGCGGGG + Intergenic
902350028 1:15847647-15847669 GCGCGCGCGCCCGCGGCGAGGGG + Intergenic
902429557 1:16352480-16352502 GAGCGCGCATGCGCCGGGGCGGG + Intergenic
902451434 1:16499166-16499188 GTGCGCGCGTGCGCGGGGGCTGG - Intergenic
902501448 1:16914152-16914174 GCGCGCGCGTGCGCGGGGGCGGG + Intronic
902535931 1:17119376-17119398 GCGAGCGCGGGCACTGCGGCGGG - Exonic
902585832 1:17438298-17438320 GGGCAAGCGCGCGGCGCGGCCGG - Exonic
902813426 1:18902423-18902445 GCGCGCGCTCGGGCCGCCCCGGG + Intronic
902870672 1:19312039-19312061 GCGAGCGCGCGGGCCTCGGGCGG + Exonic
903034771 1:20486414-20486436 GTGCGCGCCCGCCCCGCAGCCGG + Intergenic
903514775 1:23902967-23902989 CCGCGCCCTCGCGCCGCGCCGGG + Intronic
903832900 1:26185119-26185141 GCCCGCGCTGGCGCCGCCGCTGG + Exonic
903879826 1:26500973-26500995 GCGCGCGCACGTGCCGGGGCGGG + Intergenic
904037924 1:27568697-27568719 CCGGGCACCCGCGCCGCGGCCGG - Intronic
904045159 1:27604192-27604214 GAGCGCGCGCGCGGCACGCCGGG + Intronic
904500154 1:30908594-30908616 GCGCGGGCGCGGGCGGCGGGCGG + Exonic
904563388 1:31413312-31413334 GCGCGGGCGGGCGCCGGGGTCGG - Intronic
904769030 1:32870803-32870825 GCGCGAGCGCGAGCGGCCGCCGG - Exonic
904837728 1:33349819-33349841 GCGGGAGCGCGGGCGGCGGCCGG + Intronic
905066847 1:35192094-35192116 GCGCTTGCGCGCGCCGCTGCGGG - Intronic
905803723 1:40861743-40861765 GGGCGTGCGCGGGCGGCGGCGGG + Exonic
906204337 1:43979183-43979205 GCGCGCGCGGGCGCGCGGGCCGG + Intronic
906543246 1:46604196-46604218 GCGCGCGACCGCTCCCCGGCGGG - Exonic
906614570 1:47225572-47225594 GCGGGCGCGGGGGCCGGGGCGGG + Exonic
906720043 1:47997545-47997567 GCGCCCGGGCGCGGCGAGGCGGG + Intergenic
907200930 1:52726417-52726439 GCGGGCTCGCGCGCCCGGGCGGG + Intergenic
907526480 1:55056869-55056891 GCGCGCGCGCGCGTTGGGGGTGG + Intronic
908501106 1:64744895-64744917 GCGCGCCTGTGCGCCGGGGCCGG + Intergenic
908780409 1:67685423-67685445 GCCCGCGCGCTAGCCGTGGCAGG + Exonic
911072896 1:93846628-93846650 GCGCGCTCGAGCGCGGCCGCGGG - Intronic
912416238 1:109509766-109509788 GCGCGTGCGCGCGGCGGGGGCGG + Intergenic
914813621 1:151047684-151047706 GCGCTCGCGCGGGCCGCGCGGGG - Intergenic
914869120 1:151458811-151458833 GCGCGCGCGCGCGCCGCGGCGGG + Intronic
915902101 1:159854734-159854756 GTGAGCGCGCGCGCCGGGCCGGG - Exonic
917974395 1:180229917-180229939 GGGCGCGAGCCCGCCACGGCTGG + Intergenic
917974790 1:180231547-180231569 GCGCGCGCGCGCGCGACGACTGG - Intronic
918001641 1:180502591-180502613 GTGCGAGCGCGGGGCGCGGCTGG + Exonic
920924484 1:210328883-210328905 GCCCGCGCGCCCTCCGCGCCCGG - Intronic
920924487 1:210328894-210328916 GGGCGCGCGGGCACGGCGGCAGG + Exonic
921189874 1:212699785-212699807 GCGCGCGGGCGGGGCGGGGCGGG - Exonic
921384073 1:214551822-214551844 GCGCGCGCCCGCGGCGCCCCCGG - Intronic
921604761 1:217139715-217139737 GCGCGGGCCCGCGCAGAGGCCGG + Intergenic
922196511 1:223364278-223364300 GGGCGCGCGGGCGCCTCCGCGGG - Intergenic
922648719 1:227318507-227318529 GCGCGCGCGTGTGCCGGGGCCGG - Intergenic
922958555 1:229625809-229625831 GCGCGCGGGCGGGCGGGGGCCGG - Intronic
922958558 1:229625815-229625837 GCGCGCGCGCGCGGGCGGGCGGG - Intronic
923055899 1:230425933-230425955 GCGGGCGCGCGGGCGGCGGCCGG - Intergenic
923684147 1:236142409-236142431 GGGGGCGCGCGGGCCGGGGCGGG + Intergenic
924289509 1:242523994-242524016 GAGCGCGCGCGGGGCGCGGGGGG - Intronic
924754826 1:246931587-246931609 GCGGGTGAGCGCGCCGCCGCGGG + Intronic
1062843862 10:689920-689942 GCGCGCGCGCGCGGGGCGCGAGG + Intergenic
1063114968 10:3067037-3067059 GTGGGCGCGAGCGCCGGGGCGGG - Intronic
1063624804 10:7679005-7679027 GTGCGCGCGCGCGCGGAGGGAGG - Intergenic
1065099093 10:22316271-22316293 CCGCGCGCGGGCGCGGAGGCGGG + Exonic
1065099510 10:22320584-22320606 GGGCGCGCGCGGGCGACGGCTGG - Intronic
1065214694 10:23438866-23438888 GCGCGCGGGCGGGGCGAGGCCGG - Intergenic
1065214697 10:23438876-23438898 GCGCGCGAGCGCGCGCGGGCGGG - Intergenic
1069419237 10:68231580-68231602 GCGGGCACGTGCGCCGGGGCCGG - Exonic
1069544540 10:69319015-69319037 GCCCCCGCCCGCGCCGCCGCTGG + Intronic
1069651685 10:70053659-70053681 GCGGGCGTGCGCCCCGGGGCCGG + Intronic
1069976284 10:72215989-72216011 GCGCGCGCCCGTGCCGTGGTGGG - Exonic
1070147673 10:73786354-73786376 GCGCGTGCGCGCGCTGTGACAGG + Intronic
1070329605 10:75408107-75408129 GGGGCCGAGCGCGCCGCGGCGGG - Intergenic
1070954380 10:80454614-80454636 GCGCGGACGAGAGCCGCGGCGGG + Intronic
1071086713 10:81874881-81874903 GCGCCCGCTCGCGCCGCGCCTGG - Intergenic
1071997566 10:91163004-91163026 GCGCGCGCGCGTGGGGCGGTAGG - Intronic
1072102208 10:92239825-92239847 GCCTGCGCCCGCGCCGCAGCCGG - Exonic
1073147952 10:101292610-101292632 GCGGGCGCGGGCGCGGCCGCGGG - Intergenic
1074503275 10:114044636-114044658 GCGCCCGCGCGCGCGTCAGCAGG - Exonic
1074618344 10:115093038-115093060 GCGCGCGCGCCCACCCCGCCTGG - Intergenic
1075129559 10:119726295-119726317 GCGCGCGCTCGCCCTGCTGCAGG - Exonic
1076638974 10:131901190-131901212 GGGCGGGCGGGGGCCGCGGCCGG + Intronic
1076793405 10:132787901-132787923 GCGCGCGCGGGCGGAACGGCGGG + Intergenic
1077048050 11:554923-554945 GCGCGGGCGGGCGCCGGGGCTGG - Exonic
1077090854 11:777608-777630 GCCCGGGCGCGCGGAGCGGCGGG - Exonic
1077214595 11:1390163-1390185 GCCCGCGGGGGCGCCCCGGCCGG + Intronic
1077459356 11:2700836-2700858 GCGCGCGCCAGCGGCGCGGAGGG - Intronic
1078090801 11:8263271-8263293 GTGTGCCTGCGCGCCGCGGCAGG + Intronic
1078180089 11:9004064-9004086 GCGCGCGCGGGGGGCGGGGCCGG + Intergenic
1079798162 11:24833695-24833717 GTGTGCGCGCGCGCGGTGGCAGG - Intronic
1081574542 11:44310824-44310846 GAGCTCGCGGGCGCCGCTGCGGG + Intergenic
1081832024 11:46121797-46121819 GCCCGCCCGAGCGCCGCCGCGGG - Intergenic
1082035552 11:47642563-47642585 GCGTGCGCGCGCGCCGCGGGCGG - Exonic
1082928849 11:58579068-58579090 GCGCGCGCGCGCGCCGCCAGCGG + Intergenic
1083617984 11:64035844-64035866 GCTCGCGCGGGCACCGCCGCTGG + Intronic
1084174373 11:67415843-67415865 GGGCGCCCGCTCCCCGCGGCGGG + Intronic
1085485643 11:76860871-76860893 GCGCTCGCTCGCGCCCCGCCCGG - Exonic
1085666289 11:78417870-78417892 GCGGGCGCGCGCGAGGCTGCCGG - Intronic
1087782637 11:102317631-102317653 GCGCGCGCGCGCGCCTCCCCTGG + Intronic
1088462321 11:110093779-110093801 GCGGGCTCGGGCGCCGCGGATGG + Intronic
1089499814 11:118925497-118925519 GCGCGCACACCCGCCGGGGCCGG + Intronic
1091286635 11:134411973-134411995 GCGCGCCCGCCCGCCCCGCCCGG + Intergenic
1091402448 12:189194-189216 ACGCGGGCGCGCGCCTCAGCCGG - Intergenic
1091616202 12:2052926-2052948 GGGCGCGGGCGCGGCGGGGCTGG + Intronic
1092196966 12:6555536-6555558 TCGCCCGCGCGCTCCCCGGCCGG - Exonic
1092204695 12:6607586-6607608 GCGCGCGCGCCCGCTGCGAAGGG - Intergenic
1092810527 12:12267440-12267462 CCCCGCGCGTGCACCGCGGCTGG - Intergenic
1093435326 12:19129675-19129697 GCGCGGGGGCGCGCCGGGCCGGG + Intergenic
1093547844 12:20369215-20369237 GCGCGCGCGTGGGTCGGGGCGGG + Intergenic
1096101296 12:48971832-48971854 GCGCGCGCGCGCGCGCTGGGAGG - Intergenic
1096101298 12:48971836-48971858 GCGCGCGCGCGCGCGCGCGCTGG - Intergenic
1096482449 12:51951688-51951710 GCGCGCGCGCTGGGCGCTGCTGG + Exonic
1096647590 12:53047185-53047207 GCGCGGGCGCGGGGCGCGGCGGG + Intronic
1096668074 12:53180495-53180517 GCCGGCGCGTGCGCCGTGGCCGG - Intronic
1096682800 12:53268176-53268198 GCGGGAGCGCGCAGCGCGGCGGG + Intergenic
1096983627 12:55743152-55743174 GCCCGCGCGCCCGCCGCCCCCGG + Intergenic
1096994614 12:55830808-55830830 GCGCGCGTGCGCGCGGTGGGGGG - Intronic
1097190365 12:57216694-57216716 GGGGGCGCGCGGGGCGCGGCCGG + Intergenic
1097218365 12:57431153-57431175 GCGAGTGCGCGCGCGCCGGCGGG - Intergenic
1098369188 12:69739077-69739099 GGGCGCGCGGGCGCCGAGGGGGG - Intronic
1101371941 12:104138295-104138317 GGGCGCGCGGGCGGCGCGGAGGG - Intergenic
1101409849 12:104458512-104458534 GCGCCCTCGAGCGCGGCGGCCGG + Intronic
1102025824 12:109713961-109713983 GCGCGCGCCGGCGCCTCGCCTGG - Intergenic
1103604795 12:122078731-122078753 CCGCGAGCGCGCGGCGCGGCGGG - Exonic
1103764656 12:123271630-123271652 GCGGGCGCGCCGGGCGCGGCGGG + Exonic
1103855971 12:123972144-123972166 GGGTGGGCGCGCGCCGCGGCCGG + Intronic
1104444725 12:128823898-128823920 GGGCGAGCGGGCGCCGCTGCTGG - Exonic
1104961570 12:132490588-132490610 GCGCGCGCGAGCGCCGGCTCGGG - Exonic
1105768067 13:23579884-23579906 ACGCGGGCGGGCGCCGGGGCCGG - Intronic
1106776716 13:33016455-33016477 GCGGCCGCGGGCGGCGCGGCGGG - Exonic
1107468031 13:40666657-40666679 GCCGGCGCGCGCGCCGCCGCGGG - Intergenic
1108380274 13:49848113-49848135 GCGCGGCCGAGCGCCGCTGCGGG + Intergenic
1108408081 13:50124563-50124585 GCGCGCGCGCGGGCTTCGGCGGG - Intronic
1109062067 13:57632450-57632472 TCGCGCGCGCACGCTGCGCCAGG + Exonic
1112271958 13:97976626-97976648 GCGCGCTCGCGGGCCGCGGGAGG - Intronic
1112580589 13:100674231-100674253 GCAGGCGCTCGCGGCGCGGCGGG + Intronic
1113200997 13:107867341-107867363 CCGCCCGCGGGCGCCGCCGCCGG + Intergenic
1113201065 13:107867593-107867615 GCGCGGGGGCGGGCGGCGGCGGG + Intergenic
1113655607 13:112066661-112066683 GCGCGCGCGCGCGGCGGCGGCGG - Intergenic
1117920529 14:60722737-60722759 GCGTGCGCGCGCGCCAGGCCCGG + Intronic
1118030374 14:61812715-61812737 CCGGGCGCGCGCTCCTCGGCAGG - Intergenic
1118312653 14:64704884-64704906 GCGCTCGCGCACTCTGCGGCAGG - Intronic
1118323159 14:64765042-64765064 GCGCGCGCGCGCGCGGGTGGTGG + Intronic
1118404807 14:65412732-65412754 TCGCGCGCGCACGCCGGCGCTGG + Intronic
1119046398 14:71321370-71321392 GCGTGCGCGCGCGCCGGGCGCGG - Intronic
1121074946 14:91060285-91060307 GCGCGCCCCCGCGCCGGGCCCGG + Intronic
1121453845 14:94026446-94026468 GCGCGGGCGGGCTCCGCCGCTGG - Exonic
1121595342 14:95157664-95157686 GCGGGCGCGCGCGCGGAGGCCGG + Intronic
1121617022 14:95320002-95320024 GCGAGCGAGCGCGGGGCGGCGGG + Intergenic
1122130857 14:99604040-99604062 GCGCGCGGGCGGGGGGCGGCCGG + Intergenic
1122275118 14:100587196-100587218 GCGGGCGCGGGCGCGGAGGCGGG - Intronic
1122542817 14:102507450-102507472 ACGCGCGCCCGCTCCTCGGCCGG + Exonic
1122905717 14:104800656-104800678 GCGCGCGCGCGAGCGGCGACCGG + Intronic
1122975104 14:105167809-105167831 GCGCGGGCGCGGGCCCGGGCCGG - Exonic
1122993250 14:105248797-105248819 CCGCGCCCTCGCGCCGCGCCGGG - Exonic
1123004402 14:105314508-105314530 GCGCGCTCTCGCGCACCGGCGGG + Exonic
1123004449 14:105314675-105314697 CCGGGCGCGCGCGGGGCGGCCGG + Exonic
1123174193 14:106401554-106401576 GTGGGCGGGCGCGGCGCGGCGGG - Intergenic
1124957228 15:34367327-34367349 GCGGCTGCGGGCGCCGCGGCGGG - Intergenic
1125521960 15:40353147-40353169 GCGCGCGCGCGCGCATCCGTGGG + Intronic
1126626059 15:50686759-50686781 GCGCCCGCGCCCGCCTCCGCCGG + Exonic
1126626093 15:50686890-50686912 GCGCGTGCGCGCGGCGCGCAGGG - Intergenic
1126738035 15:51751561-51751583 GCGCGCCCCGGCGCCGCGCCCGG + Exonic
1126766996 15:52019420-52019442 GCTCGGGAGGGCGCCGCGGCGGG + Intronic
1126849847 15:52790257-52790279 GCAGGCGCGCGGGCCGCGGCAGG - Intronic
1127931642 15:63600982-63601004 GCGCGCGCGGGCGCGGGGGCTGG - Intronic
1129503207 15:76059798-76059820 GGGCGCGCGCGCGCGGCCGGCGG + Intergenic
1129503209 15:76059802-76059824 GCGCGCGCGCGGCCGGCGGGAGG + Intergenic
1129503262 15:76059953-76059975 CCGGGAGCGCGAGCCGCGGCCGG + Exonic
1129539396 15:76338439-76338461 CTGCTCGAGCGCGCCGCGGCCGG + Exonic
1131186039 15:90275053-90275075 GCGCGGGCCCGGGCGGCGGCTGG - Exonic
1132105357 15:99059121-99059143 GCGTGCGCGCCGGCCGCGGCGGG + Intergenic
1132111709 15:99106193-99106215 GCGGGCGAGCGCGGGGCGGCAGG + Intronic
1132527715 16:425890-425912 GCGGGCGCGCGCGGGGCGCCCGG - Exonic
1132527720 16:425905-425927 GCGCCCGCCCGCGCCGCCGAGGG + Exonic
1132583453 16:695390-695412 GCGCGCCCCCGGGCCGCGCCGGG - Intronic
1132585999 16:705964-705986 CCGCGCGCGGGGGCCGGGGCGGG - Intronic
1132719651 16:1309485-1309507 GGGCGCGGGCGCGCGGCGGCGGG + Intronic
1132841268 16:1979461-1979483 ACGCGCACGCGCGCCCCCGCGGG + Exonic
1132843533 16:1989934-1989956 CCGCGCGTCCCCGCCGCGGCCGG + Exonic
1132843535 16:1989943-1989965 GAGCGCGCGCCGGCCGCGGCGGG - Exonic
1132926006 16:2429422-2429444 GAGCGCGCCCGCGCCCCGGCCGG - Exonic
1133024777 16:2983803-2983825 GGGCGCGCGCGGCCCGCGCCTGG - Intergenic
1133188483 16:4116472-4116494 CCGCGCGTGCGCGCTGCGGCTGG - Intergenic
1133232102 16:4371789-4371811 GGGGGCGGGCCCGCCGCGGCAGG - Intronic
1133340664 16:5033668-5033690 GCGCGCGCGCGCGCCTCCCCCGG - Exonic
1133784484 16:8963720-8963742 GCCCGCAGGCCCGCCGCGGCCGG - Intronic
1135040520 16:19114158-19114180 GCGCCCCCGCGCGCCGCCGTCGG - Intronic
1136141641 16:28292544-28292566 GCCCGGGCGGGCGCCGGGGCCGG + Exonic
1136390602 16:29962007-29962029 GCGCGGCCCCGCCCCGCGGCCGG - Intronic
1136399873 16:30011443-30011465 CCGCGCGCGCGGGCGGGGGCGGG - Intronic
1136531877 16:30875361-30875383 GCGCGCGCCCGCGCCCCAACCGG + Intronic
1136579467 16:31142911-31142933 GCGCCCGCGCGCGGAGCGGGTGG - Exonic
1137454733 16:48609746-48609768 GGGCGCGCGGGGGCGGCGGCCGG + Intronic
1137531762 16:49282407-49282429 GCGTGCGCGCGCGGCGGGGCGGG + Intergenic
1138229077 16:55324628-55324650 GTGCGCGCGCGCGCACGGGCTGG + Exonic
1138327941 16:56191244-56191266 GCGCGTGTGCGCGCCGCCGCCGG + Intergenic
1139637102 16:68264460-68264482 GCGACAGCGCGCGCCGCGTCGGG - Intergenic
1139954273 16:70685870-70685892 GCGGGCGCTCGCTCCGAGGCCGG + Exonic
1141054531 16:80803724-80803746 GCGGGGGGGCGCGCCGCGGCCGG - Intronic
1141054586 16:80803936-80803958 GCGGGCGCGGGCGCCGCGGGAGG + Intronic
1141079230 16:81036011-81036033 TCGCCCCCGCGGGCCGCGGCCGG - Exonic
1141116612 16:81315015-81315037 GCGCGCGCGCCCGCCCGGCCCGG - Exonic
1141430557 16:83968581-83968603 GCGCGGGGGCGGGCCGCAGCTGG + Intergenic
1141531363 16:84648799-84648821 GCGAGTGGGGGCGCCGCGGCCGG + Intronic
1141538526 16:84700156-84700178 GGGCGGGCGGACGCCGCGGCGGG + Intronic
1141694456 16:85613091-85613113 GCGCGCGCGCGCGCACCGACGGG - Intronic
1141972341 16:87492450-87492472 GCGGGCGCGCGCGGGGCGCCGGG + Intergenic
1142429746 16:90019569-90019591 GGGCGCGCGCGGGCCGGGGCGGG - Intronic
1142509639 17:385749-385771 CCGCACGTGCGCGCCGGGGCGGG + Intronic
1142863395 17:2776769-2776791 GCGCACGCGCGCACCCCGGCCGG - Intergenic
1143183488 17:4997900-4997922 GCGAGCGCGCGCGGAGGGGCGGG - Intergenic
1143495035 17:7307899-7307921 GCGCGGGCGCGCGCCCCGGTTGG + Intronic
1144757150 17:17686607-17686629 GTGCACGCGCGCGCCGGGGAGGG + Intronic
1146033919 17:29390225-29390247 GCGCGCGCGCGCGCCCTCACAGG - Intergenic
1146281965 17:31550346-31550368 GAGGGCGCACGCGGCGCGGCGGG - Intergenic
1147139700 17:38454113-38454135 CCGCGCGCCCGGGCCGCGCCGGG + Intronic
1147159390 17:38561645-38561667 GCGCACTGGCGAGCCGCGGCTGG + Exonic
1147168673 17:38605953-38605975 GCGCGCGCGCGGGCCGGCGCGGG + Intergenic
1147189472 17:38730331-38730353 GCGGGCGGGCGCGGCGCGGGAGG + Exonic
1147440330 17:40443657-40443679 GCGCGCGGGCGAGCGGCGGAGGG - Exonic
1147684050 17:42276401-42276423 GCGCCCCCGCGGGCCCCGGCGGG - Exonic
1147864957 17:43545983-43546005 GCGCGCGCGCGCGGAGGAGCAGG + Intronic
1147967248 17:44199834-44199856 GCGCGCGCGTGTGCCGCGACCGG + Intronic
1148262238 17:46193549-46193571 GCCCGCGGGGGCGGCGCGGCGGG - Intronic
1148271734 17:46266930-46266952 CCGCGCGCGCGCGCCGCCGAGGG + Intergenic
1148284092 17:46372782-46372804 GGGCGCGCGCGCGGCGGGGGCGG + Intergenic
1148306313 17:46590703-46590725 GGGCGCGCGCGCGGCGGGGGCGG + Exonic
1148562312 17:48613130-48613152 GCGCGCGGCGGCGGCGCGGCCGG + Exonic
1148818235 17:50346011-50346033 GGCCGGGCGCGCGCCGGGGCGGG - Intergenic
1148842587 17:50508470-50508492 GCGCACGCGCCCGCCGCCGGCGG - Exonic
1150802435 17:68292217-68292239 GTGCGCGCGCGCCCCGGGCCGGG - Intronic
1150830343 17:68512778-68512800 GCGAGCGCGAGCGGGGCGGCTGG - Intronic
1151296858 17:73192576-73192598 TCGGGCGCGCTCGCCGCCGCTGG - Intergenic
1151296904 17:73192823-73192845 GCGGGCGCGGGCGCGGGGGCGGG - Intronic
1151582350 17:74987704-74987726 GAGCGCGCGGGTGCCGTGGCGGG - Exonic
1151708401 17:75785000-75785022 GCGTGCGCGCGCGGCGGGGGGGG - Intronic
1152212485 17:79009773-79009795 GCGCGCGCTCGCCCCGCCTCTGG + Exonic
1152356752 17:79811276-79811298 GCGCGTGCGCGCGCCTCGGCGGG - Intergenic
1152362553 17:79839387-79839409 GGGCGGGCGCGGGCAGCGGCGGG - Exonic
1152468050 17:80476704-80476726 GCCCGGGCCCGCGGCGCGGCGGG + Intronic
1152689658 17:81712263-81712285 GCGCGCGCGCGCCCCGGGGGCGG - Intronic
1152708932 17:81860584-81860606 GCGCGCGCGGGCGGGGGGGCAGG - Exonic
1152809544 17:82375071-82375093 GCGCGCGCGCCCCCGGCCGCCGG - Exonic
1152809546 17:82375080-82375102 GGGGGCGCGCGCGCTGCGCCTGG + Exonic
1152852975 17:82648517-82648539 GCGCGCGCCCGCGCCCCACCAGG + Exonic
1152923990 17:83079425-83079447 GGGGGCGCGGGCGCCGGGGCGGG - Intergenic
1153051921 18:908167-908189 GCGCGCGCCCCCTCGGCGGCCGG - Intronic
1154241566 18:12657982-12658004 GCGGCCGCGCGCGCCGCCGCCGG + Exonic
1154954285 18:21240558-21240580 GTGCGCGCGCGCGCGCGGGCGGG - Intergenic
1155054497 18:22171797-22171819 GCGCGGGCGCGCACCCCGGCTGG + Exonic
1155130959 18:22933830-22933852 GCGCGCGCGCGAGCCGCAGTCGG - Exonic
1155392480 18:25351091-25351113 GCGCGAGCGCGAGCCGGAGCCGG - Intronic
1157279101 18:46334187-46334209 GCGCGGGCGCGGGCGGCGGCGGG - Intronic
1157279156 18:46334393-46334415 GCGGGGGCGGGCGCCGCGGGCGG + Intronic
1160024714 18:75208491-75208513 GTGCGCGCGGGCGGCCCGGCGGG + Intronic
1160204578 18:76822514-76822536 GCACGCGCGGGCACCGGGGCGGG - Intergenic
1160500712 18:79400125-79400147 TCGCGCGCGCGCGAGGGGGCGGG + Intronic
1160613871 18:80109483-80109505 GCGCGGGCCCGCGCCGGGCCGGG - Intronic
1160729209 19:633105-633127 GCGCCCGTGTTCGCCGCGGCGGG - Intronic
1160736136 19:663194-663216 GCGTGCGCGGGCGCGTCGGCCGG - Exonic
1160767026 19:813247-813269 GCGCGCGGGGCCGCCGCCGCTGG - Exonic
1160788702 19:913058-913080 GCGGGCGGGCGGGGCGCGGCGGG - Intronic
1160830868 19:1104416-1104438 GCAGGCGCGCGTGCCGGGGCCGG + Intronic
1160873259 19:1286399-1286421 CCCCACGCGCGCGCCGCCGCCGG + Intronic
1160909900 19:1469559-1469581 GCGCGCGCCCGCCGCCCGGCCGG + Exonic
1160991892 19:1863503-1863525 GCAAGGGCGCGCGGCGCGGCGGG + Exonic
1161108693 19:2456597-2456619 GCGATCGCGCGCCCCGCGGTGGG + Intronic
1161309403 19:3585679-3585701 GGGCGGGCGCGGGGCGCGGCCGG - Exonic
1161401286 19:4067111-4067133 GCGGGGGGGCGCGCCGGGGCGGG - Intergenic
1161707235 19:5827846-5827868 GCGCACGCGCGCGCCGCCGCCGG - Exonic
1161802585 19:6424402-6424424 GCTCGCGCGCGCGCGCAGGCGGG - Intronic
1161820923 19:6531082-6531104 GCGCGAGCGCGGGGCGCGGGAGG - Exonic
1161950921 19:7467450-7467472 GCGTGCGGGCGCGCGGCTGCAGG + Exonic
1162046745 19:8005338-8005360 ACGCGCGCTGGGGCCGCGGCGGG - Intronic
1162430510 19:10625599-10625621 GCGCGGGCGGCCGCCGGGGCTGG + Exonic
1162485964 19:10960853-10960875 GCGCGCACGCGCGCCGGGAGCGG + Intergenic
1162954374 19:14090273-14090295 GCGCTCGCGCAAGGCGCGGCCGG - Exonic
1163138650 19:15331968-15331990 GGGGGCGCGGGCGCCGCGGCGGG - Intronic
1163390765 19:17028427-17028449 GCGTGCACGCGCGCAGGGGCCGG + Intergenic
1163631322 19:18419363-18419385 GCGGGGGCGCGCGCGGCGGGAGG + Exonic
1163708635 19:18832402-18832424 GCGGGCGCGGGCGCTGCGGCGGG + Exonic
1165349384 19:35268087-35268109 GCGCGGGCGCGGGCCGGGCCAGG - Intergenic
1165349427 19:35268223-35268245 GAGCGCGCGCGCGTCCCGGACGG - Intergenic
1166330641 19:42076293-42076315 GCGAGCGGGCGCGCAGAGGCCGG + Intronic
1166727758 19:45039070-45039092 CCGCGCGCGAGCGCAGCGGTGGG + Exonic
1167466134 19:49651884-49651906 GCGGGCGCGGGCGCCGGGGAGGG - Exonic
1167495810 19:49818245-49818267 GCGCGCGCGCTCGCGTCGGGCGG - Intergenic
1167509829 19:49890188-49890210 GCGCGAGGGCGCGCTGCTGCTGG - Exonic
1167509833 19:49890197-49890219 GCGCGCCCTCGCGCGGCGGCGGG + Exonic
1167709932 19:51104335-51104357 GCGCGCGCTGGCGCCGCGCCTGG - Exonic
1168246987 19:55117431-55117453 GCGCGGGCGGGCGCCGAGCCTGG - Exonic
1168408073 19:56121032-56121054 GCGCGCGTGCGCGCTGCTGGGGG - Intronic
925610424 2:5696924-5696946 GGTCGCGCCCGCGCCGCCGCCGG - Exonic
925730564 2:6917407-6917429 GCGCGAGCGCGCACAGAGGCCGG - Exonic
926020186 2:9487838-9487860 GCGCGCGCGCGCGCTGTGGGGGG + Intronic
926077349 2:9951812-9951834 TCGCGCCCGCTCGCCGCTGCCGG - Exonic
926155019 2:10448662-10448684 GCGCACGCGCACGACGCCGCAGG + Intergenic
927811766 2:26184425-26184447 GCGAGCGCGGGGGCCGCGGGAGG + Exonic
927997348 2:27495230-27495252 GCGGGCCCGCGCGTCCCGGCCGG - Exonic
931321370 2:61177373-61177395 GCTCCCGGGCGCGCCGCGGCAGG + Intergenic
931649372 2:64454392-64454414 GCGCGCGCGCGCCCGGGGCCCGG - Exonic
932567356 2:72918150-72918172 GCGCCCGCGGCGGCCGCGGCAGG - Exonic
932607674 2:73175833-73175855 GCGCCCGCCCCCGCCGCCGCGGG - Intergenic
932901929 2:75710928-75710950 GGGCGCGCTCCCGCCGCGCCTGG + Exonic
934954852 2:98608750-98608772 GCGCGAGCCCGGGCCGCGGGAGG - Intronic
935746573 2:106194341-106194363 GGGCGGGGGCGCGCGGCGGCAGG - Intergenic
936278735 2:111120807-111120829 GCCAGCCCGCGCGCCGGGGCGGG + Intronic
936433243 2:112482180-112482202 GCGCCCGGGCGCGGCGCCGCCGG + Exonic
937045003 2:118846593-118846615 GCGCCCGCGCCGGCGGCGGCTGG + Exonic
937221748 2:120346072-120346094 GCGCGGGCGCGGGCGGGGGCGGG + Intergenic
938100175 2:128493098-128493120 GGGCGCGCCCACGCCCCGGCGGG - Intergenic
942034700 2:171999721-171999743 GCGAGCGCGCGAGCCGCGGCTGG + Exonic
942965800 2:181891724-181891746 GCGCGCAGACGCGCAGCGGCCGG + Intergenic
943811645 2:192195272-192195294 CCGCGAGTGCGGGCCGCGGCTGG + Exonic
944154036 2:196592812-196592834 GCGCCCTCCCGCCCCGCGGCCGG - Intronic
944675549 2:202032665-202032687 GCGCGCGAGCGCCCAGCGCCTGG + Intergenic
944675947 2:202034245-202034267 GCGCGCACGCCCCCCGCGCCTGG - Intergenic
945225866 2:207530451-207530473 GGGCGCCAGCTCGCCGCGGCCGG - Intronic
945251952 2:207771266-207771288 GCGCACTTGCGCGCCGCGGGGGG + Intergenic
945699442 2:213151857-213151879 GCGCGCGCGCGCGGGCTGGCGGG + Intronic
946325342 2:218981957-218981979 GAGCGTGCGCGGGCGGCGGCTGG + Exonic
946692435 2:222319552-222319574 GCAGGCGCGCGGGCAGCGGCGGG + Intergenic
947119238 2:226799131-226799153 GCGCGCGCGCGCGCTCCTGGAGG - Exonic
947860505 2:233354488-233354510 GCCAGCGCGCGCACCGCGGGCGG - Exonic
948140858 2:235670828-235670850 GCGCGCGCTCCAGCCGCTGCAGG - Intronic
948140863 2:235670841-235670863 GAGCGCGCGCGGGCGGCGGCCGG + Intronic
948473757 2:238203505-238203527 GCCCGAGCGCTCGCCGCGCCCGG - Exonic
948645178 2:239400323-239400345 GGGCGGGCGGGCGCCGGGGCCGG - Intronic
948953991 2:241272897-241272919 GCGCCCGCCCGCCCCGCCGCTGG + Intronic
1169207779 20:3749728-3749750 GTGCCCGCGCTCGCCGCCGCAGG + Exonic
1169673783 20:8132446-8132468 GCGCGCGGGGGCGCAGCGCCCGG - Intronic
1170629940 20:18057508-18057530 GCGCGCGCGGGGGCCGGGCCTGG - Intronic
1171010706 20:21507940-21507962 GCGCGCGGGCGCTTCGGGGCCGG + Intergenic
1171452840 20:25248027-25248049 CCGCGCCTGCGCGCCGCGCCGGG - Intergenic
1172100574 20:32482579-32482601 GCGCGCGCCCTCGAGGCGGCCGG + Intronic
1172109413 20:32536525-32536547 GCAGGCGCGTGCGCCCCGGCGGG + Intronic
1172118436 20:32584541-32584563 GCGCGCGCGGCGGCCGCGGGCGG - Intronic
1173210724 20:41029362-41029384 CCGCGCGCGCTCGCCGCCGGAGG + Intronic
1173807467 20:45935091-45935113 GCGGGAGCGCGCGGCGGGGCGGG + Intronic
1174607102 20:51768690-51768712 GCGCGGGCGCGGGCCGGGGGCGG - Intergenic
1175267004 20:57709323-57709345 GGGCGCGCCCGGGGCGCGGCGGG + Intronic
1175903005 20:62367359-62367381 GCGCTCGGGCGGGCCGGGGCGGG - Intergenic
1176178534 20:63739513-63739535 GCGCGCCCGCGCGCCCCGCCGGG - Intronic
1176194575 20:63831304-63831326 GCGCGCGCGCGCCCCGCCCGCGG + Intergenic
1176207094 20:63895102-63895124 GGGAGCGCGCGCGCCGGTGCGGG + Intergenic
1176242077 20:64079848-64079870 GAGTGCGCGCGCGCAGCGCCGGG - Intronic
1176547222 21:8207223-8207245 GCGCGCACGCGCGCACCGGCCGG + Intergenic
1176547891 21:8209278-8209300 GGGCGCGCGCGCGTGGCCGCCGG + Intergenic
1176547956 21:8209464-8209486 GCGGGCGCGGGGGCGGCGGCCGG - Intergenic
1176549930 21:8216805-8216827 GGCTGGGCGCGCGCCGCGGCTGG + Intergenic
1176555127 21:8251432-8251454 GCGCGCACGCGCGCACCGGCCGG + Intergenic
1176555635 21:8253047-8253069 GCGCGCGCGTGCGCCGAGCGCGG + Intergenic
1176555787 21:8253491-8253513 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1176555850 21:8253679-8253701 GCGGGCGCGGGGGCGGCGGCCGG - Intergenic
1176566173 21:8390270-8390292 GCGCGCACGCGCGCACCGGCCGG + Intergenic
1176566887 21:8392499-8392521 GCGGGCGCGGGGGCGGCGGCCGG - Intergenic
1176568856 21:8399839-8399861 GGCTGGGCGCGCGCCGCGGCTGG + Intergenic
1176569424 21:8401986-8402008 GCGCGCGCGCGCGCGCGTGCGGG + Intergenic
1176574047 21:8434456-8434478 GCGCGCACGCGCGCACCGGCCGG + Intergenic
1176574724 21:8436525-8436547 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1176574787 21:8436713-8436735 GCGGGCGCGGGGGCGGCGGCCGG - Intergenic
1176576770 21:8444074-8444096 GGCTGGGCGCGCGCCGCGGCTGG + Intergenic
1176611338 21:8987818-8987840 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1176611401 21:8988006-8988028 GCGGGCGCGGGGGCGGCGGCCGG - Intergenic
1178832701 21:36069967-36069989 GCGCCTGCGCGCTCAGCGGCCGG + Exonic
1178864978 21:36320000-36320022 GCGCATGCGCGAGGCGCGGCCGG - Intergenic
1178992284 21:37366400-37366422 GCGCGGGCGCGGGGCGGGGCGGG + Intronic
1179375478 21:40846808-40846830 GCCCGGGCACGCGGCGCGGCCGG + Exonic
1179675009 21:42975040-42975062 GCGCGCCCCCGCCCCGCGCCGGG - Intronic
1181514367 22:23402675-23402697 GCGCGGGCGCGGGCCCGGGCTGG + Intergenic
1181610871 22:24011169-24011191 ACGCGCGCGCGCGCCGCCCAAGG + Intergenic
1181670553 22:24423882-24423904 GCGCCCGTGAGCGGCGCGGCCGG + Intronic
1181831609 22:25564784-25564806 GCGCGCGTGCGCGGGGCGCCGGG + Intergenic
1182355558 22:29720910-29720932 CCGCGGGCGGGCGCCGCGGAGGG - Intronic
1182903874 22:33920521-33920543 GGGGGAGAGCGCGCCGCGGCCGG - Intronic
1183294008 22:37019414-37019436 GCGCTGGCGCTCGCCCCGGCCGG + Exonic
1183486187 22:38088894-38088916 GCGAGCGCCCGGGCGGCGGCGGG - Exonic
1183788448 22:40045344-40045366 GCGGGCGCGCGCGCGGCTCCGGG + Intronic
1184153047 22:42649420-42649442 GCGGGCGCGCGGGGCGGGGCGGG + Intronic
1184184822 22:42857407-42857429 GCGCACGCGCGTGCAGCGCCTGG - Intronic
1184276479 22:43411947-43411969 GCGCGCGGGCGGGCGGCGGAGGG + Intronic
1184680781 22:46071328-46071350 GCGCGCGCGGGCGGGGCGGGCGG - Intronic
1203252095 22_KI270733v1_random:123508-123530 GCGCGCACGCGCGCACCGGCCGG + Intergenic
1203252772 22_KI270733v1_random:125576-125598 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1203252835 22_KI270733v1_random:125764-125786 GCGGGCGCGGGGGCGGCGGCCGG - Intergenic
1203254820 22_KI270733v1_random:133131-133153 GGCTGGGCGCGCGCCGCGGCTGG + Intergenic
1203260149 22_KI270733v1_random:168591-168613 GCGCGCACGCGCGCACCGGCCGG + Intergenic
1203260828 22_KI270733v1_random:170662-170684 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1203260891 22_KI270733v1_random:170850-170872 GCGGGCGCGGGGGCGGCGGCCGG - Intergenic
1203262876 22_KI270733v1_random:178210-178232 GGCTGGGCGCGCGCCGCGGCTGG + Intergenic
949089562 3:11434-11456 GAGGGCGCGCGCGCCGGCGCAGG + Intergenic
950650189 3:14402406-14402428 GCGCGCGCGCTCGGCGAGCCCGG + Intergenic
950683877 3:14602887-14602909 CCGCGCGCGCGCTCACCGGCCGG + Intergenic
950710558 3:14810593-14810615 GCGAGCGCGGGGGCGGCGGCTGG - Intergenic
951558861 3:23946031-23946053 GCGCGCGCGCGCGCGCTGGCTGG + Intronic
951717479 3:25664599-25664621 CCGCCCGCGGGCGCCGCTGCAGG + Intronic
952867220 3:37862104-37862126 GCGCGGGGGCGCGGCGCGGGGGG - Intronic
952867230 3:37862126-37862148 GCGCGGGGGCGCGGCGCGGGGGG - Intronic
953326120 3:42013738-42013760 GGGCGCGCGGGGGCGGCGGCCGG - Intergenic
955911744 3:63864415-63864437 GCGCCCACGCGCGCTGGGGCGGG + Intergenic
956179087 3:66500933-66500955 GCGCGCGCGCGCGCAGCCTCGGG + Intronic
959849787 3:111072223-111072245 GAGGGTGCGGGCGCCGCGGCCGG + Intronic
960639144 3:119810206-119810228 GCGCGCGGGCGGGCCGGCGCCGG + Intronic
961359422 3:126357562-126357584 CCGCGCGGGCGGGCCGGGGCGGG - Intergenic
961545276 3:127629067-127629089 GCGCGCCCGCGGCACGCGGCCGG + Intergenic
964437988 3:156674445-156674467 GCGCACGCGCGCGCAGGGGGCGG + Intronic
964518859 3:157542597-157542619 GCGCGCGCGCGCGCGCGCGCGGG + Intergenic
967055206 3:185824671-185824693 GCGGGCGCGGGAGCCGCCGCCGG + Intronic
968478973 4:825719-825741 GCGCGCGCGGGGTCCGGGGCGGG - Intronic
968514683 4:1011272-1011294 GCGCCCGCGCGCGCCCGGGTCGG - Exonic
968584074 4:1407848-1407870 GCGCGGGCGCGTGCACCGGCGGG + Intergenic
968674626 4:1871064-1871086 GCGCCCGCGGGCGCCGGGTCTGG + Intergenic
968701434 4:2059841-2059863 GCGCGCGCGGGTGCTGCCGCAGG - Exonic
968775400 4:2536869-2536891 GCGGGCGCGGGGGCCGCGGGCGG - Intronic
968835812 4:2963651-2963673 GCAGGGGCGCCCGCCGCGGCCGG - Intronic
968965121 4:3765844-3765866 GCGGGCGCGCGGGGCGGGGCGGG - Intergenic
972396490 4:38663631-38663653 GCTCGCGGGCGAGCCGAGGCGGG - Intergenic
972738475 4:41867312-41867334 GCGGGCGCGCAGGCGGCGGCGGG + Intergenic
973613893 4:52659995-52660017 CCGCCCGAGCGCGCCGCTGCTGG - Intergenic
975166862 4:71187200-71187222 GCGCGAGCCCGGGACGCGGCGGG - Intergenic
975485859 4:74933576-74933598 GTGCGGGCGCGGGCTGCGGCAGG - Intronic
977574090 4:98658739-98658761 GCGCGCGCGCGCACGGGGTCGGG + Intergenic
977810040 4:101347422-101347444 GCGCGGGCGATCGCGGCGGCGGG - Exonic
977908461 4:102502365-102502387 GCGCGCGCGCGCACGGAGGGGGG - Intronic
978576809 4:110197088-110197110 GCGCTCGCGCACGCGGCGGGCGG + Intronic
979205539 4:118033551-118033573 GCGCGCGCCCGCCCCGGGGAAGG - Intergenic
979469018 4:121072671-121072693 GCGCGCTGGCGCGCAGCGGGAGG - Intronic
980130044 4:128809878-128809900 GTACGCGCGCGGGCCGCGGGGGG + Intronic
981061275 4:140427653-140427675 GCGCGTGCGCGTGCGGTGGCGGG + Exonic
981348337 4:143700348-143700370 GCGCGCCCTTGAGCCGCGGCAGG + Exonic
982000299 4:151015729-151015751 GCGCACGCGCACGCCGCGCCCGG - Intergenic
982584491 4:157220576-157220598 GCGCGTGCGCGACTCGCGGCAGG - Intronic
984024121 4:174522529-174522551 GCGCGCGCGTGCAGCCCGGCGGG + Exonic
985068420 4:186144914-186144936 GCCCGCGCCCGCCGCGCGGCTGG - Exonic
987082808 5:14440993-14441015 GCGCGCGCGCGCGCTGCAGTTGG - Intronic
987234360 5:15928172-15928194 GCGCGCGAGTGTGCCGCCGCTGG + Exonic
990376225 5:55173358-55173380 GCCCGGGTGCGCGCCTCGGCCGG - Intergenic
990381857 5:55227110-55227132 GCGTGCGGGGGCGGCGCGGCCGG - Exonic
990955215 5:61333045-61333067 GCGCGCGCCCGCACCCCTGCGGG + Intronic
991263474 5:64690824-64690846 GAGCCCGCGCGTGCGGCGGCTGG + Intronic
992627430 5:78648460-78648482 GGGCCCGCGCGCGCTGCGGGAGG - Intronic
992690573 5:79236840-79236862 GCGCGAGGGGGCGCCGAGGCCGG + Exonic
993519594 5:88884134-88884156 GCAAGCGAGCGCGCCGCAGCGGG - Intronic
993727131 5:91380996-91381018 GAGTGAGCTCGCGCCGCGGCTGG - Intronic
993919146 5:93779125-93779147 GCGCGCGCGCGCGCACGTGCAGG + Intronic
994072797 5:95620743-95620765 GGGCACGCGCGGGCAGCGGCCGG - Exonic
994083331 5:95731560-95731582 GCGCGCGAGGGGGACGCGGCCGG + Exonic
998083355 5:139294464-139294486 GCGCGCGCGCGCGTGTGGGCCGG - Intronic
998131267 5:139652145-139652167 GCGCGCGCGCGCGCGCGCGCCGG - Intronic
999239131 5:150117521-150117543 GCGCGCGCGCGCGCGCTGCCAGG - Intronic
1000463313 5:161547819-161547841 GCGCGGGTGCGCGCAGCGGAGGG - Intronic
1002180078 5:177426777-177426799 TCGCGCGCGAGTGCCGAGGCCGG - Intronic
1002184201 5:177446741-177446763 GCGTGCGCGCGCGCGGCAGCCGG - Intronic
1002291716 5:178204931-178204953 GCTGGCACGGGCGCCGCGGCGGG + Exonic
1002401699 5:178994784-178994806 GTGCACGCGCGGGGCGCGGCGGG - Exonic
1002512643 5:179732964-179732986 GCGGGCTCGCGCGCGGCGGCGGG - Exonic
1002515250 5:179753223-179753245 GCGCGCGCGCGCGCGCGTGCTGG + Intronic
1002559738 5:180072910-180072932 GCGCGCGCGCGCGTTTCGGAAGG - Intergenic
1002691375 5:181053010-181053032 GCGGGGGCGCGCGCGGCGGAGGG - Intronic
1002691385 5:181053034-181053056 GCGGGAGCGCGCGCGGCGGAGGG - Intronic
1002887768 6:1311837-1311859 GGGAGCGCGCGCGCCGCTGTGGG - Intergenic
1003645573 6:7910763-7910785 GGGCGCGCGGGCATCGCGGCGGG + Exonic
1004044583 6:12012116-12012138 TGGGGGGCGCGCGCCGCGGCGGG - Intronic
1004561803 6:16759967-16759989 GCGCGCGCGCGCCGGGCGGGGGG - Intronic
1004561805 6:16759969-16759991 GTGCGCGCGCGCGCCGGGCGGGG - Intronic
1004627926 6:17393938-17393960 CCGCGCCCGCGCCCCGCGCCCGG - Intronic
1004720442 6:18264208-18264230 GCGCGCGCACGCGGGGCAGCGGG - Intronic
1004722208 6:18277464-18277486 GAGCGCGCGCGCGCCTTGGCGGG + Intergenic
1005766333 6:29015284-29015306 GCACGCGAGCGCGGCGCGGGTGG - Intergenic
1005964878 6:30720285-30720307 GGGCGCGCGTGCGCCGGGGCTGG - Exonic
1006271991 6:32972088-32972110 GCGCGCGCGCGCGGAGGGGGTGG + Exonic
1007451311 6:41941772-41941794 GCGCGCGCGCGGGCGGCGGGCGG - Exonic
1007673495 6:43576047-43576069 GCGGGCGCGTGCGCAGTGGCGGG - Exonic
1010107078 6:72182651-72182673 GCGCTCCCGCGCACCGAGGCGGG + Exonic
1011112435 6:83853482-83853504 CCGCGCCCGCGCGCCGCGTAGGG - Exonic
1011443146 6:87408439-87408461 GTGCGCATGCGCGCCGCTGCCGG - Intronic
1011640469 6:89412323-89412345 GAGCGCGCGCGCGCCCGTGCGGG - Intergenic
1011640473 6:89412336-89412358 GCGCGCGCTCGCCCGGCCGCGGG + Intergenic
1012276730 6:97283187-97283209 GAGCGCGGGCGCGCGGTGGCGGG - Intronic
1012872901 6:104693059-104693081 ACGCGCGCGCGCGCTGGGGTGGG + Intergenic
1013033702 6:106360648-106360670 GCGCCCCCGCGCGGCGCGGGCGG - Intergenic
1015149089 6:130019279-130019301 GCGAGCGCGGCCGCCGAGGCGGG + Intronic
1015328487 6:131951030-131951052 GCGCGCACGCCCTCCCCGGCCGG + Intronic
1016340913 6:143060806-143060828 GCGCGGGCGCGGGGCGGGGCGGG - Intronic
1018091132 6:160347908-160347930 GCGCGCGCGCGCCCCGGGTCCGG - Intergenic
1018329954 6:162716751-162716773 GCGTGCGCGCGCGCGCAGGCGGG - Intronic
1018400153 6:163414032-163414054 GCGCGTGCGCGCGTCGAGCCCGG - Intronic
1019472666 7:1229735-1229757 GCGCGCGCGCCCGGCCCAGCCGG - Intergenic
1019473394 7:1232960-1232982 GCGGGGGCGCGGGCCGGGGCCGG - Exonic
1019501945 7:1369059-1369081 GCGGGCCTGCGCCCCGCGGCTGG - Intergenic
1019619444 7:1983125-1983147 GCGCGCGCGCGCGCGTCTGTGGG - Intronic
1019676288 7:2314473-2314495 GGGCGAGGGCGCGGCGCGGCAGG - Intronic
1020066219 7:5190374-5190396 GCGCGCGCGCCCTCCCCGGCCGG + Exonic
1021827940 7:24573354-24573376 GCGCGCGCGGAGGCAGCGGCGGG + Exonic
1021998338 7:26201638-26201660 GCGGGCGCGCGCCCGGCGGGGGG - Intronic
1022101201 7:27170026-27170048 GCAGGAGCGCGCGCCCCGGCGGG - Intronic
1022715188 7:32891997-32892019 GCGCGCGCGCGCGAGGCGGGAGG - Intronic
1022923463 7:35037825-35037847 GCGCCCGCGCGGGGCTCGGCCGG + Exonic
1023813001 7:43926739-43926761 GCGCGAGCGCGGGGCGGGGCCGG + Intronic
1024043793 7:45574378-45574400 GGGCGCGCGCGCGGGGCAGCCGG + Intronic
1024394277 7:48848133-48848155 GCGCTGGCGCGAGCCTCGGCGGG - Intergenic
1025916841 7:65873122-65873144 GCGCGCGCGGGCGCGGAGGGAGG - Intergenic
1026522744 7:71131497-71131519 GTGCGCGCGCGCACCCGGGCAGG - Intergenic
1026822319 7:73557757-73557779 GCGCGCCTGCGCGCCCCGCCCGG + Exonic
1029483723 7:100827219-100827241 GCGCGCGCGGGCGGCGGGCCCGG + Exonic
1029496326 7:100896993-100897015 GTGCGCGCGCGCGGCGGTGCGGG + Intergenic
1030033298 7:105388448-105388470 AGGGGCGCGCGGGCCGCGGCCGG - Intronic
1030348242 7:108456440-108456462 GCGGGGGCGCGCGCCGGCGCGGG - Intronic
1031689095 7:124765898-124765920 TCGCGGGCGCGCGCAGCGGCTGG - Intergenic
1031919298 7:127589184-127589206 GGGAGCGGGAGCGCCGCGGCGGG + Intronic
1032013410 7:128360966-128360988 GCGCGCGCGCGTGCAGGGGCAGG - Intronic
1032298798 7:130668394-130668416 GCGCGCGCGGGCGCCGGGGCGGG + Intronic
1033300018 7:140177054-140177076 GCGCGCGAGGCCGCGGCGGCTGG + Intergenic
1033794987 7:144835928-144835950 CCGGGCGCGCGGGCCGCGGAAGG - Intronic
1034147330 7:148884472-148884494 GTGCGCGCGCGGGCGGCGGCGGG + Intergenic
1034223031 7:149460277-149460299 GGCCGCGCGCGAGCCCCGGCGGG - Intronic
1034262398 7:149765145-149765167 GCACGCGCGGGTGCCGCGCCAGG + Exonic
1034446192 7:151115397-151115419 GGGTGCGCGCGCGCGGCGGCCGG - Intronic
1034610829 7:152366884-152366906 GCGCCAGCTCGCGCCGCGTCTGG - Intronic
1034649219 7:152676177-152676199 GCGCGCGTGCGCACTGCGCCAGG + Intergenic
1035021391 7:155803092-155803114 CCGCGCGCACGGACCGCGGCGGG - Exonic
1037473873 8:19237561-19237583 GCCCGGGCGCTGGCCGCGGCTGG + Intergenic
1037822498 8:22141717-22141739 GAGCGGGCGCGCCCCGCGGCCGG + Exonic
1037900476 8:22685425-22685447 GCGCGCGCGCGCGCGCGCGCGGG + Intergenic
1037900478 8:22685429-22685451 GCGCGCGCGCGCGCGCGGGGAGG + Intergenic
1037900480 8:22685431-22685453 GCGCGCGCGCGCGCGGGGAGGGG + Intergenic
1038767911 8:30446845-30446867 GCGCGCGCGCGCGCGGTGGAGGG + Intronic
1041690086 8:60679360-60679382 CCGCGCGCCCCCGCCGCCGCCGG - Intronic
1043502973 8:80874375-80874397 GCGCGCGCGGGCTCGGCCGCCGG - Intronic
1044430721 8:92103389-92103411 GCGCGAGCGTGCGCCGGAGCCGG - Intergenic
1045063762 8:98427943-98427965 GCGCCCCCGCGCGGCGCGGGCGG + Exonic
1046547304 8:115668467-115668489 GGGCGCGGGCGCCCCTCGGCCGG - Intronic
1047423563 8:124727075-124727097 GCGCGCGCGCGCGTGGGGGCGGG - Intronic
1047961750 8:130016316-130016338 GGGCGCGCGCGCGGGCCGGCCGG + Intronic
1048214254 8:132480831-132480853 GCGCTAGGGCGCGCGGCGGCGGG + Exonic
1048345433 8:133571679-133571701 GCGCGCGCACTCACCACGGCTGG + Exonic
1048553894 8:135457347-135457369 GTGCGCAGGCGCGGCGCGGCAGG + Intergenic
1049145983 8:141001300-141001322 CCGCGCGCGTGCGCGGCAGCCGG + Intronic
1049452503 8:142669794-142669816 GCGGGCGCGCGGGGCGGGGCGGG - Intronic
1049788519 8:144462599-144462621 GAGCCCGCGGGCCCCGCGGCCGG + Intronic
1050472549 9:6008042-6008064 GGCCGTGCGCGCGCCGCCGCCGG - Intergenic
1051780497 9:20684124-20684146 GCGTGCGCGCGAGCCGGGGAGGG + Intronic
1056773946 9:89498075-89498097 GCGCGCGAGAGCGCTGAGGCCGG + Intronic
1056985678 9:91361952-91361974 GCGCGCACGCGCACGGCGTCCGG + Intergenic
1056992268 9:91423493-91423515 CCGCGCGCACTCGCCGCCGCTGG + Intronic
1057432163 9:95004731-95004753 GCGCGGGGGCGCGGGGCGGCCGG + Intronic
1057432187 9:95004783-95004805 GCGCGGGGGCGCGGGGCGGCCGG + Intronic
1057488722 9:95506375-95506397 GGGGGCGCGGGCGCCGCGGCGGG + Intronic
1057489562 9:95510851-95510873 GCGCGCGCGCGCCCGGCTCCCGG + Intronic
1057619125 9:96619458-96619480 GCGCGGGCGCTCGGGGCGGCGGG + Exonic
1058058549 9:100473238-100473260 GCGGGCGCGCGCGCGGCGGGCGG - Exonic
1058686988 9:107488497-107488519 GTGTGAGCGAGCGCCGCGGCTGG + Intronic
1059145632 9:111896984-111897006 GCGCGCTCGCGGGCGGCTGCGGG - Exonic
1059208262 9:112486801-112486823 GGGCGCGGGCGGGCCGGGGCGGG - Intronic
1060283373 9:122228490-122228512 GCGCGCGCGCGAGCGGGGGGGGG - Intronic
1060643861 9:125261775-125261797 GCGCGCGTGCGCAGCGCCGCGGG - Intronic
1060713024 9:125889738-125889760 GGGCGGGGGCGCGCCGCGGCGGG + Intronic
1060849268 9:126860901-126860923 GCGCGGGCGGGAGCCGAGGCCGG + Intronic
1061128218 9:128689759-128689781 GCGGGGGGGCGCGGCGCGGCCGG + Intronic
1061283647 9:129610606-129610628 GCGGGCGCGAGCGCCGCGCGAGG + Intronic
1061453513 9:130681668-130681690 GAGCGCGCCCGCGCCCCCGCCGG + Exonic
1061540903 9:131277478-131277500 TCGGGCGCGCTCGCCGCTGCCGG + Intergenic
1061976103 9:134068539-134068561 GAGCGCGCGCGCGGGGCGGGGGG + Intergenic
1062022576 9:134326389-134326411 GGGCGCGGGCGCGCGGCGGCGGG + Intronic
1062162401 9:135087631-135087653 CTGCGCGCGGGGGCCGCGGCCGG - Intronic
1062277183 9:135736607-135736629 GCGGGAGCGCTCGGCGCGGCGGG - Intronic
1062435662 9:136545641-136545663 CGGCGCGCGCGCCCCACGGCTGG - Intronic
1062462016 9:136666069-136666091 GGGCGGGCGGGCGGCGCGGCGGG + Intronic
1062567463 9:137169709-137169731 GCGCCTGCGCGCGCTGCTGCTGG - Exonic
1062696511 9:137878601-137878623 GCGCACGCACGCGCAGCGCCAGG - Intronic
1203468498 Un_GL000220v1:106658-106680 GCGCGCACGCGCGCACCGGCCGG + Intergenic
1203469175 Un_GL000220v1:108727-108749 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1203469238 Un_GL000220v1:108915-108937 GCGGGCGCGGGGGCGGCGGCCGG - Intergenic
1203471221 Un_GL000220v1:116276-116298 GGCTGGGCGCGCGCCGCGGCTGG + Intergenic
1203471789 Un_GL000220v1:118423-118445 GCGCGCGCGCGCGCGCGTGCGGG + Intergenic
1203476319 Un_GL000220v1:150630-150652 GCGCGCACGCGCGCACCGGCCGG + Intergenic
1203476996 Un_GL000220v1:152699-152721 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1203477059 Un_GL000220v1:152887-152909 GCGGGCGCGGGGGCGGCGGCCGG - Intergenic
1203479042 Un_GL000220v1:160248-160270 GGCTGGGCGCGCGCCGCGGCTGG + Intergenic
1185457610 X:318669-318691 GCGCGCGCGCTAGCCGCTGTCGG - Exonic
1187172995 X:16869995-16870017 GCGCGCGCCGGGGCCGCGGGGGG - Intronic
1189281126 X:39820926-39820948 GCCGGGGCGCGCGCCGAGGCGGG + Intergenic
1189324949 X:40106359-40106381 GCGCGGGCTCGGGCCGCGGGCGG + Intronic
1189821326 X:44872779-44872801 CCGCTCGCGCCCGCCGCGGGCGG + Intergenic
1190845018 X:54183275-54183297 GCGCGTGCGCACTCCGCGGGGGG + Intronic
1193085859 X:77447622-77447644 GGGCGCGCGCGGGCCGAGCCGGG - Intergenic
1195668288 X:107449719-107449741 GCGCGCGCGGGCTCCTCGGGCGG - Intergenic
1195954888 X:110318182-110318204 GGGCGCGCGCGCGCCGCTCCCGG + Exonic
1196443293 X:115732805-115732827 GCGCGGGTGCCCGCCGCTGCTGG + Intergenic
1196444229 X:115737132-115737154 GCGCGGGTGCCCGCCGCTGCTGG - Intergenic
1197873548 X:131082390-131082412 GCGGGCGCGGGGGCGGCGGCAGG + Intronic
1198388021 X:136147324-136147346 GCGCGCGCGCGGGAGACGGCCGG - Intergenic
1200100756 X:153688304-153688326 GGGGGCGCGCGGGCGGCGGCGGG - Exonic
1200128999 X:153830913-153830935 GCGAGCGCGCCCACGGCGGCGGG + Intergenic
1200138512 X:153886185-153886207 GCGGGCGTGCGCGCAGGGGCGGG + Intronic
1200229438 X:154436843-154436865 GGGCGCGCGCGGGGCGGGGCGGG + Intergenic
1200249882 X:154547175-154547197 GCGCGCGAGGCCGCCGGGGCAGG - Exonic
1200306069 X:155027084-155027106 GCGCGCGCGGCCGGCGCCGCGGG + Intronic