ID: 914869120

View in Genome Browser
Species Human (GRCh38)
Location 1:151458811-151458833
Sequence GCGCGCGCGCGCGCCGCGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 600
Summary {0: 1, 1: 0, 2: 5, 3: 90, 4: 504}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914869108_914869120 28 Left 914869108 1:151458760-151458782 CCGAGCGTGCGTGTGGACGTCGG 0: 1
1: 0
2: 0
3: 1
4: 27
Right 914869120 1:151458811-151458833 GCGCGCGCGCGCGCCGCGGCGGG 0: 1
1: 0
2: 5
3: 90
4: 504
914869117_914869120 -8 Left 914869117 1:151458796-151458818 CCGTGGGGCGCGAGTGCGCGCGC 0: 1
1: 0
2: 0
3: 7
4: 77
Right 914869120 1:151458811-151458833 GCGCGCGCGCGCGCCGCGGCGGG 0: 1
1: 0
2: 5
3: 90
4: 504

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914869120 Original CRISPR GCGCGCGCGCGCGCCGCGGC GGG Intronic