ID: 914879944

View in Genome Browser
Species Human (GRCh38)
Location 1:151539525-151539547
Sequence ATGGCTTCTTCACTTGGCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 284
Summary {0: 1, 1: 0, 2: 3, 3: 22, 4: 258}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914879944_914879947 -5 Left 914879944 1:151539525-151539547 CCACAGCCAAGTGAAGAAGCCAT 0: 1
1: 0
2: 3
3: 22
4: 258
Right 914879947 1:151539543-151539565 GCCATCTGCCAAGAGCAGCTGGG 0: 1
1: 0
2: 1
3: 29
4: 223
914879944_914879950 -1 Left 914879944 1:151539525-151539547 CCACAGCCAAGTGAAGAAGCCAT 0: 1
1: 0
2: 3
3: 22
4: 258
Right 914879950 1:151539547-151539569 TCTGCCAAGAGCAGCTGGGCGGG 0: 1
1: 0
2: 7
3: 55
4: 341
914879944_914879951 0 Left 914879944 1:151539525-151539547 CCACAGCCAAGTGAAGAAGCCAT 0: 1
1: 0
2: 3
3: 22
4: 258
Right 914879951 1:151539548-151539570 CTGCCAAGAGCAGCTGGGCGGGG 0: 1
1: 0
2: 3
3: 50
4: 473
914879944_914879954 14 Left 914879944 1:151539525-151539547 CCACAGCCAAGTGAAGAAGCCAT 0: 1
1: 0
2: 3
3: 22
4: 258
Right 914879954 1:151539562-151539584 TGGGCGGGGACGAAGCTCCAGGG 0: 1
1: 0
2: 1
3: 9
4: 105
914879944_914879953 13 Left 914879944 1:151539525-151539547 CCACAGCCAAGTGAAGAAGCCAT 0: 1
1: 0
2: 3
3: 22
4: 258
Right 914879953 1:151539561-151539583 CTGGGCGGGGACGAAGCTCCAGG 0: 1
1: 0
2: 2
3: 16
4: 147
914879944_914879955 24 Left 914879944 1:151539525-151539547 CCACAGCCAAGTGAAGAAGCCAT 0: 1
1: 0
2: 3
3: 22
4: 258
Right 914879955 1:151539572-151539594 CGAAGCTCCAGGGTCCTGCTTGG 0: 1
1: 0
2: 0
3: 13
4: 157
914879944_914879949 -2 Left 914879944 1:151539525-151539547 CCACAGCCAAGTGAAGAAGCCAT 0: 1
1: 0
2: 3
3: 22
4: 258
Right 914879949 1:151539546-151539568 ATCTGCCAAGAGCAGCTGGGCGG 0: 1
1: 0
2: 0
3: 19
4: 233
914879944_914879946 -6 Left 914879944 1:151539525-151539547 CCACAGCCAAGTGAAGAAGCCAT 0: 1
1: 0
2: 3
3: 22
4: 258
Right 914879946 1:151539542-151539564 AGCCATCTGCCAAGAGCAGCTGG 0: 1
1: 0
2: 1
3: 25
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914879944 Original CRISPR ATGGCTTCTTCACTTGGCTG TGG (reversed) Intergenic
900160305 1:1220150-1220172 AAGGCTTCTTCACCAGCCTGAGG - Intronic
901492146 1:9602083-9602105 ATGCCTTCTGCACCTGCCTGTGG + Exonic
902112661 1:14095684-14095706 ATGGCTTCTTCATGTGGCTTGGG + Intergenic
903404354 1:23083912-23083934 TAGGCTTCCTCACTTGGGTGGGG + Intergenic
903530675 1:24027944-24027966 ATAGCTTCTTCAGGAGGCTGAGG + Intergenic
905468268 1:38172384-38172406 ATGGCCTCTCCACGTGGCTTGGG + Intergenic
908235759 1:62146096-62146118 TTGGCTTCTTCACTACTCTGAGG - Intronic
910063791 1:83126398-83126420 ATTGCTTCATCTCTTGGCAGAGG - Intergenic
910451175 1:87347196-87347218 AAGGCTTCATCACTTGCATGTGG - Exonic
912821847 1:112874255-112874277 AGGGCTTCCTCTCTGGGCTGTGG + Intergenic
912930507 1:113954951-113954973 ATTGCTAGTTCAGTTGGCTGAGG + Intronic
912968083 1:114254276-114254298 TAGGCTTATTCACTTGGCAGTGG + Intergenic
914879944 1:151539525-151539547 ATGGCTTCTTCACTTGGCTGTGG - Intergenic
916541447 1:165759258-165759280 GTGGCTTTTGAACTTGGCTGAGG - Intronic
916594648 1:166232647-166232669 AAGGCTTCATAACTGGGCTGAGG - Intergenic
916757334 1:167785343-167785365 TTGGCTTCTTCACATGGTAGTGG + Intronic
916767640 1:167876990-167877012 TTGGCTTATTCACGTGCCTGGGG - Intronic
917068095 1:171119664-171119686 AGGGCTACTTCACTTGACTTAGG - Intergenic
922210130 1:223479922-223479944 ATGCCTTGCTCACCTGGCTGTGG + Intergenic
1063396302 10:5691403-5691425 ATGACTTTTTCATTTAGCTGTGG - Intronic
1066785264 10:38996394-38996416 ATGGCTTCCTCACTTGTTGGTGG + Intergenic
1067238292 10:44469800-44469822 CTGGCTTCCTCACTTGGTTCAGG - Intergenic
1067371785 10:45690888-45690910 ATGGCTTCCTCACTTGTTGGTGG + Intergenic
1067387996 10:45835261-45835283 ATGGCTTCCTCACTTGTTGGTGG - Intronic
1067418125 10:46122019-46122041 ATGGCTTCCTCACTTGTTGGTGG + Intergenic
1067446269 10:46349340-46349362 ATGGCTTCCTCACTTGTTGGTGG + Intergenic
1067503484 10:46828582-46828604 ATGGCTTCCTCACTTGTTGGTGG + Intergenic
1067591109 10:47511431-47511453 ATGGCTTCCTCACTTGTTGGTGG - Intronic
1067638228 10:48019523-48019545 ATGGCTTCCTCACTTGTTGGTGG - Intergenic
1067732532 10:48822391-48822413 GCAGCTTCTGCACTTGGCTGAGG - Exonic
1067875267 10:50000838-50000860 ATGGCTTCCTCACTTGTTGGTGG + Intronic
1070134832 10:73683949-73683971 ATGGCTTCCTCACTTGTTGGTGG - Intronic
1070191203 10:74113431-74113453 CTGGAGTCTTCACTTAGCTGAGG + Intronic
1070638936 10:78152191-78152213 TTGGCTTTTTGACTTGGCAGTGG + Intergenic
1071086475 10:81873819-81873841 CTGCTTTCTTCCCTTGGCTGGGG - Intergenic
1071547876 10:86542292-86542314 ATGACTTGATCACTTGGCTGAGG - Intergenic
1075530986 10:123229702-123229724 TTGGCTACTGGACTTGGCTGTGG - Intergenic
1076907388 10:133369930-133369952 CTGGCTTCTTGACCTGGGTGAGG + Exonic
1077241712 11:1514009-1514031 AGGGTTTTTTCTCTTGGCTGAGG + Intergenic
1078090315 11:8261006-8261028 ATGGCATCTTCAATTGGGGGAGG - Intronic
1079587945 11:22149599-22149621 AGGGCTTCTGCAGTTTGCTGGGG + Intergenic
1079935338 11:26609151-26609173 CTGGCTGCCTCCCTTGGCTGGGG + Intronic
1080287171 11:30628785-30628807 CTGTTTTCTTCACTAGGCTGGGG - Intergenic
1080524567 11:33101724-33101746 ATTGCTTTTTCTCTTGACTGTGG - Intronic
1080895910 11:36448695-36448717 AGGGCTTCTTCTCTTGGCAGAGG + Intronic
1081499262 11:43649882-43649904 AGGGCTTCTTCACTTGCCTTTGG - Intronic
1081784150 11:45734566-45734588 GTGGCTTCTCCACATGGCTTGGG - Intergenic
1084097110 11:66918835-66918857 GGGCCTTCTTCACTGGGCTGGGG - Intronic
1085416665 11:76322889-76322911 ATGGCTTCTTTCCTTGCCTAGGG - Intergenic
1086649128 11:89265383-89265405 CTGCCTTCGCCACTTGGCTGTGG + Intronic
1087406060 11:97732203-97732225 AGGGCTGCTACAGTTGGCTGGGG - Intergenic
1091249118 11:134127184-134127206 CTGGCTCCATCACTTGGCTGTGG + Intronic
1091813357 12:3418163-3418185 AACTCTTCTGCACTTGGCTGGGG - Intronic
1094058144 12:26286805-26286827 ATGGCCTATTCAGTTGGGTGAGG + Intronic
1094508452 12:31081293-31081315 ATGGCTGCTTCTATGGGCTGCGG - Intronic
1095404819 12:41856375-41856397 ATGGACTTTCCACTTGGCTGGGG - Intergenic
1095508231 12:42921246-42921268 AGGGCTTCTCCACATGGCTTGGG - Intergenic
1096206375 12:49725606-49725628 ATGGCCTCTTCAAGTGGCTTGGG + Intronic
1096409936 12:51369623-51369645 TTGCCATCTTCACTTGGATGTGG + Intronic
1096680412 12:53252087-53252109 ATGGCTTCATCACGTGACGGGGG - Intronic
1098441320 12:70522305-70522327 ATGGCTTGTTCACATGGCTGTGG - Intronic
1101299764 12:103467021-103467043 ATGGCTCCCTCACATGTCTGTGG - Intronic
1101548758 12:105742017-105742039 CTGACTCATTCACTTGGCTGTGG + Intergenic
1101670877 12:106871797-106871819 ATGGCTCCTTCTTTTGACTGAGG - Intronic
1102504595 12:113375692-113375714 ATGGCCTCTTCTCCTGTCTGGGG + Intronic
1102534069 12:113567990-113568012 ATGGCTTCTTTTCTTGGCTGAGG - Intergenic
1102601744 12:114036709-114036731 ATAGCTGCTCCCCTTGGCTGGGG + Intergenic
1103099438 12:118159754-118159776 CTGTCTTCCTCACTTGACTGTGG + Intronic
1104698195 12:130880279-130880301 ATGACTTCTTCCCTTGGTAGGGG - Intergenic
1106554487 13:30798105-30798127 AGGGTTTCTTCACCTGTCTGTGG - Intergenic
1106765887 13:32913656-32913678 CTGGCTTCTTACCTTGGCCGTGG + Intergenic
1110073251 13:71206175-71206197 ATGGCCTCTCCAGGTGGCTGAGG + Intergenic
1111289979 13:86153561-86153583 ATGCCTTCCTCACATGTCTGTGG - Intergenic
1115697409 14:35914042-35914064 TTGGCTTCTTCCCTTTTCTGGGG + Intronic
1116498338 14:45589911-45589933 ATGGCTACTTCAAGTGTCTGGGG + Intergenic
1117659591 14:57989574-57989596 ATGGCTTCTTCACATCCCTCAGG + Intergenic
1119726418 14:76924396-76924418 ATGGCTTCTTCTCTGGGGTGGGG + Intergenic
1119941222 14:78643754-78643776 AAGGCTTCTCCATTAGGCTGGGG - Intronic
1122955209 14:105067226-105067248 CTGGCTTCTCCACCTGGCAGGGG - Intergenic
1123928143 15:25139147-25139169 ATGGCTTCCTGTCTTCGCTGGGG - Intergenic
1125484019 15:40100023-40100045 ATGGCTTTTTCACTTGGACCAGG - Intronic
1126163194 15:45632633-45632655 AGGGCTTCTTGGCTTGGATGTGG + Intronic
1126373878 15:47975195-47975217 TCGGCTACTTCCCTTGGCTGGGG + Intergenic
1127077720 15:55344352-55344374 AGGGCTTGTTCACTTGGCATAGG + Intronic
1128561243 15:68669264-68669286 ATGGCCTGTTCACTGTGCTGAGG + Intronic
1128617790 15:69123720-69123742 ATGGCTCACTCACATGGCTGCGG + Intergenic
1129667027 15:77584972-77584994 AGGGCATGGTCACTTGGCTGGGG + Intergenic
1133222625 16:4325253-4325275 ATGGCTTCTGGACTTACCTGGGG + Intronic
1134470702 16:14522733-14522755 TTGCCTTCTTCACTTGGAGGGGG - Intronic
1134487817 16:14672495-14672517 GTGGCTTTATCACTTGGCTTCGG + Intergenic
1135497902 16:22968716-22968738 ATGGCTTCTTCATGTGGCTTGGG - Intergenic
1137364075 16:47845478-47845500 AAGGCTTCTACACTTGGGTAAGG + Intergenic
1137552250 16:49445629-49445651 AGGGCGTCTTGGCTTGGCTGGGG - Intergenic
1137693294 16:50444789-50444811 ATGGCTTCTCCATGTGGCTTAGG - Intergenic
1141923144 16:87149709-87149731 GTGGCTCCCTCACATGGCTGTGG - Intronic
1142647389 17:1323529-1323551 ATGGCTTCTTAACTTCCTTGGGG - Intergenic
1143309346 17:5975673-5975695 CTGGATGCTTCACTTGGCTCTGG - Intronic
1143353968 17:6310813-6310835 ATGGCATCTTCACTTAGGGGAGG - Intergenic
1143690011 17:8553737-8553759 ATAACTTATTCACATGGCTGGGG - Intronic
1143853863 17:9834077-9834099 ATGGCCTCTACACTTGGCCGGGG + Intronic
1146797056 17:35789368-35789390 AGAGTTCCTTCACTTGGCTGCGG - Intronic
1147386299 17:40084309-40084331 AGGGCATCTTCCATTGGCTGGGG + Intronic
1149393479 17:56215580-56215602 ATAGGTTTTTCACTTGGCAGAGG + Intronic
1151481980 17:74374970-74374992 ATGCCTTCCTCAGCTGGCTGGGG + Intergenic
1151902716 17:77027571-77027593 ATGGCTCCCTCACATAGCTGTGG - Intergenic
1155013837 18:21812034-21812056 AAGTCTTTTTTACTTGGCTGTGG - Intronic
1155117402 18:22783512-22783534 AAGGCTTCTGCAGTTTGCTGGGG + Intergenic
1155334201 18:24748426-24748448 TTGACCTTTTCACTTGGCTGAGG + Intergenic
1155465495 18:26130618-26130640 ATCTATTCTACACTTGGCTGTGG - Intergenic
1156242754 18:35269308-35269330 ATTGTTTCTTCACCTTGCTGGGG - Intronic
1157644203 18:49250644-49250666 GTGGCTTCTTCAACTTGCTGAGG - Intronic
1160674153 19:379917-379939 AAGGCGTCTTCATTTAGCTGAGG + Intergenic
1162069028 19:8142728-8142750 TTGGCTTCTTCTCTTGGGAGCGG - Intronic
1162716833 19:12639697-12639719 AAGGCTTCCTGGCTTGGCTGTGG - Intronic
1163729139 19:18939883-18939905 TTGTCTTTTTAACTTGGCTGGGG - Intronic
1165152064 19:33766745-33766767 TTGGCTGCTTCTCTTGGCTCAGG - Intronic
1165419478 19:35715865-35715887 ATGGTGTCTTCTCTGGGCTGGGG + Intronic
1166899022 19:46044103-46044125 CTCACTGCTTCACTTGGCTGGGG - Intronic
1167579958 19:50335413-50335435 GAGACTTCTTCATTTGGCTGTGG + Intronic
1167739759 19:51317382-51317404 ATGCCTTCCTCACTGGGTTGTGG - Intronic
925678524 2:6391795-6391817 GGGGCTTCTTCTCTTGGTTGTGG - Intergenic
927129863 2:20049931-20049953 ATAGCTTCTCCATTTTGCTGAGG - Intronic
927203811 2:20594470-20594492 ATGGCTCCTTCCCTATGCTGGGG + Intronic
928093280 2:28389590-28389612 ATGGCCTCTTCTCTAAGCTGAGG + Intergenic
928433683 2:31240035-31240057 ATCCCTTCATCACATGGCTGAGG + Intronic
928663139 2:33524005-33524027 ATGACTTCTGCCCTTTGCTGGGG - Exonic
929292851 2:40213289-40213311 AAGGCTATTTCCCTTGGCTGTGG - Intronic
930552371 2:52852131-52852153 AGGGCTGCTGCACTTTGCTGGGG + Intergenic
931632068 2:64310693-64310715 ATCTCTGCTTCTCTTGGCTGAGG - Intergenic
932888851 2:75572688-75572710 ATGGCTTTTCCATTTGGCTTGGG - Intergenic
938245049 2:129769794-129769816 ATGGCTGCTTGACTTGGGAGTGG - Intergenic
939176230 2:138750917-138750939 CTGGCTTCTTCACTTCACTCTGG + Intronic
939509803 2:143091432-143091454 AGGGCATCTTCACTGGGATGGGG + Intronic
942802618 2:179892987-179893009 ATGGCTTCTTCACTTGTGTCTGG + Intergenic
944269049 2:197760405-197760427 ATGGCTCCTTCGCTGGCCTGGGG - Intronic
944324376 2:198386628-198386650 GTGTCTTCTTGACTTGTCTGTGG + Intronic
945777915 2:214130345-214130367 ACAGCTCCCTCACTTGGCTGTGG + Intronic
947142882 2:227035798-227035820 ATGGCTTGGGGACTTGGCTGGGG + Intronic
1168843030 20:921872-921894 ATGGCCTCTTCATGTGGCTAGGG + Intergenic
1169501274 20:6163072-6163094 ATGGCTCCTTCACGTGGTTTGGG + Intergenic
1169740561 20:8889103-8889125 ATGGCTTTTTCACATGTCAGAGG + Intronic
1169794530 20:9447440-9447462 CAGGCTTGTTCACATGGCTGGGG + Intronic
1169846906 20:10003635-10003657 ATGGGTTTTTCACTTGGCCAGGG + Intronic
1169883914 20:10376723-10376745 ATGGCTTCTCCACCTGGCCTGGG - Intergenic
1170553344 20:17495618-17495640 ATCGCTTCTTCTCTTGGCCTGGG - Intronic
1173411867 20:42818253-42818275 AGGGCTTCTGCAGTTTGCTGGGG - Intronic
1175072797 20:56348586-56348608 ATGGCTTCCTGGCTTGGCAGGGG + Intergenic
1175136287 20:56826794-56826816 ATGGCTTCATCACTGTGCAGCGG + Intergenic
1175240962 20:57548550-57548572 TTGCCTTCTTCACTTGTCTAGGG - Intergenic
1175843629 20:62047560-62047582 ATGGGGTCTTCACTTGCCTGTGG - Intronic
1178981822 21:37270726-37270748 ATGGCTCCCTCACATGGCTGAGG + Intergenic
1179117669 21:38508946-38508968 ATGGCCTCGTCACATGGCTTGGG - Intronic
1180107773 21:45631089-45631111 AAAGCTTCTTCACTGGGATGCGG + Intergenic
1180226176 21:46393750-46393772 AGGGCTTCTTCCCAAGGCTGTGG + Intronic
1181418773 22:22781899-22781921 CTGTCTTCTCCACTTGGATGTGG - Intronic
1184186737 22:42869719-42869741 ATGCCCACTTCACTTGGCGGGGG - Intronic
1184477026 22:44727512-44727534 GTGGCTTCTTCACAGGGTTGTGG - Intronic
1184575785 22:45364700-45364722 AACGCTTCTTCACTTGGCTTTGG + Intronic
952568772 3:34687888-34687910 ATGGCTTCTTCATGTGACTTTGG - Intergenic
953870928 3:46627211-46627233 GTGGCTTCTTCCCTAGACTGTGG - Intergenic
953954749 3:47222873-47222895 ATGGCTGTTTCAATTGGTTGAGG + Intergenic
953983123 3:47422638-47422660 ATGGCTCCTTCAAAGGGCTGGGG - Intronic
956262924 3:67364434-67364456 ATGGCCTCTTTACTTGGGGGTGG - Intronic
956482434 3:69686704-69686726 ATAGCTATTTCACTTGGCTTGGG - Intergenic
956698634 3:71939717-71939739 ATGGCCTCTGCCCTTGGCTAGGG + Intergenic
956918602 3:73901498-73901520 ATGGCTTCATCATTTCACTGTGG + Intergenic
958095677 3:88941313-88941335 ATGGCAGTTTCACCTGGCTGGGG + Intergenic
960085323 3:113584363-113584385 CTGTTTTCTTCACATGGCTGTGG + Intronic
960989437 3:123301249-123301271 ACGGCTTCTGCCCTGGGCTGGGG + Intronic
961339397 3:126207392-126207414 ATGGCATCTCCACATGGCTTGGG + Intergenic
962072054 3:132043880-132043902 ATGTCTTCTTCACAGGGTTGAGG + Intronic
963416167 3:144998683-144998705 ATGGCTGCTGCAGTTTGCTGGGG + Intergenic
965707099 3:171520118-171520140 ATGGCTTCTTTACTTCTCTCTGG - Intergenic
965911651 3:173785157-173785179 CTGGCTTCTGCACTCGGCAGGGG + Intronic
966375852 3:179294808-179294830 TTGCCTTCTTCACTAGGGTGGGG + Intergenic
967269680 3:187722718-187722740 ATGGGTTCTTCACCTGGCCTTGG - Intronic
968914587 4:3491892-3491914 ACGGCTCCTGCACTTGGCCGTGG - Intronic
971574350 4:28254380-28254402 AGGGCTTCTGCAGTTTGCTGGGG - Intergenic
971669717 4:29542025-29542047 ATGCCTACTGCACGTGGCTGTGG + Intergenic
973785250 4:54326614-54326636 CTGCCTTCTTCCCTCGGCTGAGG + Intergenic
973846129 4:54914940-54914962 ATGCTTTCTCCACTAGGCTGTGG - Intergenic
976193945 4:82515229-82515251 ATGGGTTCCTCACTTAGCAGTGG + Intronic
977742378 4:100502227-100502249 ATGGGATCTTTACCTGGCTGGGG + Intronic
979628326 4:122871731-122871753 AGGGCTTCTGCAGTTTGCTGGGG - Intronic
980473153 4:133275499-133275521 ATGGCTTCTCCATGTGGCTTAGG + Intergenic
981570232 4:146143771-146143793 GTGGCTTCTTCACTCACCTGTGG - Intergenic
981843961 4:149145364-149145386 TTGAATTCTTCACTTGGATGTGG - Intergenic
982027613 4:151267026-151267048 ATGGCTTTTTCAGCTGGGTGTGG + Intronic
982280235 4:153676669-153676691 CAGGCTTTTTCACTTGTCTGTGG + Intergenic
982848095 4:160276478-160276500 CTCGCTGCTTCCCTTGGCTGGGG - Intergenic
984974051 4:185214628-185214650 ATGCTTTCTTCACATGGCAGTGG - Intronic
985662225 5:1162947-1162969 TTGGCATCCTCACTAGGCTGGGG - Intergenic
985798601 5:1985394-1985416 ATGGGTTCTGCACCTGGCTATGG - Intergenic
987858056 5:23447274-23447296 CTAGCTTCTTCTCTTCGCTGTGG - Intergenic
988164453 5:27566954-27566976 ATGTCTACTTTACTGGGCTGTGG - Intergenic
988533436 5:32044611-32044633 TTGGCTTTTTCAAGTGGCTGGGG - Intronic
988865958 5:35335296-35335318 ATGGCTCACTCACTTGCCTGTGG + Intergenic
990858413 5:60298063-60298085 ATGAATTCATCATTTGGCTGTGG + Intronic
992262510 5:74985526-74985548 ATATCTTCTTAACTTGTCTGAGG - Intergenic
994960697 5:106598207-106598229 TTGACTCCATCACTTGGCTGAGG - Intergenic
995145765 5:108785812-108785834 TGGCCTTCTTCACTTGGGTGAGG + Intronic
995271143 5:110220595-110220617 AGGGCTGCTTCACTGTGCTGGGG + Intergenic
996396668 5:123020891-123020913 ATGGCTCATTCACATGACTGAGG + Intronic
998419462 5:141970174-141970196 TAGGCTTCTTCACTGGGGTGAGG - Intronic
1000692179 5:164337563-164337585 CTGGCTTTTTCAGTTGGCTCAGG + Intergenic
1007223845 6:40299294-40299316 GTGGCTTCTGCAATTGGCTGAGG + Intergenic
1007973275 6:46074698-46074720 ATGGTTTCTAGATTTGGCTGTGG - Intronic
1008488900 6:52064942-52064964 GTGGCTTCCTTACCTGGCTGAGG + Exonic
1011219723 6:85041421-85041443 ATAGGTTGTTCACTTGGCTCTGG + Intergenic
1013692111 6:112658044-112658066 ATGGTTTATTCACTGGGCTGTGG + Intergenic
1015515570 6:134079683-134079705 ATGGGCTTTCCACTTGGCTGGGG - Intergenic
1015889463 6:137955238-137955260 AGGGTTTCCTCACTTGGCTTTGG - Intergenic
1016006870 6:139098355-139098377 ATGACTTGATCACCTGGCTGAGG + Intergenic
1016639747 6:146335193-146335215 AAGGCTTCAAAACTTGGCTGTGG + Intronic
1016992246 6:149938402-149938424 CTGGTTTCTCCACTGGGCTGGGG - Intergenic
1017007480 6:150038210-150038232 CTGGTTTCTCCACTGGGCTGGGG + Intergenic
1017109617 6:150919971-150919993 ATGGCATACTCACATGGCTGTGG + Intronic
1017595955 6:156028687-156028709 AGATCTTCTTCACTTGGCTGTGG - Intergenic
1020674324 7:11162600-11162622 ATGCCCTCTTCAGATGGCTGTGG + Intronic
1021474913 7:21049976-21049998 ATGGCTTCTCCATGTGGCTTGGG + Intergenic
1021696031 7:23277185-23277207 TTGGCTACTTCACAGGGCTGCGG + Intergenic
1021903040 7:25306505-25306527 AAGCCTTCTCCAGTTGGCTGGGG - Intergenic
1022589586 7:31648901-31648923 ATGGCTAGTTAACTTGTCTGTGG - Intronic
1023119890 7:36898866-36898888 ATCGCGTCTTCCCTTGGGTGAGG - Intronic
1023561175 7:41474695-41474717 ATGGCTTGCTCATGTGGCTGTGG - Intergenic
1023864113 7:44230755-44230777 GTGGCTTCCTCACTTGGATGCGG + Intronic
1024531693 7:50398962-50398984 TTGGCTTCTTCAATTAGCTTTGG - Intronic
1024640992 7:51328387-51328409 ATGGCTTCTACACTTCTCAGTGG + Intergenic
1025941851 7:66080982-66081004 AGGGCTTCTGGACTTGGCTCTGG - Intronic
1026233823 7:68509028-68509050 ATGGCCTCTTCACATGGCTTGGG - Intergenic
1026233849 7:68509224-68509246 ATGGCTTCTCCACATGGCTTGGG - Intergenic
1026233865 7:68509322-68509344 ATGGCCTCTTCATGTGGCTTGGG - Intergenic
1026233875 7:68509374-68509396 ATGGCTTCTCCACATTGCTCGGG - Intergenic
1026233933 7:68509731-68509753 ATGGCCTCTCCACGTGGCTTGGG - Intergenic
1026336524 7:69398562-69398584 TTGGCTTCTTTCCTTGGCTCTGG - Intergenic
1027992456 7:85380010-85380032 ATGGCTTCTCTATGTGGCTGAGG + Intergenic
1031691819 7:124797904-124797926 ATGGCTTCTTCACTCCATTGAGG - Intergenic
1032497061 7:132370384-132370406 ATGGTTTCTTGACTTGGACGTGG + Intronic
1032912097 7:136444604-136444626 ATTGTTTCTTAACCTGGCTGCGG - Intergenic
1034391741 7:150792554-150792576 ATGGCTTCTCCACTTGGCTTGGG - Intronic
1034907708 7:154965245-154965267 ATGGTTCCGTCACATGGCTGTGG - Intronic
1035034743 7:155887347-155887369 GGAGCTTCTGCACTTGGCTGTGG + Intergenic
1037128239 8:15375978-15376000 ATGACTTGGTCACCTGGCTGAGG + Intergenic
1037302773 8:17470104-17470126 ATGGCTTCTTGAACTGGCAGTGG + Intergenic
1038496011 8:28003270-28003292 ATGTCTTCTCCCCTTGGATGTGG - Intergenic
1040496821 8:47973026-47973048 CTGGCTTCCTCACTTAGCCGCGG - Exonic
1042289108 8:67149090-67149112 ATGGCTCCCTCACATGGCTCAGG + Intronic
1042644257 8:70968698-70968720 AGGGCTTCTGCAGTTTGCTGGGG + Intergenic
1043951917 8:86318896-86318918 ATAGCTTCTCCACTTGGCTTGGG - Intronic
1044356047 8:91224447-91224469 AGGGCTGCTGCAGTTGGCTGGGG + Intronic
1045321541 8:101085560-101085582 ATGGCCTCTACACATGGCTTTGG - Intergenic
1047744870 8:127837224-127837246 ATGGCCTCTTCTCTTGCATGTGG - Intergenic
1047861394 8:128971069-128971091 ATGTCTTCGTCATTTGTCTGTGG + Intergenic
1049302942 8:141881336-141881358 ATGGCTCATTCATGTGGCTGTGG + Intergenic
1050773074 9:9227769-9227791 ATGGCTCATTCACATGGCTATGG - Intronic
1052133783 9:24885143-24885165 ATGGATTCTTCTCTTTACTGGGG - Intergenic
1052225852 9:26085024-26085046 ATTGCTTTTTCTCTTGACTGTGG - Intergenic
1053291888 9:36885695-36885717 ATGCCTTCTTCATAAGGCTGTGG + Intronic
1055968004 9:81884038-81884060 AAGCCTTCCTCACTTGGCTCAGG + Intergenic
1056331330 9:85523412-85523434 ATGGCTTCTCCACGTGGCTTGGG + Intergenic
1056568240 9:87793708-87793730 ATGGCTCCTGCATTTGGGTGAGG + Intergenic
1057913320 9:99036697-99036719 ATGTGCTCTGCACTTGGCTGGGG - Intronic
1057916441 9:99059286-99059308 ATTTCTTCTTCCCTGGGCTGCGG - Intronic
1058744559 9:107977026-107977048 ATCACTTCTGCACTTGGCTGAGG - Intergenic
1058832738 9:108833469-108833491 ATTACTTCTTTACCTGGCTGGGG + Intergenic
1060048539 9:120359912-120359934 TTGGGTTCTTTTCTTGGCTGTGG - Intergenic
1060716539 9:125935545-125935567 TTGGCTTCTTCACTGGGGTAGGG - Exonic
1060820324 9:126658141-126658163 CTGACCTCTGCACTTGGCTGGGG - Intronic
1186065122 X:5755172-5755194 ATGTATTGTTCACTTAGCTGTGG - Intergenic
1186329849 X:8520098-8520120 GTGTCTTCTTCACTTGGCATAGG + Intergenic
1186410893 X:9343330-9343352 GGGGCTTCTTCACTTCGCTGTGG + Intergenic
1187940407 X:24375582-24375604 ATGGCTACTTCACAGGGCTTAGG + Intergenic
1188897094 X:35682618-35682640 ATGGCTTCTCCACGTGGCCCAGG - Intergenic
1192890285 X:75383425-75383447 ATGTCCTCTTCACTTAGCTTGGG + Intronic
1192950236 X:76009126-76009148 AGGGCTGCTTCAGTTTGCTGGGG + Intergenic
1193022052 X:76801543-76801565 ATGGCTTCTTCCCTAGGCGATGG - Intergenic
1193048284 X:77076402-77076424 AGGGCTGCTGCAGTTGGCTGGGG + Intergenic
1193270866 X:79529680-79529702 AGGGCTTCTGCAGTTTGCTGGGG + Intergenic
1194263902 X:91733056-91733078 AGGGCTTCTGCAGTTTGCTGGGG + Intergenic
1194281281 X:91957519-91957541 ATGGCTGCTGCAATTTGCTGGGG + Intronic
1197363523 X:125536195-125536217 TTGCCTTCTTCCCTTGCCTGTGG - Intergenic
1197782707 X:130172985-130173007 ATATCTTCTTTACTTGTCTGGGG + Intronic
1199497434 X:148468557-148468579 ATGGTTTCTCCTCTTGCCTGAGG - Intergenic
1200598871 Y:5182175-5182197 ATGGCTGCTGCAGTTTGCTGGGG + Intronic