ID: 914880040

View in Genome Browser
Species Human (GRCh38)
Location 1:151540121-151540143
Sequence ATTTACACAAAGGTGGGGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 231}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914880040_914880045 -5 Left 914880040 1:151540121-151540143 CCAAGCCCCACCTTTGTGTAAAT 0: 1
1: 0
2: 2
3: 20
4: 231
Right 914880045 1:151540139-151540161 TAAATCTATGCGAGCACCGATGG 0: 1
1: 0
2: 0
3: 0
4: 15
914880040_914880046 -4 Left 914880040 1:151540121-151540143 CCAAGCCCCACCTTTGTGTAAAT 0: 1
1: 0
2: 2
3: 20
4: 231
Right 914880046 1:151540140-151540162 AAATCTATGCGAGCACCGATGGG 0: 1
1: 0
2: 0
3: 0
4: 18
914880040_914880049 16 Left 914880040 1:151540121-151540143 CCAAGCCCCACCTTTGTGTAAAT 0: 1
1: 0
2: 2
3: 20
4: 231
Right 914880049 1:151540160-151540182 GGGGCATGTCCCAGACCCATTGG 0: 1
1: 0
2: 1
3: 11
4: 123
914880040_914880047 -3 Left 914880040 1:151540121-151540143 CCAAGCCCCACCTTTGTGTAAAT 0: 1
1: 0
2: 2
3: 20
4: 231
Right 914880047 1:151540141-151540163 AATCTATGCGAGCACCGATGGGG 0: 1
1: 0
2: 0
3: 1
4: 23

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914880040 Original CRISPR ATTTACACAAAGGTGGGGCT TGG (reversed) Intergenic
901183937 1:7360101-7360123 ACTTATAAAAAGGTGGGGGTTGG - Intronic
901902770 1:12380062-12380084 ACATACACAAATGCGGGGCTGGG - Intronic
902559422 1:17267706-17267728 GTTTTCACAAAGCTAGGGCTGGG + Intronic
902839618 1:19066801-19066823 CTTCACCCAAAGGAGGGGCTTGG - Intergenic
904824652 1:33266440-33266462 ATTAATACAAAGGTGGGGTAGGG + Intronic
905675171 1:39819603-39819625 ATTTTCTCAACGGTGGGGCTGGG + Intergenic
907473570 1:54690332-54690354 ATTTTCACAAAAGTGAGCCTGGG - Intronic
907712598 1:56898147-56898169 ATTCACTCAAAGGTTGGACTCGG + Intronic
908310830 1:62881239-62881261 ATTTAGACAATGGTGGGTATGGG + Intergenic
909398730 1:75200202-75200224 ATTAAAACAAATGTGAGGCTGGG - Intergenic
909818103 1:80022801-80022823 ATTTCCACAAACTTGGGGCTAGG + Intergenic
911139430 1:94482839-94482861 ATGTACAGAAAGGCAGGGCTGGG - Intronic
911680870 1:100713702-100713724 AGTTACACAAATGTGAGGCTGGG + Intergenic
914880040 1:151540121-151540143 ATTTACACAAAGGTGGGGCTTGG - Intergenic
918386673 1:184015006-184015028 ATTAACACAGACATGGGGCTGGG + Intronic
918463246 1:184796938-184796960 GTCTACACAAAGGAAGGGCTCGG - Intronic
919651269 1:200151072-200151094 AATTCTAGAAAGGTGGGGCTGGG + Intronic
920293713 1:204942778-204942800 ATATACACAAAGTTGAGGTTTGG + Intronic
920315536 1:205073592-205073614 CTTGCCACAAGGGTGGGGCTAGG + Intronic
920961906 1:210671145-210671167 ATTTACACAATGCTAGGCCTGGG - Intronic
922029619 1:221785376-221785398 ATATACAAAAAGGATGGGCTTGG + Intergenic
922554262 1:226521039-226521061 TTCTACACACAGGTGGGACTTGG - Intergenic
923191661 1:231626401-231626423 ATTTATACAAAGTGGGGGCGGGG - Intronic
923420657 1:233811544-233811566 ATTTAAACAAAGGTATGGTTGGG + Intergenic
924417060 1:243867012-243867034 ATTTACAAAAAGCTGGGACTGGG - Intergenic
1062828509 10:588884-588906 ACTCACACAAACGTGGGGCCCGG - Intronic
1063032034 10:2245059-2245081 ATTTAAACACAAGTGGGGCTGGG - Intergenic
1063199930 10:3778469-3778491 AGTGTCACAAAGCTGGGGCTGGG - Exonic
1064124906 10:12651206-12651228 ATTTCATCAGAGGTGGGGCTTGG - Intronic
1066520647 10:36214435-36214457 ACTCACATAAAGGTGGGGGTGGG - Intergenic
1067771585 10:49130534-49130556 ATTTTCACAACTGTGGGGCAGGG + Intergenic
1069467656 10:68656245-68656267 TTTTCCACAGAGGTGGGGCCAGG - Intronic
1070770342 10:79078842-79078864 ATTAAAAAAAGGGTGGGGCTAGG - Intronic
1071684998 10:87745143-87745165 ATTTCCACAGAGGTGAGGCCAGG - Exonic
1073839159 10:107478400-107478422 ATTAACACAAGGGTAGGGATAGG + Intergenic
1075090635 10:119442318-119442340 CTTTGGACACAGGTGGGGCTGGG - Intronic
1075816556 10:125269163-125269185 TTTAAAAGAAAGGTGGGGCTGGG + Intergenic
1075827159 10:125368760-125368782 ATTTACACAACGGTAGTCCTTGG + Intergenic
1077071212 11:674411-674433 TTTTCCAGAAAGGTGGGGCAGGG + Intronic
1077580148 11:3412258-3412280 TTTTAAACAAAAATGGGGCTGGG + Intergenic
1077617134 11:3684277-3684299 ATGTTCAAAAAGTTGGGGCTTGG + Intronic
1077645369 11:3918804-3918826 ATTTACAGAAAGGTAGGTTTGGG + Intronic
1077900470 11:6483356-6483378 AATTACACAAAGTTGGGGGGCGG - Exonic
1078447002 11:11411998-11412020 ATTTCAAAAAAGGTAGGGCTTGG + Intronic
1078564817 11:12405174-12405196 AACAACAAAAAGGTGGGGCTGGG + Intronic
1078957114 11:16211473-16211495 ATTTACAAAAATATGGGGCAAGG + Intronic
1080604888 11:33857144-33857166 ATTAAAACACAGGTGGGGCACGG + Intergenic
1083160102 11:60849464-60849486 ATTTTCACAGGTGTGGGGCTGGG - Intronic
1084237072 11:67795085-67795107 TTTTAAACAAAAATGGGGCTGGG + Intergenic
1084544467 11:69807804-69807826 CCTTACACACAGGAGGGGCTGGG - Intergenic
1084835331 11:71797749-71797771 TTTTAAACAAAAATGGGGCTGGG - Intronic
1086380133 11:86244448-86244470 ATTCAAACAGAGGAGGGGCTTGG + Intergenic
1089108088 11:116031966-116031988 ATCTACATAAGGGAGGGGCTGGG - Intergenic
1089360436 11:117882552-117882574 ATTTGCAGAGAGGAGGGGCTTGG - Intergenic
1090532694 11:127607669-127607691 TTTTTCACAAAGGCGGGGCAAGG - Intergenic
1091885644 12:4015337-4015359 ATTTAGGCGAAGGTGGGGGTCGG + Intergenic
1092998037 12:13969023-13969045 ATTTACAGAATGGTAGGGGTAGG + Intronic
1094336134 12:29356332-29356354 CTTTAGACAAAGTTGGAGCTTGG - Intronic
1098225755 12:68321377-68321399 ATTTATATAAAGCTGGGGCTTGG - Exonic
1102221964 12:111200972-111200994 ATTTAAACAATAGTGGGGCAGGG + Intronic
1104507274 12:129344294-129344316 ATTTACCCAAAGGTAGTCCTTGG - Intronic
1106994954 13:35470794-35470816 ATAAACACAAAGGAGGGCCTGGG + Intronic
1110179388 13:72597022-72597044 TATTACACAATGGTGAGGCTTGG - Intergenic
1110888414 13:80668435-80668457 ATGTACACTAAGGTGGTGCGGGG - Intergenic
1111319432 13:86607128-86607150 ATTTACACTATGTAGGGGCTGGG + Intergenic
1112928480 13:104706031-104706053 GTTTATACCAAGGAGGGGCTTGG + Intergenic
1115714587 14:36088849-36088871 ACTTAAATAAGGGTGGGGCTAGG - Intergenic
1115725802 14:36215070-36215092 TTTTCCAGAAAGGTGGGCCTGGG - Intergenic
1116812859 14:49556056-49556078 ATTTAAAAAAAAATGGGGCTGGG - Intergenic
1117457374 14:55911965-55911987 AGTTACACAAGGCTGGGTCTTGG + Intergenic
1118712806 14:68536459-68536481 ATTTAGACCAATGTAGGGCTCGG - Intronic
1118891588 14:69914385-69914407 ATTTACAAAAATGGGGAGCTGGG + Intronic
1118912650 14:70074551-70074573 ATTATCACAAAGGTGGGGAAGGG + Intronic
1118920232 14:70143435-70143457 ATTTACAAACAGATGGGCCTGGG + Intronic
1119215662 14:72867304-72867326 AGTTAAAAAAAGGTGGGGCCAGG - Intronic
1119953133 14:78766619-78766641 GTTTCCACAAAGGTGAGGCATGG - Intronic
1126863533 15:52912402-52912424 ATTTGCATTTAGGTGGGGCTAGG + Intergenic
1127568552 15:60217280-60217302 ATTTACACACAGCTGAGGCTGGG - Intergenic
1128042148 15:64584610-64584632 ATAAACATAAAGATGGGGCTGGG - Intronic
1128130571 15:65224646-65224668 ATTTGCACAAAGCTGGTGATTGG - Intergenic
1128549825 15:68590928-68590950 ATTTGCACAAGGGTAGGGATGGG - Intronic
1129060932 15:72859783-72859805 ATTTCCACAAAGGAGGGTCATGG - Intergenic
1129741281 15:77990852-77990874 ATTTATGCAAGGATGGGGCTTGG - Intronic
1129844383 15:78761547-78761569 ATTTATGCAAGGATGGGGCTTGG + Intronic
1129897848 15:79121872-79121894 AAGGACACAAAGGTGAGGCTGGG - Intergenic
1130534866 15:84777179-84777201 ATTTAAAAAAAAGAGGGGCTGGG + Intronic
1133885938 16:9827697-9827719 AAGCACAGAAAGGTGGGGCTGGG + Intronic
1133972431 16:10577795-10577817 ACTTACCCAAAGGTGGGGTGGGG - Intronic
1134514560 16:14876321-14876343 ATAAACACAAGGATGGGGCTTGG - Intronic
1134702237 16:16274974-16274996 ATAAACACAAGGATGGGGCTTGG - Intronic
1134789341 16:16974790-16974812 ATTGACTAAAAGGTAGGGCTGGG - Intergenic
1134969593 16:18519676-18519698 ATAAACACAAGGATGGGGCTTGG + Intronic
1137237903 16:46630266-46630288 TTTTACACAATGTTGTGGCTAGG - Intergenic
1139278502 16:65749892-65749914 AATTACACGAAGGTGGGGAGGGG + Intergenic
1140277497 16:73523578-73523600 ATTTACACAGTGCTGGGGGTAGG + Intergenic
1141744417 16:85915923-85915945 ATTTACATAGAGGTGGGGGCGGG - Intronic
1142353319 16:89589654-89589676 ATGTACACAAACGTGGAGTTGGG + Intronic
1142545536 17:699562-699584 ATTTACAAAAAACAGGGGCTGGG - Intronic
1142796888 17:2314946-2314968 ATTAAAAGAAAGGTGGAGCTGGG + Intronic
1143121853 17:4612947-4612969 ATATACCCAAAGGTGGGGAAAGG - Intergenic
1143746319 17:8996825-8996847 ATGTACACAAAGGTTTGGTTTGG + Intergenic
1146084363 17:29813839-29813861 ATTTAAAAAAAGGCTGGGCTTGG + Intronic
1148529831 17:48378980-48379002 TATTCCAAAAAGGTGGGGCTGGG + Intronic
1150563374 17:66315307-66315329 AGTTAGAAAATGGTGGGGCTGGG + Intronic
1152266138 17:79296010-79296032 AATTACAACAGGGTGGGGCTGGG + Intronic
1154084284 18:11287124-11287146 ATTTTCGTAAAGGTGGGGCATGG - Intergenic
1155839103 18:30625766-30625788 ATTGGCACAGAGTTGGGGCTTGG + Intergenic
1157086438 18:44585249-44585271 ATTTGCTCCAAGGTGGGACTGGG - Intergenic
1157678166 18:49583015-49583037 ACTTACACACAGGTAGGGCAAGG + Intronic
1158259773 18:55593666-55593688 ATTTTAACACAGGTGGGACTCGG - Intronic
1158502821 18:58019059-58019081 ATCTACATAAAGGTGGGGTGGGG - Intergenic
1160350229 18:78172268-78172290 ATTTAGACAATGGTGGGTGTTGG + Intergenic
1160413863 18:78693765-78693787 ATTGACACCAGGATGGGGCTGGG + Intergenic
1161437199 19:4270692-4270714 TTTTAAAGAAAGGTGGGGCACGG + Intergenic
1162931640 19:13960569-13960591 CGCTGCACAAAGGTGGGGCTCGG + Exonic
1163256036 19:16156477-16156499 CTTTACAAAAATGTGGGGCCAGG - Intronic
1164228561 19:23267759-23267781 ATTGGCACAAAAGTGGGGTTGGG - Intergenic
1164243530 19:23410740-23410762 ATTGGCACAAAGGTGGGGTTGGG - Intergenic
1164464083 19:28472769-28472791 ATTTACACAAAAGCTGAGCTTGG - Intergenic
1164751938 19:30662819-30662841 AAATAGACAAGGGTGGGGCTTGG + Intronic
1165066148 19:33229719-33229741 CTTGACACCAAGGTGAGGCTAGG - Intergenic
1166646079 19:44532845-44532867 GTGTACAGAAAGGTGTGGCTGGG - Intergenic
1166925036 19:46261296-46261318 ATTTAGAAAAAGATGGGGCTGGG + Intergenic
1167762837 19:51460120-51460142 ATTTGCACCAAAGTGAGGCTAGG - Intergenic
925524425 2:4784199-4784221 AGTGACACAAAGGTAGGGGTGGG - Intergenic
925719416 2:6813181-6813203 GTTTTCACAAGGGTGGGGCAGGG - Intergenic
925989938 2:9246578-9246600 ATTTTCACACAGGTGGGGCTGGG - Intronic
926132722 2:10314965-10314987 TTTTTCCCAAATGTGGGGCTAGG + Intronic
926977777 2:18532329-18532351 ATTGACACAGAGATGGGGGTCGG + Intergenic
928200316 2:29243626-29243648 CTTTACACAGAGGTGGGCCCTGG - Intronic
928496998 2:31843169-31843191 CTTCACTCAAAGGTGGGCCTGGG - Intergenic
928814209 2:35270709-35270731 ATTAACAGAAAGAAGGGGCTGGG - Intergenic
929908213 2:46064926-46064948 ATCTACAGAAAGCTTGGGCTTGG - Intronic
933080060 2:77974999-77975021 ATCAACAGAAAGGTGGGTCTAGG - Intergenic
939433953 2:142148962-142148984 ATTTCCACATCTGTGGGGCTTGG + Intergenic
942495753 2:176538499-176538521 AATTAAAAGAAGGTGGGGCTGGG + Intergenic
942668584 2:178349267-178349289 ATCTGCACAAAGGTTGGGGTTGG - Exonic
942937534 2:181575834-181575856 ATTTTGACAAAAGTGGGGATGGG - Intronic
943099281 2:183468930-183468952 ATTTGCACAAAAGTGTGGCATGG - Intergenic
943604465 2:189960787-189960809 AAGTACACAAAGGTGGGGTCAGG - Intronic
943690792 2:190867876-190867898 ATTTCCTCAAATGTGGGACTAGG - Intergenic
944683043 2:202094329-202094351 ATTTCCCCAAAGATGGGGGTTGG - Intronic
946539812 2:220671652-220671674 ATTTAAACTAAGATAGGGCTGGG + Intergenic
947815824 2:233035350-233035372 ACCTACACAAAGCTGGGGGTAGG - Intergenic
947847051 2:233252681-233252703 ATTAACACCAAGGTGGGGCCGGG - Intronic
948359351 2:237408278-237408300 TTTTACACAAAAGGGAGGCTGGG - Intronic
1168875676 20:1170727-1170749 ATTAACAGAGAGTTGGGGCTCGG + Intronic
1169571909 20:6915479-6915501 ATTTACACAACAGTGAGCCTTGG - Intergenic
1170972798 20:21131946-21131968 ATTTTCACAAAGGTGTGATTTGG + Intronic
1170981938 20:21222322-21222344 AATTGCACAAGGGTGTGGCTGGG - Intronic
1172423185 20:34835118-34835140 ATACACAAAAAGGTGGGGGTGGG + Intergenic
1173313495 20:41921700-41921722 TTTTAGACAAAGGTGAGGATGGG + Intergenic
1173507903 20:43603163-43603185 ATTTTCACAAAGCTGGGGAAGGG - Intronic
1173656100 20:44701282-44701304 ACTTGCAGAAAGGCGGGGCTGGG - Intergenic
1174543182 20:51305743-51305765 GATAACACAAAGGTGGGGGTTGG + Intergenic
1175784343 20:61703094-61703116 ATTTACACTCTGGTGGGGCAGGG + Intronic
1176169265 20:63689652-63689674 AGTTACAGCAGGGTGGGGCTGGG + Intronic
1177462417 21:21430320-21430342 ATTTACATAAAATTGGGGCTGGG - Intronic
1179358662 21:40684990-40685012 ATTTACACTTAGGTGGAGCAAGG + Intronic
1180066906 21:45417136-45417158 ATCTTCCCAAAGGTGGTGCTGGG + Intronic
1180609727 22:17087328-17087350 ATTTCCACAAAGGCAGGACTGGG + Intronic
1183125432 22:35775541-35775563 ATTTAAAAAAATGTGGGGCCAGG + Intronic
1184380136 22:44140295-44140317 TTATACAGAAAGGTGGGGGTGGG - Intronic
1184403269 22:44286136-44286158 ATGTAGGCAAAGGTGGGGCAGGG - Intronic
1184639780 22:45864377-45864399 ATTTAAGAAAAGGTGGGGGTGGG - Intergenic
951473695 3:23082394-23082416 TTTTACACAAAAGTGGAGCATGG + Intergenic
952176637 3:30870904-30870926 AGTTAGACAAATGTGTGGCTGGG + Intronic
952523498 3:34185678-34185700 AATTACACAAAGGTGCTGCCTGG + Intergenic
955216050 3:56985825-56985847 ACATACCCACAGGTGGGGCTGGG + Intronic
955962933 3:64359386-64359408 TTTTAAAAAAAGGTGGGGGTGGG + Intronic
957053024 3:75424852-75424874 TTTTAAACAAAACTGGGGCTGGG + Intergenic
957147327 3:76441162-76441184 ATTTTCACAAAGCTGGTGCTTGG + Intronic
960922955 3:122766979-122767001 ATTTACGGAATGGTGGGGCGTGG + Intronic
961301813 3:125926685-125926707 TTTTAAACAAAAATGGGGCTGGG - Intergenic
961582644 3:127895115-127895137 ATTAACAAAAAGGTGGGGCCGGG - Intergenic
961645399 3:128390192-128390214 ATTAACACAAAAGTGGGACTTGG + Intronic
961886654 3:130101153-130101175 TTTTAAACAAAAATGGGGCTGGG + Intronic
964418416 3:156474244-156474266 ATTTACATTAAGATGGGGTTGGG + Intronic
965338170 3:167453865-167453887 ATTTAAATAAAAGTGGGGGTGGG + Intronic
965596937 3:170419415-170419437 TTTTACAACAAGGTGGGACTAGG - Intronic
967205778 3:187119633-187119655 CTTTGCACAATGGTGCGGCTTGG + Intergenic
967898444 3:194421256-194421278 ATTAAAAAAAATGTGGGGCTGGG + Intronic
968944590 4:3656925-3656947 ATAGACACAAAGGTGTGGCCTGG - Intergenic
968995821 4:3945170-3945192 TTTTAAACAAAAATGGGGCTGGG + Intergenic
971467563 4:26980057-26980079 ATTTAAAGAAAAGTGGGGCTGGG - Intronic
971965000 4:33542394-33542416 ATTTATACAAAGAAGGGGGTAGG - Intergenic
972670398 4:41209559-41209581 AATTTCACAAGGGTGGGCCTGGG + Intronic
973987787 4:56372309-56372331 GTTTACACAATTGTGGGGCCTGG - Intronic
974024454 4:56720952-56720974 AGTCATACAAAGGTGGGGGTTGG + Intergenic
979207974 4:118063934-118063956 ATTTACCATAAGGTGGAGCTTGG - Intronic
980968346 4:139545536-139545558 CTTTACAAAAAGGTGGGGTTGGG + Intronic
982323621 4:154106877-154106899 ATTTATACTAAGGTGGTGCAAGG + Intergenic
986846932 5:11766691-11766713 ATTTAGACCAGGGTGGTGCTGGG + Intronic
989535385 5:42557673-42557695 ATTTACAGAGAGGGTGGGCTTGG - Intronic
992252830 5:74892795-74892817 AGAAACAAAAAGGTGGGGCTTGG - Intergenic
995128978 5:108609735-108609757 ATTTAGACAAAGGAGGGGAAGGG + Intergenic
995242611 5:109902144-109902166 TTTTACACAAGGGTGAAGCTGGG - Intergenic
996925642 5:128823209-128823231 GTTTACAGATAGGTGGGGGTTGG + Intronic
997021038 5:130002079-130002101 CTATAAACAAAGGTGGTGCTTGG + Intronic
997394800 5:133550484-133550506 ATTCACCCACAGTTGGGGCTGGG - Intronic
997435654 5:133872826-133872848 GTCTAGACAGAGGTGGGGCTGGG + Intergenic
1000855065 5:166387995-166388017 CTTTAAACAAAGTTGAGGCTGGG + Intergenic
1001496624 5:172192453-172192475 ATTAAGACAGAGGAGGGGCTGGG + Intergenic
1001740318 5:174047734-174047756 ATTCACACAAAGGTGGGATGGGG + Intronic
1004277453 6:14250980-14251002 ATTGACACACATGTGGAGCTGGG + Intergenic
1004406533 6:15338412-15338434 ATTTACAGAAAGGACTGGCTTGG + Intronic
1005795286 6:29354029-29354051 CATTACACAAAAGAGGGGCTGGG + Intergenic
1008499565 6:52167458-52167480 ATTTGCACTTAGGAGGGGCTAGG - Intergenic
1008773422 6:55007384-55007406 ATTCACACATATGTGGGGCATGG - Intergenic
1010410373 6:75554691-75554713 ATATTTACAAAGGTGTGGCTGGG - Intergenic
1015982066 6:138849423-138849445 ATTTACTCCAAGGTAGGCCTGGG + Exonic
1017988584 6:159466500-159466522 ACTTACAGAAAGGTGAGGCTGGG + Intergenic
1019478922 7:1257147-1257169 ATTGCCACACAGGAGGGGCTGGG - Intergenic
1020850616 7:13347876-13347898 TTTTAAAGAATGGTGGGGCTGGG + Intergenic
1020876328 7:13699378-13699400 ATTAAAAAAAAGGTGGGGGTGGG + Intergenic
1022038181 7:26553936-26553958 GATGAGACAAAGGTGGGGCTGGG - Intergenic
1022394882 7:29978451-29978473 AATTACACAAAGGTGAGGAGAGG - Intronic
1024702775 7:51922634-51922656 ATTTACAAAAAGGAGGGGACTGG + Intergenic
1028199311 7:87942110-87942132 ATGTTCATAAAAGTGGGGCTGGG + Intronic
1029139079 7:98397133-98397155 ATGTAGTCTAAGGTGGGGCTGGG + Intronic
1029490683 7:100868428-100868450 ATTTCCACAAATGTGGGTCTTGG + Intronic
1029926523 7:104325221-104325243 AGTTAGACAAAGATGGTGCTAGG + Intergenic
1030012629 7:105186250-105186272 TATTACACAATGGTGGGGTTTGG + Intronic
1030979442 7:116169001-116169023 ACTTACTCAAAGGTAAGGCTGGG + Intergenic
1033093179 7:138405483-138405505 TTTTAAACAAAGGCTGGGCTGGG - Intergenic
1033387416 7:140891959-140891981 ATTTAGACAAAGGTAAGGCCAGG + Intronic
1034398748 7:150847556-150847578 CTATATACAAAGGTGGAGCTAGG - Intronic
1034823605 7:154239675-154239697 AGTTACACAAGGGCTGGGCTGGG + Intronic
1038600185 8:28932777-28932799 ATTTAGGCAGAGGTGTGGCTAGG + Intronic
1039736655 8:40339823-40339845 ATTTAAACACATGTGAGGCTAGG - Intergenic
1041646886 8:60262003-60262025 ATTTACAAAAAAGTGGGGCTGGG - Intronic
1041829643 8:62139434-62139456 TTTTGTATAAAGGTGGGGCTGGG - Intergenic
1042767962 8:72347102-72347124 AATTGCAAAAAGATGGGGCTGGG - Intergenic
1045424829 8:102055163-102055185 ATTTACACAAAGGCGCCACTCGG + Intronic
1046104476 8:109649295-109649317 ATTAAGACAAGGGTTGGGCTGGG - Intronic
1047298275 8:123590160-123590182 ATTTACACAGAGGGGAGGCAGGG - Intergenic
1047742163 8:127815255-127815277 GATTACACTAAGGTGGGGCACGG - Intergenic
1050221332 9:3393914-3393936 AATTACATAATGGTGGGGTTTGG - Intronic
1051807998 9:21017767-21017789 GTTTCCAAAAAGGTGGGGCTGGG - Intronic
1052845821 9:33335521-33335543 ATTTAAAAAAAGGTTGGGCACGG - Intronic
1055539790 9:77291309-77291331 TTTTCCACAAAAGTGGGGCTGGG - Intronic
1057554246 9:96074813-96074835 TTTTACAGAAAATTGGGGCTGGG - Intergenic
1060679846 9:125552597-125552619 ATTTACACTAAGGTGAGAATGGG - Intronic
1061338962 9:129963399-129963421 ATTTACACTAAGGAGTGGCAAGG - Intronic
1185847170 X:3448568-3448590 AATTACACAGAGGTGTGTCTTGG + Intergenic
1188928078 X:36070399-36070421 CTTGACACCAGGGTGGGGCTTGG + Intronic
1189150964 X:38706188-38706210 ATTTACAAAATGGTGAGGGTGGG + Intergenic
1190787009 X:53661327-53661349 TTTTAAAAAAAGGTGAGGCTGGG - Intronic
1194368239 X:93035815-93035837 ATTTACACACAAGTGAGGATTGG + Intergenic
1196811973 X:119636088-119636110 ATATACTGACAGGTGGGGCTGGG - Intronic
1197006121 X:121500608-121500630 ATTAACATATAGGTTGGGCTGGG - Intergenic
1198005964 X:132492700-132492722 ACTTACACAAATGTAAGGCTAGG + Intergenic
1199851827 X:151729309-151729331 TTATAGACAAAGATGGGGCTGGG - Intergenic
1200676448 Y:6152080-6152102 ATTTACACACAAGTGAGGATTGG + Intergenic