ID: 914882352

View in Genome Browser
Species Human (GRCh38)
Location 1:151557053-151557075
Sequence CAGTTAATCCACAGGAAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 292
Summary {0: 1, 1: 0, 2: 3, 3: 39, 4: 249}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914882352_914882355 -10 Left 914882352 1:151557053-151557075 CCTGCCTTCCTGTGGATTAACTG 0: 1
1: 0
2: 3
3: 39
4: 249
Right 914882355 1:151557066-151557088 GGATTAACTGAACACTTTTTAGG 0: 1
1: 0
2: 1
3: 20
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914882352 Original CRISPR CAGTTAATCCACAGGAAGGC AGG (reversed) Intronic
901741372 1:11344176-11344198 CAGGTAGTCCTCAGGGAGGCAGG + Intergenic
902298395 1:15483989-15484011 GAGATAATCCACAGGAAGCCTGG + Intronic
906279309 1:44542728-44542750 CATTTAATCCACAGGGAGACAGG + Intronic
907994933 1:59620586-59620608 CATTTAATCCAAAAGAAGTCAGG - Intronic
908719300 1:67107292-67107314 CAAATAATCCAAAGAAAGGCAGG + Intronic
909132947 1:71762216-71762238 CAGGTAACCCACAGGAATGCAGG + Intronic
909170860 1:72293292-72293314 CAAATAACCCACTGGAAGGCAGG - Intergenic
910499065 1:87867973-87867995 CAGTTAATCCAAAAGTAGGCAGG + Intergenic
911277903 1:95885438-95885460 CAAATAATCCATAAGAAGGCAGG - Intergenic
912957271 1:114164325-114164347 CAGTGAAGCCACAGGAAGCCAGG + Intergenic
913243942 1:116855219-116855241 CACAGAATCCACAGGAAGCCTGG + Intergenic
914408223 1:147398716-147398738 CAGGTAACCTCCAGGAAGGCAGG - Intergenic
914882352 1:151557053-151557075 CAGTTAATCCACAGGAAGGCAGG - Intronic
915988171 1:160487278-160487300 AAGTTCTTCCAGAGGAAGGCTGG + Intronic
916763465 1:167837711-167837733 GTGTTAATCCACAGAAATGCTGG + Intronic
917012034 1:170485480-170485502 CCATTATTCCACAGGTAGGCAGG - Intergenic
918042988 1:180924418-180924440 CTGTTCATCTTCAGGAAGGCAGG + Intronic
918415274 1:184299619-184299641 CACTTAGTCAACAGGATGGCTGG - Intergenic
918921593 1:190718462-190718484 CAGTTAAACCAAAGGAAGTCTGG + Intergenic
919863457 1:201759665-201759687 CACTTAATCATCAGGCAGGCTGG - Intronic
920319571 1:205108570-205108592 CAAGTAGCCCACAGGAAGGCAGG + Intronic
922713754 1:227854257-227854279 CAGCCAATCCACAAGAAGGCAGG + Intergenic
922993187 1:229932702-229932724 CAATTAATCCCAAAGAAGGCAGG + Intergenic
923033297 1:230266676-230266698 CAGTCAAGCCCCAGGCAGGCAGG - Intronic
923818254 1:237404483-237404505 TACTTAATCCACAAGAAAGCAGG + Intronic
923893175 1:238238216-238238238 CAATTAATCCAAAGGAAGGCAGG + Intergenic
924169148 1:241318982-241319004 CAATTACTCCTCAGGAAGACAGG + Intronic
1063962023 10:11314603-11314625 AAGTTAATGGACTGGAAGGCTGG + Intronic
1065269065 10:24008132-24008154 TATTTAATCCATAGGAAGGTAGG + Intronic
1066299000 10:34080340-34080362 CAGCTGATCCACAGGCAAGCCGG + Intergenic
1067041608 10:42956022-42956044 CAGTTAAACCCCATGAAGCCTGG + Intergenic
1070369756 10:75771118-75771140 CAGTGAATCCAGAGCTAGGCAGG - Intronic
1071540969 10:86483608-86483630 GAGTTATTCCAGAAGAAGGCTGG + Intronic
1071759004 10:88579340-88579362 CAGTTTTTACAAAGGAAGGCAGG + Intronic
1072416817 10:95254040-95254062 CAAATAACCCACAGGAAAGCAGG + Intronic
1073560620 10:104493444-104493466 CATTTAAGCCACAGGAACGATGG + Intergenic
1073790147 10:106931803-106931825 TAGTTAATACACAGCATGGCAGG - Intronic
1074518550 10:114195828-114195850 CAAGTAACCCACAAGAAGGCAGG - Intronic
1075830801 10:125409170-125409192 AAGTTTATTCACAGCAAGGCAGG + Intergenic
1076886897 10:133267161-133267183 CAGCGAGGCCACAGGAAGGCAGG - Intronic
1077698740 11:4419837-4419859 CAGTGGATCCTCAGGAAGGTAGG + Intergenic
1078033391 11:7776872-7776894 CAAGTAACCCACAGGAAGGCAGG + Intergenic
1078427197 11:11261583-11261605 CAGGTAAACCAAAGGAAGGGAGG - Intergenic
1084754492 11:71227155-71227177 CAAATAACCCACAAGAAGGCAGG + Intronic
1085237335 11:75025244-75025266 CAGCCATTCCACAGCAAGGCAGG + Intergenic
1086014099 11:82143402-82143424 GGGTTAATCCATAGGAAGTCAGG + Intergenic
1086167317 11:83794666-83794688 CATTTAATCCTCAGGAGGGTGGG + Intronic
1087219837 11:95534863-95534885 GAAGTAATCCATAGGAAGGCAGG + Intergenic
1088054475 11:105558393-105558415 CAGTTTTTACACAGAAAGGCAGG - Intergenic
1088658120 11:112020914-112020936 CAGTTTTTCCCCAGGAAGTCTGG + Intronic
1091411110 12:239986-240008 CAGGCAATCCAAAGGAAGGTGGG + Intronic
1091459192 12:631029-631051 CAGTTAAACCGCAGAAAGGTTGG + Intronic
1093925511 12:24904497-24904519 CAGTTAATACAGATGGAGGCCGG - Intronic
1094771252 12:33662762-33662784 CAGTGAATCCAGAGGGAAGCAGG + Intergenic
1095179211 12:39127606-39127628 CAGAGAATCCCAAGGAAGGCTGG - Intergenic
1095354521 12:41255860-41255882 CTGTTAATTCACAGGAGAGCTGG - Intronic
1095626293 12:44318692-44318714 CAGTCTATGCACAGGAAGGGTGG + Intronic
1095867010 12:46983379-46983401 CAATCTATGCACAGGAAGGCTGG - Intergenic
1095908008 12:47397316-47397338 CAGTCTATGCACAGGAAGGGTGG - Intergenic
1095990700 12:48032621-48032643 TACTTAAGGCACAGGAAGGCAGG - Intergenic
1096187679 12:49592876-49592898 CAGTTACTCCACAAGAAGGCAGG + Intronic
1097069735 12:56346184-56346206 CAGTTAATCTCCAGGAACGGAGG - Exonic
1097274311 12:57801779-57801801 CAGTTAATCAACAGAAAGCCAGG - Intronic
1097608230 12:61782242-61782264 CAGTAATTCCAAAGGGAGGCGGG - Intronic
1097877585 12:64657735-64657757 CTTTTAATCCAGAGGAAGGTTGG + Intronic
1098418664 12:70266998-70267020 CAGATAATCCAAAAGATGGCAGG - Intronic
1099089839 12:78292626-78292648 CCTCTAATCCACATGAAGGCAGG + Intergenic
1099840626 12:87960780-87960802 CAGATTATACACAGCAAGGCAGG - Intergenic
1100288452 12:93190196-93190218 CAGTTCTTACACAGAAAGGCAGG - Intergenic
1100656569 12:96652547-96652569 CAGTTAACTCAAAAGAAGGCAGG + Intronic
1102804678 12:115769263-115769285 CAGTCATTGCACAGTAAGGCAGG + Intergenic
1102807138 12:115791981-115792003 AAGTTGATCCACAGGAAAGGAGG + Intergenic
1104450317 12:128863698-128863720 CAGGTTTTACACAGGAAGGCAGG + Intronic
1107120099 13:36786933-36786955 CTGTTTAACCACAGGAAGCCTGG + Intergenic
1109269276 13:60236387-60236409 CAGTCAATCCACTCGATGGCTGG + Intergenic
1109980276 13:69897911-69897933 CAGTTAAACCTCAGGAACTCAGG + Intronic
1110734092 13:78914046-78914068 CAATTATTCCTCAGTAAGGCTGG - Intergenic
1113463123 13:110495682-110495704 CAGTTACTCCACGGGATGGGTGG - Intronic
1119667389 14:76494780-76494802 CAGTTAAAGCAGAGGAAGCCAGG + Intronic
1120952584 14:90055762-90055784 CAGTTAATCCAAAAGAAGTCAGG + Intergenic
1122146897 14:99696209-99696231 TACTTAATCCAAAAGAAGGCAGG - Intronic
1123092009 14:105746113-105746135 CAGATCATCCACAGGAGAGCAGG - Intergenic
1125103488 15:35943197-35943219 CAGTTTATCAGCAGGAAGGACGG + Intergenic
1125494512 15:40179685-40179707 CAGATAATCCAAAAGAAGGTAGG - Intronic
1126379027 15:48027184-48027206 CAATTACTCCAGAGGAAGGCAGG - Intergenic
1127985902 15:64070204-64070226 CAGCTCATGCACAGAAAGGCGGG - Intronic
1128596378 15:68955107-68955129 CAAGTAATCCACTGGAGGGCAGG - Intronic
1129518125 15:76169302-76169324 CAGTTATTGTACAGGAAGGAGGG + Intronic
1129877986 15:78989321-78989343 CAGTTCTTCCCCAGGAAAGCTGG + Intronic
1132387865 15:101413443-101413465 CAAGTAACCCACAGGAAGGCAGG + Intronic
1132799087 16:1742674-1742696 CAGTAACACCACAGGGAGGCAGG + Intronic
1134067871 16:11240866-11240888 CAGTTGAGGGACAGGAAGGCTGG + Intergenic
1135237930 16:20775860-20775882 CTGTTGATCCACCAGAAGGCTGG - Exonic
1135427253 16:22349249-22349271 CTGTAACTCCACAGAAAGGCAGG + Intronic
1135973874 16:27092797-27092819 CAGGTAACCCAGAGGAAGGCAGG + Intergenic
1136059053 16:27712248-27712270 GGGCTCATCCACAGGAAGGCTGG + Intronic
1136363888 16:29799569-29799591 CAGTTGAGGCATAGGAAGGCTGG + Intronic
1137454912 16:48610537-48610559 ACGTTAATCCACAGGCAGACGGG + Intronic
1138672194 16:58624416-58624438 CAGTTAAGCAACAGGTATGCTGG + Intronic
1141798618 16:86291834-86291856 AAGTTAACCCACAGGATGGGAGG + Intergenic
1142318972 16:89368790-89368812 CAGCTACTCCAGAGGCAGGCGGG + Intronic
1143630034 17:8133720-8133742 CAGTTCTTCAAAAGGAAGGCTGG + Intergenic
1146199606 17:30845256-30845278 CACTTAAGCCACAGGAGGACAGG - Intronic
1147501932 17:40973895-40973917 CAAGTAACCCACAGAAAGGCAGG - Intergenic
1148449261 17:47764474-47764496 CCATTGAGCCACAGGAAGGCAGG - Intergenic
1148574278 17:48698259-48698281 CAAGTAGCCCACAGGAAGGCAGG - Intergenic
1148966303 17:51438753-51438775 CTGGGAATCCACTGGAAGGCTGG - Intergenic
1149099436 17:52886001-52886023 AAGTTAATCCACAGGAAATGAGG - Intronic
1149309412 17:55379413-55379435 CAGTTAAGACAAAGGAAAGCTGG + Intergenic
1149851270 17:60036721-60036743 CAAATAATCCAAAGGAAGGCAGG - Intergenic
1150597247 17:66616929-66616951 CAGCTGAGCCACAGGAAAGCTGG - Intronic
1151129656 17:71883237-71883259 TAATCTATCCACAGGAAGGCAGG + Intergenic
1151245048 17:72788004-72788026 CTGTAAATCCCCAAGAAGGCAGG + Intronic
1151837701 17:76594283-76594305 AAAATAATCCACAGGAAGGCAGG - Intergenic
1151915791 17:77117049-77117071 CAGTAAATGCAATGGAAGGCCGG + Intronic
1153224094 18:2884766-2884788 CAGATCAGCCTCAGGAAGGCAGG - Intronic
1154291546 18:13112445-13112467 CAGCTAATCCCCTGGAAAGCAGG - Intronic
1154932178 18:21011244-21011266 CAGGTAACCCACAGAAAGACAGG - Intronic
1155025198 18:21934718-21934740 CAGAGAGTCCACAGGGAGGCAGG - Intergenic
1156377987 18:36531832-36531854 CAGTTTGCCCACAGGCAGGCTGG + Intronic
1157218016 18:45801793-45801815 CACTTAGTCCACAGGAAGGAAGG + Intergenic
1157824273 18:50798416-50798438 CAGTTATTCCATGGAAAGGCAGG + Intronic
1158265197 18:55653853-55653875 CAGAAAATCCACAGGAGAGCAGG + Intronic
1159414766 18:68130889-68130911 CATGTAATTGACAGGAAGGCAGG - Intergenic
1159638486 18:70835494-70835516 CAGTTAAGCCATAGGAGAGCAGG - Intergenic
1159679281 18:71326988-71327010 TAGCCAATCCACAGGAAGGCTGG - Intergenic
1159817765 18:73097920-73097942 CAAGTAACCCACAGGAATGCAGG - Intergenic
1160019773 18:75171495-75171517 CAGTTTTTACACAGAAAGGCAGG - Intergenic
1161450883 19:4344598-4344620 CTGGGAAACCACAGGAAGGCCGG - Intronic
1161654556 19:5506173-5506195 AAGTTAAACCACATGAGGGCAGG + Intergenic
1164449548 19:28348620-28348642 CAGCTCATCCAGAGGAAAGCAGG + Intergenic
1164880840 19:31731602-31731624 CAATTCATCCACAGGCAGTCTGG + Intergenic
1164962528 19:32446290-32446312 CAGGTAACCTACAGGAAGGCAGG + Intronic
1165146866 19:33736388-33736410 CAAATCATCCACAGGGAGGCAGG - Intronic
926321791 2:11753486-11753508 CAGTTTAACCACAGGGACGCTGG + Intronic
927174658 2:20397140-20397162 CAGTTAGACCACAGAAAGACAGG - Intergenic
927464746 2:23328747-23328769 CAGTGAAACCAGAGGGAGGCAGG - Intergenic
927496390 2:23554439-23554461 TGATTAATCCACAGGAAGGCAGG - Intronic
928040002 2:27865491-27865513 CAGTTAATCCAAAAGAAAGCAGG - Intronic
929375630 2:41283418-41283440 CAGTTTTTACACAGAAAGGCAGG - Intergenic
935365711 2:102288515-102288537 TAGTTAATCCAAAAGAAGTCAGG + Intergenic
935558815 2:104540153-104540175 CAAGTGATCCACAGGAAGGCAGG - Intergenic
935565829 2:104606380-104606402 CAAGTAATTCACAGGAAAGCAGG + Intergenic
936308204 2:111360744-111360766 CAGTTGGTCCAGAGGTAGGCAGG - Intergenic
936406140 2:112205481-112205503 CAAGTAACCCACAGGAAAGCAGG + Intergenic
937637883 2:124177167-124177189 CAGTTTTTACACAGAAAGGCGGG + Intronic
938227685 2:129630106-129630128 CAGTTAATCAAAAGGAGGGCAGG - Intergenic
941404226 2:165069215-165069237 CAGCTGATCCACTGGAATGCAGG + Intergenic
941724081 2:168842083-168842105 CAGTTTTTACACAGAAAGGCAGG + Intronic
942081075 2:172399933-172399955 CTGTTTATGAACAGGAAGGCAGG + Intergenic
942484755 2:176427142-176427164 CTGTGCATTCACAGGAAGGCGGG + Intergenic
944527270 2:200632176-200632198 CAGGCAACCCACAGGAAGGTGGG - Intronic
947962568 2:234251914-234251936 AAGTTATTTCACAGGAAGGCAGG - Intergenic
948670944 2:239568225-239568247 GAGTTAAACCGCAGGAGGGCAGG + Intergenic
1169129253 20:3156108-3156130 CAGAAAATCCATAGGAAAGCTGG + Intronic
1169398821 20:5261936-5261958 CAGTTAATCCACAAGGAAGTGGG - Intergenic
1172837981 20:37885199-37885221 CAGGTCACACACAGGAAGGCTGG - Intergenic
1173260844 20:41433983-41434005 CATGTAAACCAGAGGAAGGCAGG + Intronic
1173377759 20:42504817-42504839 CAGTAAATTCAAAGAAAGGCTGG - Intronic
1173626897 20:44479783-44479805 CTGTTAGTCCCCAGGGAGGCAGG - Intronic
1174220733 20:48952990-48953012 CAGAGAATCCACAGGAAGAAGGG - Intronic
1174879243 20:54259872-54259894 CAATTAATCCAAAAGAAGGCAGG - Intergenic
1177228721 21:18291291-18291313 CCTTTAAGCCACAGGAAGGTTGG + Intronic
1179164410 21:38924579-38924601 CAGTGGATCTGCAGGAAGGCTGG - Intergenic
1180175127 21:46083555-46083577 CTGTTAATCCTCAGGACAGCTGG + Intergenic
1180923749 22:19537842-19537864 CAAGTAAGCCACAGGAAAGCAGG + Intergenic
1181135369 22:20762249-20762271 GAGTTAAGCCTCAGGAGGGCAGG + Intronic
1182171746 22:28237053-28237075 CACTTGATCCAGAAGAAGGCAGG - Intronic
1182576828 22:31278524-31278546 CCGCCAATCCACAGGAAGCCCGG - Intronic
949912909 3:8928240-8928262 CAGTTAATCCAAAAAAAAGCAGG + Intronic
950161952 3:10766894-10766916 CAGATAAACCACAGGGAAGCAGG - Intergenic
950982039 3:17317325-17317347 CAGGTAACTCACAAGAAGGCAGG + Intronic
952580506 3:34827825-34827847 CAGTTAACCCAAAGGAGGACAGG - Intergenic
953109871 3:39924041-39924063 CAAGTAATCTACAGGAAGGTAGG + Intronic
953461325 3:43083486-43083508 CAAGTAATTCACAAGAAGGCAGG - Intronic
953666877 3:44931691-44931713 CAGTTAATCAAGAGCATGGCTGG + Intronic
954040400 3:47882393-47882415 CAGGTAACCAACAGGAAGGCAGG - Intronic
955005586 3:54965704-54965726 CAGATATGCCACAGGAAGCCAGG + Intronic
955321099 3:57974917-57974939 CAGATAACTCACAGGAAGGAAGG + Intergenic
955865719 3:63381807-63381829 TCAGTAATCCACAGGAAGGCAGG - Intronic
955958807 3:64317971-64317993 CAGTGAATCTCTAGGAAGGCTGG - Intronic
956167810 3:66409622-66409644 CAGCTCATCTACAGGAAGGAAGG + Intronic
956578976 3:70788757-70788779 CAGGTAACCCATAGGAAGGCAGG - Intergenic
956992296 3:74781026-74781048 CAATTAATACACAGGCAGGGAGG - Intergenic
960060468 3:113314988-113315010 CAAGTAACCCACAGGAAAGCAGG + Intronic
960316511 3:116184981-116185003 CAGTTAAACCACAAGAAATCTGG - Intronic
961419792 3:126793307-126793329 CAAGTAACCCACAGGAAGACAGG - Intronic
962121718 3:132567520-132567542 AAATTAACCCACAGGAATGCAGG + Intronic
962942710 3:140140446-140140468 CTGTTAGTCCACAGGAGAGCTGG - Intronic
963533767 3:146502732-146502754 CCATTAATTCACATGAAGGCTGG + Intergenic
964455418 3:156860377-156860399 GAGTTAATCCACAGTAATGTAGG + Intronic
964681886 3:159350057-159350079 CTGAAAATCCACAGGAATGCTGG + Intronic
966362407 3:179144573-179144595 CAAATAATCCACAAGAAAGCAGG + Intergenic
966460004 3:180165982-180166004 CAGTCTATGCACAGGAAGGGTGG + Intergenic
967376318 3:188806620-188806642 CATTTAATTCAAAGAAAGGCAGG - Intronic
967697017 3:192543854-192543876 CAGTTTAGCCACAGAAAGACAGG - Intronic
968535859 4:1128643-1128665 CAAATAGCCCACAGGAAGGCAGG + Intergenic
971279591 4:25232005-25232027 GAATTAATCCAAACGAAGGCAGG + Intronic
973188329 4:47357417-47357439 CAGATAAGACACAGGAATGCTGG - Intronic
975166450 4:71183180-71183202 CAGTTAATGTCAAGGAAGGCAGG - Intergenic
977547858 4:98406362-98406384 CAGTGAAACCTAAGGAAGGCTGG + Intronic
979610625 4:122685227-122685249 CAGTGAATCCATTGGAATGCCGG + Intergenic
981574793 4:146193281-146193303 CAGTTAAACCACACAAAAGCTGG - Intronic
983421779 4:167527290-167527312 CAGTTCAGCCACAGCAAGACAGG - Intergenic
984211406 4:176853561-176853583 TACTTAATCCAAAAGAAGGCAGG + Intergenic
984426185 4:179589407-179589429 CACTTAACCCACAGGAAAGCAGG - Intergenic
985049672 4:185976527-185976549 CAATTAATCTAAAAGAAGGCAGG + Intergenic
986466499 5:8031051-8031073 CAGGTATTACACAAGAAGGCAGG - Intergenic
986618188 5:9641641-9641663 CAGTAGATTCAGAGGAAGGCTGG - Intronic
987054339 5:14177135-14177157 CAGTTATGCCCCAGGAGGGCAGG + Intronic
987642534 5:20630545-20630567 CAGTTGATCCAGAGAAAGACTGG - Intergenic
988082353 5:26430287-26430309 TAGCTAATCCACAGGGAGCCAGG + Intergenic
989989797 5:50748114-50748136 CATTTAATCCAAAAGAAAGCAGG - Intronic
990007894 5:50964236-50964258 CAGATAATCCAGAGCCAGGCGGG - Intergenic
990261100 5:54023346-54023368 CAAATAACCCTCAGGAAGGCAGG + Intronic
990547608 5:56838734-56838756 TAGTCAATCCACTGGAAGACGGG - Intronic
990768723 5:59218252-59218274 CTGTTCATGCACAGGAAGGAGGG - Intronic
991085736 5:62646967-62646989 CAGTGCATGCACGGGAAGGCTGG - Intergenic
993961610 5:94304273-94304295 CACTTATGCCACAGGGAGGCAGG - Intronic
994536898 5:101042627-101042649 CAGTTACTCCAGGGGAAGGAGGG + Intergenic
998047896 5:139004315-139004337 CAGTGAAACCACAGAAAGACTGG - Intronic
1000002807 5:157155593-157155615 CAAGTAAACCACAGGAAAGCAGG - Intronic
1003932057 6:10933814-10933836 CAATTAATCCTCAAGAAGGAAGG + Intronic
1004032706 6:11886919-11886941 CAAATAACCCACAGGAAGACAGG + Intergenic
1004380548 6:15128679-15128701 CAGTTTTTACACAGAAAGGCAGG - Intergenic
1006011289 6:31045053-31045075 CAGTGATTCCACTGGAAGGTGGG - Intergenic
1007403061 6:41615586-41615608 CAGCTAATCCAGAGGGAGGAGGG + Intergenic
1007512982 6:42388878-42388900 AAATGAAACCACAGGAAGGCAGG + Intronic
1007928089 6:45666045-45666067 AAGTCAAACCACAGGAAGCCTGG - Intergenic
1008665624 6:53712975-53712997 CTGCAAATCCACATGAAGGCTGG - Intergenic
1008800149 6:55358453-55358475 CAGTTATCCCACAGGATGGGAGG - Intronic
1011238343 6:85242652-85242674 CAGTTAATGAACAGGCAGGATGG - Intergenic
1011664363 6:89620644-89620666 CAATTAAGCCACCTGAAGGCAGG + Intronic
1014548531 6:122760557-122760579 CAATTAATCTAAAAGAAGGCAGG - Intergenic
1015008394 6:128312254-128312276 CAGTTACTTCACAGAAAGGCAGG + Intronic
1015042142 6:128733890-128733912 CAGGAAATTCAGAGGAAGGCTGG + Intergenic
1015499113 6:133912214-133912236 CAAGTAAGCTACAGGAAGGCAGG + Intergenic
1015687847 6:135885897-135885919 CTGTTAATTCACAGGCATGCAGG + Intronic
1015862836 6:137698576-137698598 AAGATAGTCCACAGGAAGCCTGG + Intergenic
1016024065 6:139267537-139267559 CAAATAATCCAAAGGAAGGCAGG + Intronic
1017612394 6:156202637-156202659 CAAATAATCCATAAGAAGGCAGG + Intergenic
1019412649 7:913138-913160 CAGTTAATACAAAAGAAGGCCGG - Intronic
1019704902 7:2492953-2492975 CTGTTTATCCATTGGAAGGCAGG - Intergenic
1020597989 7:10235190-10235212 CAATTAATCCAAAAGAAGGAAGG - Intergenic
1020678379 7:11206596-11206618 CAGTTCGTAAACAGGAAGGCTGG + Intergenic
1022448522 7:30491722-30491744 CAAGTAACCCACAGGAAGGCAGG - Intergenic
1022579401 7:31534160-31534182 CAGTTTTTCCACTGGAAGGAGGG - Intronic
1022641905 7:32194860-32194882 CAAGTAAGCCACAGGAAGGCAGG - Intronic
1023070934 7:36432697-36432719 CAATTAATCCAGAAGAAGGCAGG - Intronic
1024225552 7:47323874-47323896 AAATAAATCCACAGTAAGGCAGG + Intronic
1027034692 7:74916559-74916581 CAGTGAATCCTCAGGAAAGAAGG + Intergenic
1028330106 7:89579789-89579811 CAATTACTCCACAGGCAGGGCGG + Intergenic
1029251013 7:99236357-99236379 CACTGAATCCCCAGGAAGGAGGG - Intergenic
1031172166 7:118305860-118305882 CAGTGAATCAACAGATAGGCAGG - Intergenic
1032776599 7:135120511-135120533 CACATTACCCACAGGAAGGCAGG + Intronic
1034388212 7:150758611-150758633 CAGTTAATTCCCAGGATGGATGG + Intergenic
1034495747 7:151421100-151421122 AAGTTAAGTCACAGAAAGGCTGG + Intergenic
1036037786 8:5039073-5039095 CAGTTAGTTCACAGGAAAGCTGG + Intergenic
1036057696 8:5276943-5276965 CAAGTAATCCACAGGAAAGCAGG - Intergenic
1038160956 8:25037036-25037058 AAGTGACTCAACAGGAAGGCTGG - Intergenic
1039304761 8:36249507-36249529 CAGTTTATACACAGAAAGGTAGG + Intergenic
1039430143 8:37519519-37519541 CACCTAATCCCCAGGAAGGAAGG + Intergenic
1040023363 8:42760070-42760092 CAGCTAAGACACATGAAGGCAGG - Intronic
1041896103 8:62926368-62926390 CAGTAAACCCACAGGGGGGCTGG - Intronic
1043493383 8:80773211-80773233 TGTTTAATCCACAGGAAGGCAGG - Intronic
1043803746 8:84644644-84644666 AAGATAATACACAGGAAGGCAGG - Intronic
1044958642 8:97507580-97507602 CACTAAATGCACAGGAAGGCTGG - Intergenic
1049130018 8:140830674-140830696 CAGTATATTCACAGGAAGGATGG + Intronic
1049590269 8:143456206-143456228 CAAGTAACCCATAGGAAGGCAGG + Intronic
1050562232 9:6845759-6845781 CAGTTAGTCCATTGGAAGTCAGG + Intronic
1053085465 9:35216696-35216718 TATTTAATCCACAGGAAGGCAGG + Intronic
1053380207 9:37642928-37642950 CAAGTACTCCACAGGGAGGCAGG - Intronic
1053444715 9:38143130-38143152 CAGTTTCCCTACAGGAAGGCAGG - Intergenic
1054863391 9:69975600-69975622 CTGAAAATCCAAAGGAAGGCCGG + Intergenic
1057253417 9:93522867-93522889 AAGATGAACCACAGGAAGGCAGG + Intronic
1059253576 9:112908865-112908887 CAGTTAATCCACATGATGTCTGG + Intergenic
1059475233 9:114541165-114541187 CAGTTAGTACACAGGAGGTCTGG + Intergenic
1061228731 9:129299161-129299183 TACGTAATCTACAGGAAGGCAGG - Intergenic
1061837705 9:133340449-133340471 CAGTTCGTCCACAGGAAGTGTGG - Exonic
1186218597 X:7325968-7325990 CAGTTTTTACACAGAAAGGCAGG + Intronic
1188479967 X:30627444-30627466 CAGTTTCTACACAGAAAGGCAGG - Intergenic
1189428509 X:40925735-40925757 CAAGTAACCCATAGGAAGGCAGG - Intergenic
1189442112 X:41046472-41046494 TAAGCAATCCACAGGAAGGCAGG - Intergenic
1190383951 X:49866267-49866289 CAAGTAACTCACAGGAAGGCAGG - Intergenic
1194194577 X:90876923-90876945 TACTTAATTCAAAGGAAGGCAGG - Intergenic
1196022052 X:111000788-111000810 CACTTAAGCCCCAGGAGGGCAGG - Intronic
1196463098 X:115949360-115949382 AAGCAAATCCCCAGGAAGGCAGG + Intergenic
1196664413 X:118301379-118301401 GAAATAATCTACAGGAAGGCAGG + Intergenic
1197350912 X:125382238-125382260 CAGTTAGTTCACAGGATGTCTGG - Intergenic
1198319173 X:135502343-135502365 CAAATAATCTACAGAAAGGCAGG - Intergenic
1198804344 X:140478778-140478800 CAAGTAACCCACAAGAAGGCAGG + Intergenic
1200541192 Y:4459324-4459346 TACTTAATTCAAAGGAAGGCAGG - Intergenic