ID: 914885213

View in Genome Browser
Species Human (GRCh38)
Location 1:151578949-151578971
Sequence ATTACCAGGTTCAGGTTATT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 180}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914885209_914885213 2 Left 914885209 1:151578924-151578946 CCATGTCAAACATTTATAGCTAC 0: 1
1: 0
2: 0
3: 6
4: 122
Right 914885213 1:151578949-151578971 ATTACCAGGTTCAGGTTATTAGG 0: 1
1: 0
2: 1
3: 14
4: 180
914885208_914885213 3 Left 914885208 1:151578923-151578945 CCCATGTCAAACATTTATAGCTA 0: 1
1: 0
2: 1
3: 16
4: 172
Right 914885213 1:151578949-151578971 ATTACCAGGTTCAGGTTATTAGG 0: 1
1: 0
2: 1
3: 14
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914885213 Original CRISPR ATTACCAGGTTCAGGTTATT AGG Intronic
900538772 1:3192384-3192406 ATGACCAGGCTCAGGGTGTTAGG + Intronic
901611233 1:10500043-10500065 ATTACCAGCCTCTGGTTAATTGG - Intronic
902087946 1:13877552-13877574 ATTCCCAGGGTCTGGGTATTAGG + Intergenic
902562421 1:17285983-17286005 ATTGCCAGGAGGAGGTTATTAGG - Intergenic
902569514 1:17338208-17338230 GTCACCAGGTTCAGGCTATGTGG - Intronic
903544137 1:24112998-24113020 ATTGCCAGGTGGAGGTCATTAGG + Intergenic
908921966 1:69205927-69205949 AATATCAGGTACAGGTCATTGGG + Intergenic
909519884 1:76555509-76555531 ATGACCAGGTTCACTTTGTTTGG - Intronic
910171701 1:84385119-84385141 ATTACAAGGATTAGGTTAGTGGG - Intronic
913463451 1:119114532-119114554 TTTACCTTGTTCAGGTTATCTGG - Intronic
914885213 1:151578949-151578971 ATTACCAGGTTCAGGTTATTAGG + Intronic
916328271 1:163588005-163588027 ATTCACAGGTTCTGGGTATTAGG + Intergenic
918527249 1:185478610-185478632 ATTCCCAGGTTCTGGGGATTAGG - Intergenic
920673544 1:208023312-208023334 TTTACCAGGAGCAGGTTAATGGG + Exonic
920912357 1:210231022-210231044 ATAACCAGTTTTAGATTATTTGG + Intergenic
922624999 1:227030952-227030974 ATTACCTTGCTGAGGTTATTGGG - Intronic
923393037 1:233532644-233532666 ATTCCCAGGTTCTGGGAATTAGG + Intergenic
1063470249 10:6278623-6278645 GTTTCCAGTTTGAGGTTATTTGG + Intergenic
1064126580 10:12666782-12666804 ATGACCAAGTACAGGTGATTTGG - Exonic
1065642067 10:27793509-27793531 ATTCTGAGGTTCTGGTTATTAGG + Intergenic
1068267916 10:54678339-54678361 ATTCCCAGGTTAAAGTCATTTGG + Intronic
1068329275 10:55539529-55539551 ATTAGAAGTTTCAAGTTATTTGG - Intronic
1069065301 10:63936308-63936330 ATTACCAGGTGCAAGGTCTTGGG + Intergenic
1073807870 10:107119118-107119140 ATTACCAGTTTCAGCTACTTTGG - Intronic
1074164618 10:110864140-110864162 GTTGCCAGGTGGAGGTTATTAGG - Intergenic
1075775647 10:124984478-124984500 CTTGCCAGGATCAGTTTATTAGG + Intronic
1076270208 10:129145869-129145891 ATTACAAGGTTTATGTTACTTGG + Intergenic
1077227301 11:1443982-1444004 ATGCCCAGGTTCATGTGATTGGG + Intronic
1078704344 11:13725113-13725135 ATTTCCAGTTTCTGGCTATTAGG + Intronic
1078827448 11:14942809-14942831 CTTACCATCTTCAGGTTATTAGG - Intronic
1079259725 11:18866819-18866841 ATGACCAGGTTCTGGTCAATGGG + Intergenic
1080819832 11:35794840-35794862 ATTACCAGGTACTGGTGATACGG + Intronic
1080988071 11:37494947-37494969 AATACCAGGTTCAAGGTAATAGG + Intergenic
1084990525 11:72919545-72919567 ATTACCATGTTCATTTTATATGG - Intronic
1085682497 11:78590858-78590880 ATTACCAGGGTCTGGTTATGAGG + Intergenic
1086878889 11:92131083-92131105 AATACCAGGTTCTGGGTTTTCGG - Intergenic
1087363008 11:97184338-97184360 ATTTACAGGTACAGTTTATTAGG - Intergenic
1087724860 11:101705427-101705449 GTTACCAGGTGGAGGTTGTTAGG + Intronic
1088023558 11:105150448-105150470 ATTCACAGGTGCAGGTAATTAGG + Intergenic
1090117681 11:123991796-123991818 CTAATCAGGTTCAGATTATTTGG - Intergenic
1090394811 11:126411855-126411877 ATTTAAAGGTTCAGGTAATTAGG + Intronic
1092907768 12:13117470-13117492 ATTTCCAGGATCAGGCTACTTGG + Intronic
1094427546 12:30330794-30330816 ATAAACAGGCTCAGGTGATTAGG - Intergenic
1095333016 12:40991418-40991440 ATTTACAGGTTCTGGTAATTTGG + Intronic
1096020279 12:48318539-48318561 AGTAGCAGGTTCAGGTCAATGGG + Intergenic
1096356736 12:50947650-50947672 ATTCCCAGGTTCTGGAAATTAGG + Intergenic
1099466274 12:82991976-82991998 TTTTCCAGATTCAGGTTAGTAGG + Intronic
1100572001 12:95851815-95851837 ATTACTAGATTCAGGTTATGTGG + Intergenic
1100939656 12:99712317-99712339 ATTCACAGGTTCTGGTTATTAGG - Intronic
1101431448 12:104630976-104630998 ATAACCCTGTTCACGTTATTAGG - Intronic
1104658481 12:130591791-130591813 ATTCCCAGGTTCTAGTGATTGGG + Intronic
1106798015 13:33227623-33227645 ATTACCTTTTTCAGGGTATTTGG - Intronic
1108309466 13:49172775-49172797 ATTCACAGGTTCAGGGGATTGGG + Intronic
1108333247 13:49411887-49411909 GTTACCAGGTGGAGGTTGTTAGG + Intronic
1109495979 13:63172275-63172297 ATTCACAGGTTCTGGGTATTAGG + Intergenic
1109568839 13:64158537-64158559 TTTCCCAGGTTCTGGTGATTAGG + Intergenic
1109799834 13:67362389-67362411 ATTAACAGGTCCTGGTAATTAGG + Intergenic
1109986499 13:69993320-69993342 ATTGCCAGGTGGAGGTTATTAGG - Intronic
1111333453 13:86791805-86791827 ATTTACAGGTTCAGGGTATTAGG - Intergenic
1112257848 13:97851081-97851103 ATTTCCAGGTTCTGGGGATTAGG - Intergenic
1115185180 14:30679484-30679506 ATTTCCAGGTTCAGTTCTTTGGG - Intronic
1119679300 14:76579972-76579994 ATTCCCAGGTTCAGGGGATTAGG + Intergenic
1120165733 14:81197400-81197422 ATTAACAAATTCAGGTAATTAGG - Exonic
1120193079 14:81456705-81456727 ATTACATGGTTCAGGGTATATGG + Intergenic
1121520007 14:94579634-94579656 ATTCACAGGTTCTGGGTATTAGG + Intronic
1123509327 15:20980419-20980441 ATTAGAAGGTTCAGGTCAATAGG + Intergenic
1123566551 15:21554163-21554185 ATTAGAAGGTTCAGGTCAATAGG + Intergenic
1123602812 15:21991452-21991474 ATTAGAAGGTTCAGGTCAATAGG + Intergenic
1124205033 15:27710685-27710707 ATTCACAGGTTCTGGGTATTGGG - Intergenic
1129532744 15:76281776-76281798 ATTCACAGGTTCTGGGTATTAGG - Intronic
1130195161 15:81772481-81772503 ATGACCATTTTCAGGTAATTGGG - Intergenic
1130198871 15:81807016-81807038 ATTCCCATTTTCAGGTTCTTTGG + Intergenic
1130360685 15:83182398-83182420 ATTTCCAGATTTAGGCTATTAGG - Intronic
1202974913 15_KI270727v1_random:281254-281276 ATTAGAAGGTTCAGGTCAATAGG + Intergenic
1134274155 16:12760810-12760832 ATTATCAGGTTTGGGTTAGTAGG - Intronic
1135027588 16:19010478-19010500 AGTACTAGGTTCAGGTCAGTGGG + Intronic
1135180587 16:20270681-20270703 TTTACCAGTTTCCCGTTATTGGG + Intergenic
1135317119 16:21457905-21457927 GTTAACAGTTCCAGGTTATTAGG + Intergenic
1135370041 16:21890146-21890168 GTTAACAGTTCCAGGTTATTAGG + Intergenic
1135441772 16:22480976-22480998 GTTAACAGTTCCAGGTTATTAGG - Intronic
1140776214 16:78250859-78250881 ATTGCCAGGTAGAGGTTGTTAGG - Intronic
1141487363 16:84349674-84349696 ATTCCCAGGTTCAGGGGATTAGG - Intergenic
1142538750 17:640429-640451 GTTACCAGGTTCATCTCATTGGG - Intronic
1142884366 17:2903664-2903686 ATTGCCAGGTTCAGGTTAATGGG + Intronic
1143886025 17:10065702-10065724 ATTCCCAGGTTCTGGGGATTAGG + Intronic
1154039148 18:10836562-10836584 ATTACTAGGTTAAGGTAATGAGG + Intronic
1155341054 18:24814513-24814535 ATTGACAGGTTCTGGGTATTAGG + Intergenic
1156067311 18:33159713-33159735 ATTCACAGGTTCTGGTGATTAGG + Intronic
1158028962 18:52939189-52939211 ATTCCCAGTCTCAGGATATTTGG + Intronic
1159336912 18:67080490-67080512 ATTACCTGGTTTAGGTCAATTGG - Intergenic
925468227 2:4130683-4130705 ATTTCCAAGTTCAGGTTTATTGG + Intergenic
928699486 2:33884304-33884326 ATTGCCAGGTAGAGGTTATTAGG + Intergenic
928891333 2:36206601-36206623 ATTATCATTTTGAGGTTATTAGG + Intergenic
930607312 2:53505904-53505926 ATTGCCAGGTGGAGGTTGTTAGG - Intergenic
931914131 2:66934597-66934619 ATTACAAAGTTCAGGTTAAATGG + Intergenic
931923068 2:67041780-67041802 TTTGCCATGTTCAGGGTATTGGG - Intergenic
931959445 2:67465993-67466015 CTTCCCATGTTCAGTTTATTTGG - Intergenic
933396858 2:81742927-81742949 TTTACCTGGTATAGGTTATTGGG - Intergenic
936895260 2:117420572-117420594 ATTCCCAGGTTCTGGAAATTAGG + Intergenic
937364599 2:121252439-121252461 ATTTCCAGGTTCCGGGGATTAGG - Intronic
937459627 2:122074711-122074733 GTTACCAGGTGGAGGTTTTTAGG - Intergenic
938096774 2:128469297-128469319 AGTACCAGCTCCAGGTTCTTAGG - Intergenic
938116748 2:128607577-128607599 AATTCCTGGTTCAGGTTGTTGGG + Intergenic
941036198 2:160571510-160571532 ATGACCAGGTTCTGGTTAATGGG + Intergenic
941857877 2:170248846-170248868 ATTCACAGGTTCTGGGTATTAGG + Intronic
944958465 2:204840242-204840264 ATTTCCAAATTCAAGTTATTTGG + Intronic
1170844398 20:19950050-19950072 ACAACCAGGTTAAGGTTCTTTGG - Intronic
1173376393 20:42487441-42487463 ATTCCCAGGTTCTGGGTATTAGG - Intronic
1176031317 20:63014288-63014310 ACTTCCAGTTTCTGGTTATTAGG - Intergenic
1177917525 21:27108505-27108527 TTTTGCATGTTCAGGTTATTGGG + Intergenic
1181715213 22:24721998-24722020 ATTTCCTTGTTCAGGTTCTTAGG + Intronic
1182960403 22:34466868-34466890 ATTAACAGATTCATGGTATTAGG + Intergenic
951132164 3:19060735-19060757 ATTTCCAGGTTCATCTTAATGGG - Intergenic
952662520 3:35868860-35868882 ATTGCCAGGTGGAGGTTGTTAGG + Intergenic
956343147 3:68248779-68248801 TTTGCCAGGTGCAGGTCATTAGG + Intronic
956913607 3:73847211-73847233 ATTAACAGGTTCTGGAGATTAGG + Intergenic
956963913 3:74436099-74436121 ATGCCTAGGTTCAGGGTATTTGG + Intronic
963971136 3:151430484-151430506 AGTACAATGTTCATGTTATTTGG + Intronic
968859261 4:3153276-3153298 ATTACCAGGGTGATGGTATTAGG - Intronic
970071491 4:12164617-12164639 ATTGACATGTTCAGGATATTTGG + Intergenic
970726260 4:19048606-19048628 ATTAGCAGGATCAAGTTATGAGG - Intergenic
970905931 4:21216158-21216180 TTTACAAGGATCAGGTTTTTTGG + Intronic
971473313 4:27050072-27050094 ATTGCCAGGTGGAGGTTGTTAGG + Intergenic
973716741 4:53684463-53684485 AGGACCAGCTTCATGTTATTAGG - Intronic
973990793 4:56404981-56405003 GTTACCAAGTCAAGGTTATTGGG + Intronic
975883304 4:78937231-78937253 ATTACCAGATGGAGGTTGTTAGG + Intronic
977865388 4:102019937-102019959 ATTATTGGGTTCAGGGTATTTGG + Intronic
978029183 4:103917314-103917336 ATTCACAGGTTCTGGTAATTAGG + Intergenic
978859617 4:113432562-113432584 ATGCCCAGGTTCTGGGTATTAGG - Intergenic
979790138 4:124769883-124769905 ATTGCTATTTTCAGGTTATTTGG + Intergenic
979791470 4:124787249-124787271 ATAACCAAGTTGAGGCTATTGGG - Intergenic
981526420 4:145710656-145710678 ATTACCAGTTTCAGGTGTTTTGG + Intronic
982092888 4:151895949-151895971 ATTGCCAGGTGGAGGTTTTTAGG - Intergenic
983119791 4:163867993-163868015 ACTACCAAGTTCAGATAATTGGG - Intronic
984685446 4:182662577-182662599 ATTCCCAGGTTCAGGCTCTAGGG + Intronic
986383874 5:7211973-7211995 ATTATCAGGTTCAGATCCTTGGG + Intergenic
988937967 5:36108188-36108210 ATTAGTAGGTGTAGGTTATTTGG - Intronic
990492614 5:56317479-56317501 ATCTCAAAGTTCAGGTTATTTGG - Intergenic
992075620 5:73190260-73190282 ATTAGCAAGTTCAGGTCACTGGG + Intergenic
993914283 5:93723245-93723267 ATTAACAGGTTAAGGTTGTAGGG - Intronic
994484209 5:100374686-100374708 ATTCCCAGGTTCAAGCAATTGGG - Intergenic
995480151 5:112585228-112585250 GTTACCAGGTTGAGGTTGCTGGG + Intergenic
996584933 5:125076244-125076266 ACTATCAGGTTCATGTTATAAGG + Intergenic
998878663 5:146625714-146625736 ATTCCCAGGTTCCGGGCATTAGG - Intronic
999033937 5:148326399-148326421 ACTACCAGTTTCAGTTTCTTTGG - Intronic
1000455855 5:161448075-161448097 ATTAAAATGTACAGGTTATTTGG + Intronic
1000701479 5:164456754-164456776 ATTACCAAGTTGATGGTATTTGG + Intergenic
1001813164 5:174646096-174646118 ATTTCCAGGTTCTGGAGATTAGG + Intergenic
1004876660 6:19962458-19962480 ATTCACAAGTTCAGGGTATTAGG - Intergenic
1005233084 6:23727499-23727521 ATTACTATGTTCTGTTTATTAGG - Intergenic
1006974107 6:38081064-38081086 ATTACCTGTTTCATGTTCTTTGG + Intronic
1013303532 6:108826722-108826744 ATTCACAGGTTCTGGGTATTAGG - Intergenic
1016117221 6:140302202-140302224 GTAAACAGGTTCAGGTTATGTGG + Intergenic
1017330457 6:153192276-153192298 ATTTACATGTTCAGGTAATTTGG + Intergenic
1018914584 6:168125310-168125332 AACAAGAGGTTCAGGTTATTTGG + Intergenic
1020937260 7:14483148-14483170 GTTACCAGGTTCCAGTTATTAGG - Intronic
1021612974 7:22475834-22475856 GTTGCCAGGTGGAGGTTATTAGG + Intronic
1027765791 7:82339808-82339830 ATTAACAGGTTCTGGGGATTAGG - Intronic
1028032271 7:85931558-85931580 ACTACCAGTTGGAGGTTATTTGG + Intergenic
1031167446 7:118246194-118246216 ATTCCCAGGTTCTGGGCATTAGG + Intergenic
1031167474 7:118246538-118246560 ATTCCCAGGTTCTGGGCATTAGG + Intergenic
1035215661 7:157364662-157364684 ATTGCCAGATTCAGGATTTTAGG + Intronic
1037626881 8:20615837-20615859 ATTTTCAGCTTCAGGTTCTTTGG + Intergenic
1040735533 8:50502770-50502792 TTTTTCAGGTTCAGGTTCTTCGG + Exonic
1042158941 8:65872646-65872668 ATTACCGAGTTCAGGCTAATAGG - Intergenic
1042433520 8:68736887-68736909 ATTATTAGGCTGAGGTTATTGGG + Intronic
1046271518 8:111903466-111903488 GTTACCAGGGCCAGGGTATTGGG - Intergenic
1047111800 8:121798571-121798593 ATAAACAGGGTCAGGGTATTTGG - Intergenic
1047668776 8:127121693-127121715 ATTTCCAGCATCTGGTTATTGGG - Intergenic
1051494380 9:17702884-17702906 ATTAACAGATTCAGGGCATTTGG - Intronic
1051614785 9:18997064-18997086 ATTACCTGGTTCATCTCATTGGG + Intronic
1051877747 9:21809255-21809277 ATTCCCAGGTTCTGGGAATTAGG + Intronic
1052083076 9:24230558-24230580 AGTACCAGGTTCATCTTACTAGG - Intergenic
1054826990 9:69583150-69583172 ATTGCCAGGTGGAGGTCATTAGG + Intronic
1055352252 9:75401940-75401962 ATTCCCAGGGCCAGGATATTTGG + Intergenic
1060118771 9:120968099-120968121 ATTCACAGGTTCAGGGGATTAGG - Intronic
1060764373 9:126282891-126282913 ATTCCCAGGTTCTGGGGATTAGG - Intergenic
1060793481 9:126500471-126500493 ATTCCCAGGTTCCAGTGATTGGG + Intronic
1185561221 X:1061888-1061910 ATTACCAGGTTCTGGGCTTTAGG + Intergenic
1185698889 X:2215482-2215504 ATTCCCAGGCTCTGGGTATTAGG - Intergenic
1185698937 X:2215821-2215843 ATTCCCAGGCTCTGGATATTAGG - Intergenic
1185699039 X:2216465-2216487 ATTCCCAGGCTCTGGGTATTAGG - Intergenic
1185699086 X:2216807-2216829 ATTCCCAGGCTCTGGATATTAGG - Intergenic
1186232294 X:7468458-7468480 ACTACCAGGTTCAGGGTACATGG + Intergenic
1187799834 X:23048954-23048976 ATTAAGAGCTTGAGGTTATTTGG + Intergenic
1188266900 X:28087975-28087997 ATTTACAGGTTCAGGGGATTCGG + Intergenic
1188352856 X:29153340-29153362 ATTCGCAGGTTCAGGAGATTAGG + Intronic
1188461683 X:30434476-30434498 ATTTACAGGTTCTGGGTATTAGG - Intergenic
1189517441 X:41728873-41728895 ATTATCTGGCTCATGTTATTGGG + Exonic
1190084129 X:47380656-47380678 ATCACCAGTTTCAGGTTTTTTGG + Intronic
1192606694 X:72526104-72526126 AATACCATGTTCAGGTAGTTTGG - Intronic
1193902502 X:87199492-87199514 ATTACTAGATTCAGATTCTTTGG - Intergenic
1198722474 X:139637749-139637771 ATTACCAGGTTCCAGGGATTAGG - Intronic
1199235722 X:145489873-145489895 ATTTCCAGGTTTATGATATTTGG - Intergenic
1199563138 X:149185693-149185715 ATTTCCAGGTTTTGGCTATTTGG - Intergenic
1200980594 Y:9260205-9260227 TTTTGCAGGTTCAGGATATTTGG - Intergenic