ID: 914885735

View in Genome Browser
Species Human (GRCh38)
Location 1:151582890-151582912
Sequence CTGCAGGGTCATTCAGAGCC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 231}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914885735 Original CRISPR CTGCAGGGTCATTCAGAGCC AGG (reversed) Exonic
900144123 1:1150602-1150624 CTGCAGGGGGATGCAGAGCTGGG + Intergenic
901240667 1:7691322-7691344 CTGGAGGGACCCTCAGAGCCAGG + Intronic
901497499 1:9630276-9630298 CTGCAGGGTCACTCGGTGTCAGG + Intergenic
902386804 1:16080551-16080573 CTTCAGGGCGATTCTGAGCCTGG + Intergenic
903524489 1:23982806-23982828 GTGCAGGGTCCTTCTGAGCATGG + Intergenic
904211627 1:28889687-28889709 CTGCAGGGTGAGACAGAGGCTGG + Intronic
905184695 1:36187999-36188021 CTTCAGGCTCAGTCAGGGCCTGG - Intergenic
906683432 1:47746951-47746973 CTGCAAAGTCCTTGAGAGCCAGG + Intergenic
907308787 1:53527859-53527881 CTGCAGGCTCATTCTGGGCCTGG + Intronic
907411119 1:54284033-54284055 CTTCAGGTTCTTTCAGAGACTGG + Intronic
907746945 1:57223054-57223076 CTGCAGGAGCATTCAGAGAAAGG - Intronic
908293479 1:62690634-62690656 AAGCAGGGTAATTCAGAGTCTGG + Intergenic
909042657 1:70672564-70672586 CTCCGGGGTCATTTTGAGCCTGG - Intergenic
909080028 1:71098992-71099014 CTCCAGGATTATTCAGTGCCTGG - Intergenic
910847480 1:91617361-91617383 GTTCAGGCTCCTTCAGAGCCAGG - Intergenic
912505476 1:110152779-110152801 CTGCAGGCTTATTTTGAGCCAGG + Intronic
912681168 1:111729854-111729876 CTGCTGGCTCATTGAGAGCCTGG - Intronic
914885735 1:151582890-151582912 CTGCAGGGTCATTCAGAGCCAGG - Exonic
914957846 1:152180645-152180667 CTGAATGGTCATGCAGAGGCCGG - Intergenic
915070155 1:153260005-153260027 CTGCAGAGTCCTTCTGTGCCCGG - Intronic
917638339 1:176958483-176958505 CTGCAGGGACACCCAGTGCCAGG + Intronic
918070437 1:181130257-181130279 CTGCAGGGACATTTTGAGGCAGG - Intergenic
922803101 1:228372987-228373009 CTGCAGGCTCATCCAGCGGCAGG - Exonic
923287152 1:232507327-232507349 CAGAAGAGTCATTCATAGCCGGG + Intronic
1062893878 10:1088129-1088151 CTGCAGCCTAATTCAGAGCAGGG - Intronic
1067277820 10:44850454-44850476 AGGCAGGGTCACTAAGAGCCAGG + Intergenic
1069796119 10:71053088-71053110 CAGCATGGTCACTGAGAGCCAGG - Intergenic
1072697364 10:97613834-97613856 CTGTAGTGCCATTCAGAGCCTGG - Intronic
1073121420 10:101124555-101124577 CTGCAGGCTCCTGCTGAGCCAGG - Intronic
1073243532 10:102073773-102073795 GTGCAGAGACCTTCAGAGCCAGG - Intergenic
1073483025 10:103798796-103798818 CTGCCGGCGTATTCAGAGCCAGG - Intronic
1074188541 10:111116613-111116635 GTGGAGGGTCTTTCAGTGCCTGG - Intergenic
1074240304 10:111632176-111632198 TCCCAGGGTCATTAAGAGCCAGG + Intergenic
1077034713 11:489052-489074 CTGCAGAGCCAGGCAGAGCCGGG - Intronic
1077053364 11:577732-577754 CTGCAGGCTTGTTCAGTGCCTGG + Intronic
1077233366 11:1468534-1468556 CTGCATGGTGAGTCAGTGCCTGG - Intergenic
1078267563 11:9766377-9766399 TTACAGGGCCATTCAAAGCCAGG - Intergenic
1079388416 11:20000655-20000677 CTGCAGGGACATTCAAGGCCAGG - Intronic
1080840397 11:35978369-35978391 GTGCAGGGTCATCCAGGGCAGGG + Intronic
1081626746 11:44660498-44660520 CTGAAGGGCCTTCCAGAGCCAGG + Intergenic
1082066148 11:47902170-47902192 CTGAAGGGTCATTTAGAGTTGGG - Intergenic
1084108514 11:66997326-66997348 GTGCAGGGTCACACAGACCCGGG + Intergenic
1089662254 11:119993306-119993328 ATCCAGGGTCATTCTGGGCCTGG - Intergenic
1090029805 11:123196430-123196452 CTCCAGGGACATTCAGAGACTGG - Intergenic
1090339976 11:126009228-126009250 CTCCAGCTTCATTCAGAGCAAGG + Intronic
1091625077 12:2115482-2115504 CTTCAGGGTCAGGCAGAGCAGGG - Exonic
1095629876 12:44363067-44363089 ATGTAAGGTCATTTAGAGCCAGG + Intronic
1096492083 12:52018553-52018575 CTCCAGGGTCTAACAGAGCCTGG + Intergenic
1097403361 12:59157508-59157530 CTGATTGGTCATTCATAGCCTGG + Intergenic
1100459731 12:94787527-94787549 CTCAAGGGTCATTTAGACCCGGG + Intergenic
1102000362 12:109554021-109554043 CAGCAGGATCTATCAGAGCCTGG + Exonic
1103704054 12:122861891-122861913 CTGCAGGCTCAGTAAGGGCCAGG - Exonic
1106782011 13:33068520-33068542 CTGTAAGGTCATTTTGAGCCTGG - Intergenic
1107274404 13:38661460-38661482 TTGCAGCATGATTCAGAGCCAGG + Intergenic
1107301225 13:38967861-38967883 TTTCAAGGACATTCAGAGCCAGG + Intronic
1107346371 13:39465778-39465800 CTTCATGTTCATTCAAAGCCAGG - Intronic
1111908203 13:94280355-94280377 TTTCCGGGTCATTCAGATCCTGG + Intronic
1112610603 13:100951334-100951356 CTGCAGGATGGCTCAGAGCCTGG + Intergenic
1113430550 13:110246692-110246714 CTGTAGGGTCATCCAGACACCGG - Intronic
1114394043 14:22340515-22340537 CTGAACAGTCATTTAGAGCCTGG - Intergenic
1117742204 14:58830433-58830455 ATGCAAGGTCCTTCAGAGCAGGG - Intergenic
1119543653 14:75456725-75456747 CTGAGGGGTCATGCAGGGCCGGG - Intronic
1120131087 14:80808331-80808353 CTGCAGAGTCATGCAGAGGTGGG - Intronic
1120504564 14:85338749-85338771 CTGCAGGCCTATTGAGAGCCTGG + Intergenic
1120716702 14:87848355-87848377 CTTCAGGGTCAAACAGAGTCAGG - Intronic
1120757465 14:88257557-88257579 GTGCATGGTGGTTCAGAGCCTGG + Intronic
1121609792 14:95269907-95269929 CTGCAGGGGCATGCAGGGACAGG - Intronic
1122456400 14:101855779-101855801 CTGGACCGTCATTCAGAGCTTGG + Intronic
1122943910 14:104996364-104996386 TTGCAGGGTCCTCCAGACCCTGG - Intronic
1123131315 14:105987837-105987859 CTGAAGGAGCATTCTGAGCCAGG - Intergenic
1123470608 15:20549410-20549432 CTCCAGGGTCCGTCAGCGCCAGG + Intergenic
1123581546 15:21719037-21719059 CTGAAGGAGCATTCTGAGCCAGG - Intergenic
1123618195 15:22161660-22161682 CTGAAGGAGCATTCTGAGCCAGG - Intergenic
1123647452 15:22451290-22451312 CTCCAGGGTCCGTCAGCGCCAGG - Intergenic
1123730908 15:23144388-23144410 CTCCAGGGTCCGTCAGCGCCAGG + Intergenic
1123749047 15:23341814-23341836 CTCCAGGGTCCGTCAGCGCCAGG + Intergenic
1123997880 15:25731563-25731585 CAGCAGGGTCAGGCTGAGCCAGG + Intronic
1124301284 15:28545924-28545946 CTCCAGGGTCCGTCAGCGCCAGG - Intergenic
1125768447 15:42150135-42150157 CTGCTGTGTCTTTCAGGGCCAGG - Exonic
1127324276 15:57880159-57880181 CTGCATGTTCATTCACAGCTTGG - Intergenic
1128323914 15:66711236-66711258 GTGCAGGGAAAGTCAGAGCCAGG - Intronic
1128708916 15:69857514-69857536 CTGCAGTTTCACTCAGATCCTGG + Intergenic
1128880339 15:71236738-71236760 CTGCAGGCTCCTTCAGGGCAGGG - Intronic
1131007078 15:88987147-88987169 CTCCAGGCTGATTCAGACCCTGG - Intergenic
1133065984 16:3207359-3207381 GGGCAGGGTCAGCCAGAGCCAGG + Intergenic
1134047693 16:11113194-11113216 CTGCATGATCAGGCAGAGCCCGG + Intronic
1134470289 16:14519103-14519125 CTCCAGTGTCATTGAGAACCAGG + Intronic
1136479591 16:30533286-30533308 CTGCAGAGCCAGACAGAGCCTGG + Intronic
1136483370 16:30556245-30556267 CTGCAGAGCCAGACAGAGCCGGG + Intronic
1137483278 16:48870239-48870261 CAGCAGGATCAGTCAGGGCCTGG + Intergenic
1138010273 16:53373049-53373071 CTCCAGGGTCCGTCAGCGCCAGG + Intergenic
1140201424 16:72897841-72897863 CTGCAAGGTCACACAGAGCATGG + Intronic
1140957068 16:79875978-79876000 CTGCAGGGTGAATCAGGGTCAGG - Intergenic
1141348128 16:83267308-83267330 CTGCTTTATCATTCAGAGCCCGG + Intronic
1142033484 16:87850044-87850066 CTGCAGGGGGATGCAGTGCCGGG - Intronic
1143315271 17:6027365-6027387 CCGCAGGGATATTCAGGGCCAGG - Intronic
1143839013 17:9716622-9716644 CTGCAGGTTCATTCATGGGCTGG + Intronic
1146268423 17:31468389-31468411 GCGCAAGGACATTCAGAGCCAGG - Intronic
1146918418 17:36693024-36693046 CTGCAGGGTCATAAAGAGCTTGG + Intergenic
1147255153 17:39176915-39176937 GAGCAGGGGCCTTCAGAGCCAGG - Intronic
1147602773 17:41756141-41756163 CTCCAGGGTCCTGAAGAGCCCGG + Intronic
1148097976 17:45067344-45067366 CTTCAGTGTCATTGAGATCCTGG + Intronic
1149413993 17:56439161-56439183 ATGCAGGATCATCCAGAGCAAGG + Intronic
1149537550 17:57444144-57444166 CTGCAGGGTCACTCAGGCCTTGG - Intronic
1150717137 17:67581565-67581587 GAGCAGGGTCAAGCAGAGCCTGG - Intronic
1152543208 17:80987408-80987430 CTGCAGGGTCCAGCAGAGCCAGG + Intergenic
1152602251 17:81270167-81270189 CTGCAGCGTCACTCCCAGCCAGG - Intronic
1153300805 18:3590478-3590500 GAGCAGGGTTATTCAAAGCCTGG + Intronic
1153626112 18:7023658-7023680 CTGCAGGCTCAGCCAGAGCTGGG + Intronic
1154097215 18:11429787-11429809 GTACAGTGTCATTGAGAGCCTGG + Intergenic
1156341082 18:36211314-36211336 CTGCATGGTGATTAAGAGCAGGG + Intronic
1157526945 18:48390787-48390809 CTCCAGGGGCACTAAGAGCCTGG + Intronic
1157742871 18:50108933-50108955 ATGTGGGGTCATTCAAAGCCAGG - Intronic
1160333761 18:78018486-78018508 CTGCAAGGCCAGGCAGAGCCCGG + Intergenic
1161327022 19:3668926-3668948 CTCCAGGCTCATGCAGAGGCGGG + Intronic
1161709109 19:5837924-5837946 CTCGAGGGACACTCAGAGCCCGG + Intronic
1162195334 19:8980309-8980331 CTGCTGTGTCCTGCAGAGCCAGG + Exonic
1162421793 19:10569605-10569627 CTGCTGGCTCAGTCTGAGCCCGG - Intergenic
1163270188 19:16248396-16248418 CAGCAGGGTCAGTCTGAGCCTGG - Intergenic
1163680604 19:18679902-18679924 CTGCAGTCTCAGTCAGAACCAGG + Intergenic
1164683491 19:30151393-30151415 CTGCAGGGGCATTGAGAAACTGG - Intergenic
1165191155 19:34064570-34064592 CTGCACGGTCACACACAGCCTGG + Intergenic
1166110385 19:40619033-40619055 ATGCTGGGTCAATCAAAGCCAGG - Intronic
1166301919 19:41915837-41915859 CTGCAGGGCCAAACAGGGCCTGG + Intronic
1167024245 19:46903400-46903422 TCCCAGGGCCATTCAGAGCCAGG + Intergenic
1167418485 19:49389555-49389577 CTGCAGGGTGTTCCAGACCCTGG + Intronic
1168008406 19:53509699-53509721 CTGCAGAGCAATGCAGAGCCTGG + Intergenic
1168061776 19:53897122-53897144 CTGCAGTGTCAGTCTCAGCCTGG + Intronic
1168334596 19:55590616-55590638 CTGAAGGCTTATTCTGAGCCAGG - Intergenic
926036396 2:9639151-9639173 CTGCAGGATCCTTCAGAGTGAGG - Intergenic
927590158 2:24348650-24348672 TTGCAGGGGCAGACAGAGCCTGG + Intronic
928258120 2:29742521-29742543 CTGTAGGGGAAATCAGAGCCAGG - Intronic
932468019 2:71935829-71935851 CTGCGGGGTCAGGCAGAGGCTGG - Intergenic
933844585 2:86315075-86315097 CTGCAGGGCCCTTGAGACCCTGG + Intronic
934117675 2:88812032-88812054 CTGTAGGGGCAGTCAGAGCATGG - Intergenic
935976999 2:108587861-108587883 CTGCTGGGGCAGCCAGAGCCTGG + Intronic
936401094 2:112165008-112165030 CTGCGGGGGTGTTCAGAGCCGGG - Exonic
938139582 2:128784722-128784744 CTGGAGGGCCACTCAGGGCCAGG + Intergenic
939826845 2:147025364-147025386 CTGCAGACTCATTCTGAGGCTGG - Intergenic
942611852 2:177750455-177750477 CTGCAGGACCATCCAGATCCTGG - Intronic
944416573 2:199485157-199485179 CAGCAGGGCCTTTCAGAGCAGGG + Intergenic
945327777 2:208502462-208502484 CTGCAGTATCATGCAGAGCATGG + Intronic
947539836 2:230968775-230968797 CTGCAGCCTCATTCAGGGTCTGG - Intergenic
949001576 2:241617494-241617516 CTGCAGAGCCATTAAGAGCCAGG - Intronic
949041507 2:241851967-241851989 CTGCAGGGACAATAGGAGCCAGG - Exonic
949055363 2:241925247-241925269 CTGATGCGGCATTCAGAGCCAGG - Intergenic
1169414984 20:5408546-5408568 CTGCAGGGGCAATCCCAGCCTGG + Intergenic
1171095301 20:22327222-22327244 CTGCAGGGTAATTCATACACAGG - Intergenic
1171342103 20:24437858-24437880 CTAGAGGGAAATTCAGAGCCTGG + Intergenic
1174166167 20:48584969-48584991 CTGCTGGGTGATTCAGTTCCTGG - Intergenic
1175068808 20:56314522-56314544 CTGCAGGGAGATGCAGGGCCTGG + Intergenic
1175141665 20:56865265-56865287 CTGGAGTGTGATTCAGAGTCGGG - Intergenic
1175197227 20:57252637-57252659 CTCCAGGGTGTTTCAAAGCCAGG + Intronic
1175793698 20:61758111-61758133 GTGCAGGCACATTCAGAGTCAGG + Intronic
1175999278 20:62824871-62824893 CTGCAGGGTCAGTCAGCCCAGGG - Intronic
1180127005 21:45799726-45799748 CGGCAGGGCCACCCAGAGCCTGG + Intronic
1180998111 22:19975521-19975543 CTGGAGGGTGATTCAGCACCAGG - Intronic
1181007782 22:20022217-20022239 TCCCAAGGTCATTCAGAGCCAGG + Intronic
1181732730 22:24859407-24859429 CCCCAGGTTCCTTCAGAGCCAGG - Intronic
1181756105 22:25026204-25026226 CTGCTGAGTGAGTCAGAGCCGGG + Intronic
1182476211 22:30577851-30577873 CTGCAGAATCATTAAGAGGCGGG + Intronic
1182555278 22:31125664-31125686 GGCCAGGGTCCTTCAGAGCCTGG + Exonic
1184152840 22:42648655-42648677 TTGCAGGGTCAGTGGGAGCCTGG + Intronic
1185280210 22:49966695-49966717 CACCTGGGTCATTCAGAGCTGGG + Intergenic
949333556 3:2949004-2949026 CTGCAGTGTCCTACATAGCCAGG + Intronic
950095379 3:10326409-10326431 CTCCATGTTCATTCGGAGCCAGG - Exonic
950140179 3:10609856-10609878 TTGAAGGGTCACTCAGTGCCAGG - Intronic
951459565 3:22935378-22935400 CTTCAGGGTAATTCAGATTCTGG - Intergenic
953331036 3:42053352-42053374 CTGCAGTCCCATTCAGAGTCGGG + Intronic
953447871 3:42982982-42983004 CTTTAGGGTCACTTAGAGCCAGG + Intronic
954186901 3:48924220-48924242 CTGGAGGATCATTCAAAACCAGG - Intronic
957337875 3:78855401-78855423 CTGCAAAGTCAGGCAGAGCCTGG + Intronic
957558525 3:81792023-81792045 ATGCAGGCTGATTCAGATCCTGG + Intergenic
961654292 3:128432931-128432953 CTGCGGGGTCGGTCAGATCCGGG + Intergenic
961656010 3:128442172-128442194 CTGCTGGGCCCTGCAGAGCCTGG - Intergenic
962852407 3:139317970-139317992 CTGCAGGATGATACAGAGCCAGG + Intronic
963559448 3:146843627-146843649 CTGCAGGCTTGGTCAGAGCCTGG - Intergenic
963603946 3:147398364-147398386 CTGCAGGCCCTCTCAGAGCCTGG - Intronic
968755359 4:2413105-2413127 TTGCAGGGCAATTAAGAGCCTGG - Intronic
969351013 4:6597946-6597968 CTTCAGGGTCCTTCAGAGCAGGG + Intronic
970890270 4:21036012-21036034 CTGCAGGATCACTCTGAGACTGG + Intronic
973293861 4:48494508-48494530 CTGCAGCCTAACTCAGAGCCTGG - Intergenic
974642691 4:64652166-64652188 CTGCTGGGACATGCAGGGCCTGG + Intergenic
979456000 4:120926643-120926665 CTGGAGGATCACTCAAAGCCAGG - Intergenic
982113989 4:152081956-152081978 CTGCATAGTCACTGAGAGCCTGG + Intergenic
983626931 4:169811381-169811403 CTGCAGGGGGATTCAAATCCTGG - Intergenic
987074626 5:14369376-14369398 CTGCAGCGTCCTCGAGAGCCTGG + Exonic
988984309 5:36601974-36601996 CTGCAGGGTCTTTGAGGGCAGGG - Intergenic
991194801 5:63920297-63920319 CACCAAGGTCATTCACAGCCTGG - Intergenic
991458332 5:66828759-66828781 CAGCACGCTAATTCAGAGCCCGG - Intronic
993267052 5:85739894-85739916 CTGCAGCTGCATTCAGAGGCTGG + Intergenic
994043564 5:95284489-95284511 CTGCAGGTTCTTCCAGAGCCGGG + Exonic
995313428 5:110739205-110739227 CTGCAAGGTCCTTCAGCACCGGG + Exonic
995476654 5:112554823-112554845 CTGCCCTGTCTTTCAGAGCCCGG - Intergenic
997011227 5:129880796-129880818 CTGCAAGGGCATTGTGAGCCTGG - Intergenic
997894093 5:137700413-137700435 CAGCAGTGTAAATCAGAGCCTGG + Intronic
997962221 5:138331325-138331347 CCGAAGGGTGATTCACAGCCTGG + Intronic
998743880 5:145234810-145234832 CCCCTGGGTCATTCTGAGCCAGG - Intergenic
999811592 5:155132557-155132579 CTGGAGGGTCCTGCAGAGTCAGG - Intergenic
1001246687 5:170110150-170110172 CTGCAGGGTCAGACAGATCTAGG - Intergenic
1002504551 5:179670148-179670170 CTGCAGCTTCAGTCAGAGCAGGG + Intergenic
1003656424 6:8014725-8014747 CTTCTGGTTCATTCAAAGCCAGG + Exonic
1004445123 6:15690875-15690897 GTCCAGGATCATTCAGATCCAGG - Intergenic
1005945316 6:30591035-30591057 CTGTAGGGTAAATCAGAGGCAGG - Exonic
1006372331 6:33652808-33652830 CTCCAGGCTCACTCAGACCCTGG - Intronic
1007245472 6:40458859-40458881 CTGGACAGTCATTCAGACCCAGG - Intronic
1007762187 6:44139603-44139625 CTGCTGGGTCAGTGAGGGCCAGG + Exonic
1008703778 6:54132802-54132824 CTGCAGGGGAATTCAGTGCAGGG + Intronic
1013163115 6:107565345-107565367 CTGCAGGTTCAGTCAGACCAAGG + Intronic
1015445695 6:133301880-133301902 CTGCAAGCTCCTTCAGAGCATGG - Intronic
1018498725 6:164379161-164379183 CTGCACGGCCATTCGTAGCCCGG - Intergenic
1018996453 6:168714052-168714074 CTGCAGTGTCATTTAAAGCTGGG - Intergenic
1020136011 7:5588455-5588477 CAGCATGGTCAGCCAGAGCCCGG - Intergenic
1021888399 7:25163391-25163413 CTCCAGGGCCATTCGGAGGCTGG - Intronic
1022378754 7:29840319-29840341 CTGCATAGCCATTGAGAGCCTGG + Intronic
1022808463 7:33846411-33846433 CTCCAAGGTCATGCAGAGCAAGG + Intergenic
1024090892 7:45939067-45939089 CTGCAGGTGCATCCAGTGCCTGG - Intergenic
1025118193 7:56276460-56276482 CAGCAGGGCCTTCCAGAGCCCGG + Intergenic
1027139438 7:75646842-75646864 CTGCAGTGCCACTTAGAGCCAGG + Intronic
1029256358 7:99272338-99272360 GGGCAGGTTCATGCAGAGCCAGG + Intergenic
1029663639 7:101980116-101980138 CTGCAGTGTCATTCTGGGCCAGG + Intronic
1030148286 7:106378329-106378351 CTGCAGCCTCATCCAGAGGCTGG + Intergenic
1030306425 7:108023504-108023526 CTACATGGTCATTCTCAGCCAGG - Intergenic
1031528176 7:122846832-122846854 CTGCAGGGTCATGCACAGCATGG - Intronic
1032388577 7:131541068-131541090 CTGCAGAGTAATTCACAGCAGGG + Intronic
1032601422 7:133300293-133300315 CTGCAGGGTTATTGACAGTCTGG - Intronic
1034116130 7:148585575-148585597 CAGCTGGGCCAATCAGAGCCAGG - Intergenic
1034445812 7:151113759-151113781 ATGCAGTGTCAATCACAGCCGGG + Intronic
1034672817 7:152870877-152870899 CTGCAGGATGATCCAGAGCCGGG + Intergenic
1034672829 7:152870929-152870951 CTGCAGGATGATCCAGAGCCGGG + Intergenic
1034672841 7:152870981-152871003 CTGCAGGATGATCCAGAGCCGGG + Intergenic
1034672853 7:152871033-152871055 CTGCAGGATGATCCAGAGCCGGG + Intergenic
1039553944 8:38463492-38463514 CTGCAGGCTCCTTCAGAACAGGG + Intronic
1040432360 8:47356013-47356035 CTGCAGGTTCCTTGAGGGCCAGG + Intronic
1040574505 8:48639596-48639618 CTGCAGGGTCAATTACACCCAGG - Intergenic
1040831459 8:51681559-51681581 CTGCAGAGTCACCCAGGGCCTGG + Intronic
1044115208 8:88327319-88327341 CTGCAGGTTCACCCACAGCCGGG + Exonic
1045324853 8:101110282-101110304 CTGCATGGTCACACACAGCCTGG - Intergenic
1045356247 8:101391829-101391851 CTGCAGAGTCAGTGAGAGTCAGG - Intergenic
1045686496 8:104718160-104718182 CTGTATGGTTATTCAGAGCTGGG - Intronic
1047951167 8:129936430-129936452 CTACAGCGTAATTAAGAGCCAGG + Intronic
1048256259 8:132907274-132907296 GGGCAGGGTCACTCAGAGGCTGG - Intronic
1049770442 8:144378041-144378063 CTGAGGGGACATTCAGAGACGGG + Intronic
1050559382 9:6819005-6819027 CTGATGGGTCATCCAGATCCTGG + Intronic
1062036960 9:134386682-134386704 CTGCAGGGTCTGGCAGACCCAGG - Intronic
1062278228 9:135740566-135740588 CTGCTGTGTCCTGCAGAGCCTGG - Intronic
1062375918 9:136261869-136261891 CTCCAGGGCCATTTCGAGCCCGG + Intergenic
1186930268 X:14381506-14381528 CTGCAGCGTCCTCCAGAGGCGGG - Intergenic
1189989690 X:46582483-46582505 CTGTAGGGTCAGAGAGAGCCAGG - Intronic
1201305243 Y:12544318-12544340 CTGCATGGATTTTCAGAGCCGGG - Intergenic