ID: 914887698

View in Genome Browser
Species Human (GRCh38)
Location 1:151599021-151599043
Sequence AAAGAAGGATGGGAGTGAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914887698_914887714 29 Left 914887698 1:151599021-151599043 CCCCCTCACTCCCATCCTTCTTT No data
Right 914887714 1:151599073-151599095 GCAAGCTCCTCACACTGGGATGG No data
914887698_914887713 25 Left 914887698 1:151599021-151599043 CCCCCTCACTCCCATCCTTCTTT No data
Right 914887713 1:151599069-151599091 ACTGGCAAGCTCCTCACACTGGG No data
914887698_914887715 30 Left 914887698 1:151599021-151599043 CCCCCTCACTCCCATCCTTCTTT No data
Right 914887715 1:151599074-151599096 CAAGCTCCTCACACTGGGATGGG No data
914887698_914887711 7 Left 914887698 1:151599021-151599043 CCCCCTCACTCCCATCCTTCTTT No data
Right 914887711 1:151599051-151599073 GGTTTTGTTCTGGTATTCACTGG No data
914887698_914887712 24 Left 914887698 1:151599021-151599043 CCCCCTCACTCCCATCCTTCTTT No data
Right 914887712 1:151599068-151599090 CACTGGCAAGCTCCTCACACTGG No data
914887698_914887706 -3 Left 914887698 1:151599021-151599043 CCCCCTCACTCCCATCCTTCTTT No data
Right 914887706 1:151599041-151599063 TTTGACCCCCGGTTTTGTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914887698 Original CRISPR AAAGAAGGATGGGAGTGAGG GGG (reversed) Intergenic
No off target data available for this crispr