ID: 914887700

View in Genome Browser
Species Human (GRCh38)
Location 1:151599023-151599045
Sequence TCAAAGAAGGATGGGAGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914887700_914887706 -5 Left 914887700 1:151599023-151599045 CCCTCACTCCCATCCTTCTTTGA No data
Right 914887706 1:151599041-151599063 TTTGACCCCCGGTTTTGTTCTGG No data
914887700_914887713 23 Left 914887700 1:151599023-151599045 CCCTCACTCCCATCCTTCTTTGA No data
Right 914887713 1:151599069-151599091 ACTGGCAAGCTCCTCACACTGGG No data
914887700_914887711 5 Left 914887700 1:151599023-151599045 CCCTCACTCCCATCCTTCTTTGA No data
Right 914887711 1:151599051-151599073 GGTTTTGTTCTGGTATTCACTGG No data
914887700_914887714 27 Left 914887700 1:151599023-151599045 CCCTCACTCCCATCCTTCTTTGA No data
Right 914887714 1:151599073-151599095 GCAAGCTCCTCACACTGGGATGG No data
914887700_914887712 22 Left 914887700 1:151599023-151599045 CCCTCACTCCCATCCTTCTTTGA No data
Right 914887712 1:151599068-151599090 CACTGGCAAGCTCCTCACACTGG No data
914887700_914887715 28 Left 914887700 1:151599023-151599045 CCCTCACTCCCATCCTTCTTTGA No data
Right 914887715 1:151599074-151599096 CAAGCTCCTCACACTGGGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914887700 Original CRISPR TCAAAGAAGGATGGGAGTGA GGG (reversed) Intergenic
No off target data available for this crispr