ID: 914887705

View in Genome Browser
Species Human (GRCh38)
Location 1:151599036-151599058
Sequence ACAAAACCGGGGGTCAAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914887705_914887711 -8 Left 914887705 1:151599036-151599058 CCTTCTTTGACCCCCGGTTTTGT No data
Right 914887711 1:151599051-151599073 GGTTTTGTTCTGGTATTCACTGG No data
914887705_914887712 9 Left 914887705 1:151599036-151599058 CCTTCTTTGACCCCCGGTTTTGT No data
Right 914887712 1:151599068-151599090 CACTGGCAAGCTCCTCACACTGG No data
914887705_914887713 10 Left 914887705 1:151599036-151599058 CCTTCTTTGACCCCCGGTTTTGT No data
Right 914887713 1:151599069-151599091 ACTGGCAAGCTCCTCACACTGGG No data
914887705_914887715 15 Left 914887705 1:151599036-151599058 CCTTCTTTGACCCCCGGTTTTGT No data
Right 914887715 1:151599074-151599096 CAAGCTCCTCACACTGGGATGGG No data
914887705_914887714 14 Left 914887705 1:151599036-151599058 CCTTCTTTGACCCCCGGTTTTGT No data
Right 914887714 1:151599073-151599095 GCAAGCTCCTCACACTGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914887705 Original CRISPR ACAAAACCGGGGGTCAAAGA AGG (reversed) Intergenic
No off target data available for this crispr