ID: 914887707

View in Genome Browser
Species Human (GRCh38)
Location 1:151599046-151599068
Sequence GAATACCAGAACAAAACCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914887707_914887712 -1 Left 914887707 1:151599046-151599068 CCCCCGGTTTTGTTCTGGTATTC No data
Right 914887712 1:151599068-151599090 CACTGGCAAGCTCCTCACACTGG No data
914887707_914887718 24 Left 914887707 1:151599046-151599068 CCCCCGGTTTTGTTCTGGTATTC No data
Right 914887718 1:151599093-151599115 TGGGTCTACTCTTTGACCCAGGG No data
914887707_914887713 0 Left 914887707 1:151599046-151599068 CCCCCGGTTTTGTTCTGGTATTC No data
Right 914887713 1:151599069-151599091 ACTGGCAAGCTCCTCACACTGGG No data
914887707_914887717 23 Left 914887707 1:151599046-151599068 CCCCCGGTTTTGTTCTGGTATTC No data
Right 914887717 1:151599092-151599114 ATGGGTCTACTCTTTGACCCAGG No data
914887707_914887719 25 Left 914887707 1:151599046-151599068 CCCCCGGTTTTGTTCTGGTATTC No data
Right 914887719 1:151599094-151599116 GGGTCTACTCTTTGACCCAGGGG No data
914887707_914887714 4 Left 914887707 1:151599046-151599068 CCCCCGGTTTTGTTCTGGTATTC No data
Right 914887714 1:151599073-151599095 GCAAGCTCCTCACACTGGGATGG No data
914887707_914887715 5 Left 914887707 1:151599046-151599068 CCCCCGGTTTTGTTCTGGTATTC No data
Right 914887715 1:151599074-151599096 CAAGCTCCTCACACTGGGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914887707 Original CRISPR GAATACCAGAACAAAACCGG GGG (reversed) Intergenic
No off target data available for this crispr