ID: 914887709

View in Genome Browser
Species Human (GRCh38)
Location 1:151599048-151599070
Sequence GTGAATACCAGAACAAAACC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914887709_914887713 -2 Left 914887709 1:151599048-151599070 CCCGGTTTTGTTCTGGTATTCAC No data
Right 914887713 1:151599069-151599091 ACTGGCAAGCTCCTCACACTGGG No data
914887709_914887715 3 Left 914887709 1:151599048-151599070 CCCGGTTTTGTTCTGGTATTCAC No data
Right 914887715 1:151599074-151599096 CAAGCTCCTCACACTGGGATGGG No data
914887709_914887714 2 Left 914887709 1:151599048-151599070 CCCGGTTTTGTTCTGGTATTCAC No data
Right 914887714 1:151599073-151599095 GCAAGCTCCTCACACTGGGATGG No data
914887709_914887719 23 Left 914887709 1:151599048-151599070 CCCGGTTTTGTTCTGGTATTCAC No data
Right 914887719 1:151599094-151599116 GGGTCTACTCTTTGACCCAGGGG No data
914887709_914887717 21 Left 914887709 1:151599048-151599070 CCCGGTTTTGTTCTGGTATTCAC No data
Right 914887717 1:151599092-151599114 ATGGGTCTACTCTTTGACCCAGG No data
914887709_914887712 -3 Left 914887709 1:151599048-151599070 CCCGGTTTTGTTCTGGTATTCAC No data
Right 914887712 1:151599068-151599090 CACTGGCAAGCTCCTCACACTGG No data
914887709_914887718 22 Left 914887709 1:151599048-151599070 CCCGGTTTTGTTCTGGTATTCAC No data
Right 914887718 1:151599093-151599115 TGGGTCTACTCTTTGACCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914887709 Original CRISPR GTGAATACCAGAACAAAACC GGG (reversed) Intergenic
No off target data available for this crispr