ID: 914887710

View in Genome Browser
Species Human (GRCh38)
Location 1:151599049-151599071
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914887710_914887715 2 Left 914887710 1:151599049-151599071 CCGGTTTTGTTCTGGTATTCACT No data
Right 914887715 1:151599074-151599096 CAAGCTCCTCACACTGGGATGGG No data
914887710_914887719 22 Left 914887710 1:151599049-151599071 CCGGTTTTGTTCTGGTATTCACT No data
Right 914887719 1:151599094-151599116 GGGTCTACTCTTTGACCCAGGGG No data
914887710_914887714 1 Left 914887710 1:151599049-151599071 CCGGTTTTGTTCTGGTATTCACT No data
Right 914887714 1:151599073-151599095 GCAAGCTCCTCACACTGGGATGG No data
914887710_914887717 20 Left 914887710 1:151599049-151599071 CCGGTTTTGTTCTGGTATTCACT No data
Right 914887717 1:151599092-151599114 ATGGGTCTACTCTTTGACCCAGG No data
914887710_914887718 21 Left 914887710 1:151599049-151599071 CCGGTTTTGTTCTGGTATTCACT No data
Right 914887718 1:151599093-151599115 TGGGTCTACTCTTTGACCCAGGG No data
914887710_914887713 -3 Left 914887710 1:151599049-151599071 CCGGTTTTGTTCTGGTATTCACT No data
Right 914887713 1:151599069-151599091 ACTGGCAAGCTCCTCACACTGGG No data
914887710_914887712 -4 Left 914887710 1:151599049-151599071 CCGGTTTTGTTCTGGTATTCACT No data
Right 914887712 1:151599068-151599090 CACTGGCAAGCTCCTCACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914887710 Original CRISPR AGTGAATACCAGAACAAAAC CGG (reversed) Intergenic
No off target data available for this crispr