ID: 914887712

View in Genome Browser
Species Human (GRCh38)
Location 1:151599068-151599090
Sequence CACTGGCAAGCTCCTCACAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914887710_914887712 -4 Left 914887710 1:151599049-151599071 CCGGTTTTGTTCTGGTATTCACT No data
Right 914887712 1:151599068-151599090 CACTGGCAAGCTCCTCACACTGG No data
914887705_914887712 9 Left 914887705 1:151599036-151599058 CCTTCTTTGACCCCCGGTTTTGT No data
Right 914887712 1:151599068-151599090 CACTGGCAAGCTCCTCACACTGG No data
914887698_914887712 24 Left 914887698 1:151599021-151599043 CCCCCTCACTCCCATCCTTCTTT No data
Right 914887712 1:151599068-151599090 CACTGGCAAGCTCCTCACACTGG No data
914887701_914887712 21 Left 914887701 1:151599024-151599046 CCTCACTCCCATCCTTCTTTGAC No data
Right 914887712 1:151599068-151599090 CACTGGCAAGCTCCTCACACTGG No data
914887696_914887712 30 Left 914887696 1:151599015-151599037 CCCTGTCCCCCTCACTCCCATCC No data
Right 914887712 1:151599068-151599090 CACTGGCAAGCTCCTCACACTGG No data
914887707_914887712 -1 Left 914887707 1:151599046-151599068 CCCCCGGTTTTGTTCTGGTATTC No data
Right 914887712 1:151599068-151599090 CACTGGCAAGCTCCTCACACTGG No data
914887709_914887712 -3 Left 914887709 1:151599048-151599070 CCCGGTTTTGTTCTGGTATTCAC No data
Right 914887712 1:151599068-151599090 CACTGGCAAGCTCCTCACACTGG No data
914887697_914887712 29 Left 914887697 1:151599016-151599038 CCTGTCCCCCTCACTCCCATCCT No data
Right 914887712 1:151599068-151599090 CACTGGCAAGCTCCTCACACTGG No data
914887700_914887712 22 Left 914887700 1:151599023-151599045 CCCTCACTCCCATCCTTCTTTGA No data
Right 914887712 1:151599068-151599090 CACTGGCAAGCTCCTCACACTGG No data
914887699_914887712 23 Left 914887699 1:151599022-151599044 CCCCTCACTCCCATCCTTCTTTG No data
Right 914887712 1:151599068-151599090 CACTGGCAAGCTCCTCACACTGG No data
914887704_914887712 13 Left 914887704 1:151599032-151599054 CCATCCTTCTTTGACCCCCGGTT No data
Right 914887712 1:151599068-151599090 CACTGGCAAGCTCCTCACACTGG No data
914887708_914887712 -2 Left 914887708 1:151599047-151599069 CCCCGGTTTTGTTCTGGTATTCA No data
Right 914887712 1:151599068-151599090 CACTGGCAAGCTCCTCACACTGG No data
914887703_914887712 14 Left 914887703 1:151599031-151599053 CCCATCCTTCTTTGACCCCCGGT No data
Right 914887712 1:151599068-151599090 CACTGGCAAGCTCCTCACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914887712 Original CRISPR CACTGGCAAGCTCCTCACAC TGG Intergenic
No off target data available for this crispr