ID: 914887714

View in Genome Browser
Species Human (GRCh38)
Location 1:151599073-151599095
Sequence GCAAGCTCCTCACACTGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914887701_914887714 26 Left 914887701 1:151599024-151599046 CCTCACTCCCATCCTTCTTTGAC No data
Right 914887714 1:151599073-151599095 GCAAGCTCCTCACACTGGGATGG No data
914887710_914887714 1 Left 914887710 1:151599049-151599071 CCGGTTTTGTTCTGGTATTCACT No data
Right 914887714 1:151599073-151599095 GCAAGCTCCTCACACTGGGATGG No data
914887709_914887714 2 Left 914887709 1:151599048-151599070 CCCGGTTTTGTTCTGGTATTCAC No data
Right 914887714 1:151599073-151599095 GCAAGCTCCTCACACTGGGATGG No data
914887703_914887714 19 Left 914887703 1:151599031-151599053 CCCATCCTTCTTTGACCCCCGGT No data
Right 914887714 1:151599073-151599095 GCAAGCTCCTCACACTGGGATGG No data
914887705_914887714 14 Left 914887705 1:151599036-151599058 CCTTCTTTGACCCCCGGTTTTGT No data
Right 914887714 1:151599073-151599095 GCAAGCTCCTCACACTGGGATGG No data
914887707_914887714 4 Left 914887707 1:151599046-151599068 CCCCCGGTTTTGTTCTGGTATTC No data
Right 914887714 1:151599073-151599095 GCAAGCTCCTCACACTGGGATGG No data
914887708_914887714 3 Left 914887708 1:151599047-151599069 CCCCGGTTTTGTTCTGGTATTCA No data
Right 914887714 1:151599073-151599095 GCAAGCTCCTCACACTGGGATGG No data
914887700_914887714 27 Left 914887700 1:151599023-151599045 CCCTCACTCCCATCCTTCTTTGA No data
Right 914887714 1:151599073-151599095 GCAAGCTCCTCACACTGGGATGG No data
914887698_914887714 29 Left 914887698 1:151599021-151599043 CCCCCTCACTCCCATCCTTCTTT No data
Right 914887714 1:151599073-151599095 GCAAGCTCCTCACACTGGGATGG No data
914887699_914887714 28 Left 914887699 1:151599022-151599044 CCCCTCACTCCCATCCTTCTTTG No data
Right 914887714 1:151599073-151599095 GCAAGCTCCTCACACTGGGATGG No data
914887704_914887714 18 Left 914887704 1:151599032-151599054 CCATCCTTCTTTGACCCCCGGTT No data
Right 914887714 1:151599073-151599095 GCAAGCTCCTCACACTGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914887714 Original CRISPR GCAAGCTCCTCACACTGGGA TGG Intergenic
No off target data available for this crispr