ID: 914887717

View in Genome Browser
Species Human (GRCh38)
Location 1:151599092-151599114
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914887710_914887717 20 Left 914887710 1:151599049-151599071 CCGGTTTTGTTCTGGTATTCACT No data
Right 914887717 1:151599092-151599114 ATGGGTCTACTCTTTGACCCAGG No data
914887707_914887717 23 Left 914887707 1:151599046-151599068 CCCCCGGTTTTGTTCTGGTATTC No data
Right 914887717 1:151599092-151599114 ATGGGTCTACTCTTTGACCCAGG No data
914887709_914887717 21 Left 914887709 1:151599048-151599070 CCCGGTTTTGTTCTGGTATTCAC No data
Right 914887717 1:151599092-151599114 ATGGGTCTACTCTTTGACCCAGG No data
914887708_914887717 22 Left 914887708 1:151599047-151599069 CCCCGGTTTTGTTCTGGTATTCA No data
Right 914887717 1:151599092-151599114 ATGGGTCTACTCTTTGACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr