ID: 914889761

View in Genome Browser
Species Human (GRCh38)
Location 1:151612274-151612296
Sequence GGGTCTGGGCTCCACTGCGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 193}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914889743_914889761 19 Left 914889743 1:151612232-151612254 CCCTCAGCCCCTCACAGGAACGG 0: 1
1: 0
2: 1
3: 8
4: 171
Right 914889761 1:151612274-151612296 GGGTCTGGGCTCCACTGCGCCGG 0: 1
1: 0
2: 1
3: 16
4: 193
914889748_914889761 12 Left 914889748 1:151612239-151612261 CCCCTCACAGGAACGGAGGTGGC 0: 1
1: 0
2: 0
3: 10
4: 114
Right 914889761 1:151612274-151612296 GGGTCTGGGCTCCACTGCGCCGG 0: 1
1: 0
2: 1
3: 16
4: 193
914889749_914889761 11 Left 914889749 1:151612240-151612262 CCCTCACAGGAACGGAGGTGGCG 0: 1
1: 0
2: 0
3: 2
4: 83
Right 914889761 1:151612274-151612296 GGGTCTGGGCTCCACTGCGCCGG 0: 1
1: 0
2: 1
3: 16
4: 193
914889745_914889761 18 Left 914889745 1:151612233-151612255 CCTCAGCCCCTCACAGGAACGGA 0: 1
1: 1
2: 1
3: 9
4: 197
Right 914889761 1:151612274-151612296 GGGTCTGGGCTCCACTGCGCCGG 0: 1
1: 0
2: 1
3: 16
4: 193
914889750_914889761 10 Left 914889750 1:151612241-151612263 CCTCACAGGAACGGAGGTGGCGG 0: 1
1: 0
2: 1
3: 11
4: 111
Right 914889761 1:151612274-151612296 GGGTCTGGGCTCCACTGCGCCGG 0: 1
1: 0
2: 1
3: 16
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914889761 Original CRISPR GGGTCTGGGCTCCACTGCGC CGG Exonic
900483662 1:2911224-2911246 GGGTCTGGGCGCCAGGACGCTGG + Intergenic
900606321 1:3525220-3525242 GGGTCTGGGCTGCTCTGGGATGG - Intronic
902080007 1:13814319-13814341 GGGCCTTGGCTGCACAGCGCAGG + Intronic
902631658 1:17708241-17708263 GTGTCTGTCCTCCACTGCCCAGG - Intergenic
903908545 1:26704831-26704853 AGGTCTTGGCTCCATTGCCCAGG - Intronic
905257528 1:36694525-36694547 GGGTCCGGGCTCCACTTGGCTGG - Intergenic
907952668 1:59198665-59198687 GAGTCTGGGCTCCACTCCGGAGG - Intergenic
914889761 1:151612274-151612296 GGGTCTGGGCTCCACTGCGCCGG + Exonic
918078548 1:181188899-181188921 GGGCCTGGGTTCCACTGCTGTGG + Intergenic
919598979 1:199599665-199599687 GGGGTTGGGATCCACTGAGCTGG - Intergenic
923038496 1:230302044-230302066 AGGGCTGGGCTCCAGTGGGCAGG + Intergenic
923628183 1:235631279-235631301 GGTTCAGGGCTCCACTGAGGGGG - Intronic
1063651151 10:7938292-7938314 GGACATGGGCCCCACTGCGCAGG + Intronic
1063848762 10:10161226-10161248 GGGACTAGGCGCCACTGAGCAGG - Intergenic
1067170677 10:43903685-43903707 GGGTCTGGGCAGGACTGCACAGG + Intergenic
1069616570 10:69810415-69810437 GGGTCTGGGTTTCACTGTACAGG - Intronic
1069696001 10:70385929-70385951 GGGTCTGACCCCCACTGGGCAGG + Intergenic
1071567417 10:86678829-86678851 GGGTCTGGGCTCCTTTGCCTGGG + Intronic
1073056658 10:100707491-100707513 GGGGCTGGGCTGCACTGAGGTGG - Intergenic
1074865862 10:117543973-117543995 GGCTCTGGGCTCCGCGGCGCCGG - Intronic
1075040783 10:119104887-119104909 GGCTCTGGGATACACTGCGAGGG - Intronic
1075623436 10:123944768-123944790 GAGTGTGGGCTCCACAGGGCGGG + Intergenic
1075657487 10:124171823-124171845 GGCTCTGGGCTCCAGTGTCCAGG - Intergenic
1075870450 10:125769355-125769377 GGGGCTGGACTTCACTGAGCAGG - Intronic
1076293969 10:129369710-129369732 GGCTCTGGGCCCCTCTGCCCAGG + Intergenic
1077515988 11:3002500-3002522 GGGTGAGGGCTCTACTGGGCAGG - Intronic
1078193178 11:9110390-9110412 GGGTCTTGCCTCCACTGGGTGGG - Intronic
1078823899 11:14907863-14907885 GGGTCTGGGCTGCTCTCCACGGG - Intronic
1079080957 11:17413408-17413430 GGGTCTGGTCTCCATGGGGCAGG + Exonic
1079308780 11:19346496-19346518 GGGTGTGCGCTCCGCTGAGCCGG + Intergenic
1081836641 11:46160795-46160817 TGGTCAGGGCTCCTCTGCGGAGG + Intergenic
1083328982 11:61888370-61888392 GGGCCTGGGCTCAACTACACAGG + Intronic
1083366679 11:62145560-62145582 AGTTCTGGGCTCCACTCTGCAGG + Intronic
1083742899 11:64720523-64720545 GGGGCTGGACTCCACTGGGAAGG + Intronic
1083886052 11:65574047-65574069 GGCTCTGGGTTCCTCTGCCCTGG + Exonic
1085048642 11:73368072-73368094 GGGTCTGGACCCCACGGGGCTGG + Exonic
1087063897 11:94009807-94009829 CTGTCTGGGCTCCTCTGGGCAGG + Intergenic
1087910771 11:103751044-103751066 GAGTCTGGGCACCAGTGAGCAGG + Intergenic
1088820011 11:113448811-113448833 GGGCCTGGTCTCCTCTTCGCAGG - Intronic
1089642117 11:119854552-119854574 GGGTCTTGGGCCCACTGCCCTGG - Intergenic
1090669712 11:128937728-128937750 GGTTCTGGTCTCCCCTGCCCAGG + Exonic
1091284288 11:134399451-134399473 GGGCCTGGCCCCCACTGAGCAGG - Intronic
1091583225 12:1801051-1801073 GGGGCTGGGCTGCACTGTGGTGG + Exonic
1091603294 12:1930609-1930631 GGGTCTGTGCTCCACTCTGAGGG - Intergenic
1091613970 12:2035117-2035139 GGGCGTGGCCTCCCCTGCGCCGG + Intronic
1091616473 12:2053980-2054002 GCCTCTGGGCTCCGCGGCGCCGG - Intronic
1091794180 12:3287943-3287965 GGGTCTGGGCTCCTCTGTCTAGG + Intergenic
1092732509 12:11547581-11547603 GGGACTGGGCTCCGCGGAGCAGG - Intergenic
1093714485 12:22366136-22366158 GGGCATGGGATCCACTGTGCTGG - Intronic
1097819821 12:64117102-64117124 GGGTGTTGGCTCCAATGGGCAGG + Intronic
1104811213 12:131621320-131621342 GGGTCAGGGCTCCCCTGGACAGG + Intergenic
1105070790 12:133233222-133233244 GGATCTGGGAGCCACTGCTCAGG + Intronic
1105707395 13:22976829-22976851 GGGTGTGGGCACCCCTGAGCAGG - Intergenic
1110568560 13:76980178-76980200 AGGTCTGGGCTGCACGGCCCTGG - Intergenic
1114559770 14:23581079-23581101 GGGACAGGGCTCCGCTGAGCAGG - Intergenic
1115649198 14:35390871-35390893 GGGTCAGGGCTGCGCTGAGCAGG + Intergenic
1118666835 14:68078962-68078984 GGGTCTTGGCTCTATTGCCCAGG - Intronic
1119675330 14:76549260-76549282 GGTTCAGGGCTCCACTGAGGGGG + Intergenic
1122774428 14:104110903-104110925 GGGTCTGGGCCCACCTGCCCTGG - Intronic
1123112870 14:105881260-105881282 GGGTCCGGGCCCCTCTGGGCAGG + Intergenic
1202899797 14_GL000194v1_random:28404-28426 GGGTGGGGGCCCCACAGCGCCGG - Intergenic
1123942251 15:25222234-25222256 GGGTCTGAGCTTCAGTGCACTGG - Intergenic
1124376604 15:29132809-29132831 GGGTCTGGGCTCCACGGACAGGG + Intronic
1124632391 15:31345100-31345122 GGGTCTGGGTTCCATAGGGCTGG + Intronic
1124708049 15:31981863-31981885 GGCTCTGGGCTCTACAGCACTGG + Intergenic
1124890371 15:33726577-33726599 GGGCCTGGGGGCCACTGTGCTGG - Intronic
1127255869 15:57292273-57292295 GGGTCAGTGTTCCACTACGCTGG + Intronic
1129603038 15:77011367-77011389 TGGGCTGGGCTCCACTGTGCTGG - Intronic
1129691434 15:77715870-77715892 GGGGCTGGGCTCCTCTCCACTGG + Intronic
1129970140 15:79771032-79771054 GGGTATGGGATCCACTTCACAGG + Intergenic
1130275176 15:82472662-82472684 GGGTGTGGCCGGCACTGCGCTGG + Intergenic
1130339143 15:82984535-82984557 GGGGCTGGGCTCCACGGCTCAGG + Intronic
1130467535 15:84200057-84200079 GGGTGTGGCCGGCACTGCGCTGG + Intergenic
1130496730 15:84473485-84473507 GGGTGTGGCCGGCACTGCGCTGG - Intergenic
1130589827 15:85204655-85204677 GGGTGTGGCCGGCACTGCGCTGG + Intergenic
1131092550 15:89633374-89633396 GGGTCTGGGGGACACTTCGCAGG - Intronic
1136288061 16:29255514-29255536 GGATGAGGGCCCCACTGCGCAGG + Intergenic
1137932804 16:52604619-52604641 GGGGCTGGTGTCCACTGTGCAGG + Intergenic
1138190103 16:55007724-55007746 GGGTCTGTGCACCACAGTGCTGG - Intergenic
1142093728 16:88228281-88228303 GGATGAGGGCCCCACTGCGCAGG + Intergenic
1142126358 16:88412527-88412549 GGGTCTGGGCTGCTGTGCCCAGG - Intergenic
1142131745 16:88434394-88434416 GGGGCGGGGCTCCCCTGCTCTGG - Exonic
1143172351 17:4937666-4937688 GGGCCTGGGCTCTGCTGCCCTGG - Exonic
1143627383 17:8118290-8118312 GAGCCTGGGTTCCACTGCGGAGG + Exonic
1143652000 17:8269002-8269024 GGGGCTTGGCTCCACTGCACTGG + Exonic
1148469616 17:47885050-47885072 GGGTCTGGGCTTCTCCGTGCAGG - Intergenic
1151700456 17:75740080-75740102 GGGGCTGGGCGCCACAGCTCTGG + Intronic
1152912582 17:83013577-83013599 GGGTCTGGCCCACACGGCGCTGG - Intronic
1159917228 18:74198310-74198332 GGGGCCTGGCTCCACTGCTCAGG + Intergenic
1160452265 18:78973854-78973876 GGCTCCGGGCTCCACTCCGACGG - Intergenic
1160686865 19:440969-440991 GGGACGTGGCTCCACTGCGGGGG - Intronic
1160716264 19:578188-578210 GCGTCTGGGTTCTACTGAGCAGG - Intronic
1161010999 19:1959423-1959445 GGGTCTGTGCTACCCTGCGCAGG - Intronic
1161319011 19:3632518-3632540 GCGTCAGGGCCCCACTGCGGCGG + Exonic
1161529969 19:4782551-4782573 GGGGCAGGGCTCCACTGGGAAGG + Intergenic
1162100577 19:8336137-8336159 GGGCCAGGGCTCCACTCCACAGG - Intronic
1162662441 19:12181104-12181126 GGCTCCTGGCTCCACTGCCCTGG + Intronic
1163117319 19:15196259-15196281 GGCGCGGAGCTCCACTGCGCAGG + Intronic
1166046704 19:40234394-40234416 GGGTCTGGGGGCCACTGGGAGGG - Intronic
1167505074 19:49867087-49867109 GGGTCAGGGGTCCCCTGCCCAGG + Exonic
927504474 2:23604020-23604042 GGGTCTGGTCTTCAGTGCTCAGG + Intronic
927518362 2:23685118-23685140 TGGTCTATGCTCCACAGCGCCGG - Intronic
927697910 2:25250656-25250678 TGGTGTGGGCTCCTCTGCGAGGG - Intronic
929558893 2:42943309-42943331 GGATCTAGGCTCCACGGGGCAGG - Intergenic
931385724 2:61795876-61795898 GGGACTGGGCTACGCTGGGCTGG - Intergenic
931666010 2:64609811-64609833 GGGTCTGGGCTCCAGAGCGGAGG - Intergenic
934105541 2:88691736-88691758 GGGTCTTGGCCCCGCTGCCCGGG + Exonic
934993316 2:98936323-98936345 AGGTCTCGGCCCCACTCCGCCGG - Intergenic
935123053 2:100198793-100198815 GGGGCTGGGCCCCAGTGAGCGGG + Intergenic
935299302 2:101679954-101679976 GGGTCTGGGCTTCTCTGCATAGG + Intergenic
935574351 2:104693459-104693481 GGCTTTGGGGTCCACTGCTCCGG - Intergenic
935922602 2:108031875-108031897 GGGACTGGGCGCCACTGGGGAGG - Intergenic
937092216 2:119213961-119213983 GGGCCTGGGCCCCACTGCTGGGG + Intergenic
938909955 2:135876634-135876656 GGGCCACGGCTACACTGCGCAGG - Intergenic
940825082 2:158401877-158401899 AGGTCTGGGCTGCTCTGCTCTGG - Intronic
945869197 2:215208208-215208230 GGGACTGGGCTCCACGGAGCAGG - Intergenic
946921633 2:224585843-224585865 TGGGCTGGGCCCCACTGGGCTGG + Intergenic
947635588 2:231679309-231679331 GGCTCAGGGCTCCACAGCGATGG + Intergenic
947742948 2:232493138-232493160 GGCTCTGGGCACCCCTGCTCTGG - Intergenic
948652586 2:239457720-239457742 GGGTCTGGGCACCACACCGAGGG - Intergenic
1171329536 20:24325553-24325575 GGGCCTGGGGTCCACAGAGCAGG - Intergenic
1173128414 20:40362636-40362658 GTGTCTGGGGTACACTGCGAAGG - Intergenic
1173750150 20:45470001-45470023 GGGTGTGGGGTCCAATGTGCTGG + Intronic
1173880227 20:46406390-46406412 GGGCCTGGGCTGGACCGCGCCGG - Intronic
1175793925 20:61759465-61759487 GGGTCTGGGCGCCAGGGCTCTGG + Intronic
1176038721 20:63053125-63053147 GGCTCTGGGCTCATCTGTGCCGG - Intergenic
1176619171 21:9043178-9043200 GGGTGGGGGCCCCACAGCGCCGG - Intergenic
1178975951 21:37221198-37221220 GGGTCTGGGCTCCACAGCCGGGG - Intergenic
1179880712 21:44292355-44292377 GGGCCGGGGCTCCTCTGCCCGGG - Exonic
1180046132 21:45306619-45306641 GGGTCTGGGCTCCATGGAGGAGG - Intergenic
1180935544 22:19622814-19622836 GGGTCTGGGCTCCTCATCACTGG - Intergenic
1181048881 22:20229396-20229418 GGGTCTGGGTGCCACTGGGGCGG + Intergenic
1182550613 22:31098982-31099004 GGGCCTGGGATCCACTGGGTGGG + Intronic
1183013053 22:34963058-34963080 GGGTATGGGCTACAGTGCGTGGG + Intergenic
1184393287 22:44218100-44218122 GGTTCTGGCCTCCAGTGTGCAGG + Intronic
1184676283 22:46045058-46045080 GGGTCCGGGCTCGACTGCGAGGG + Intergenic
951185016 3:19702861-19702883 GGGACTGGGCGCCACGGAGCAGG - Intergenic
953421562 3:42757270-42757292 GGGTCAGGCCTCCACTGCCTAGG + Intronic
954102090 3:48381444-48381466 GGGCCTGGGTTCCAATGCCCAGG + Intronic
954207205 3:49068652-49068674 GGGTCTGTGCTCTATTGCCCAGG + Intronic
954861295 3:53693014-53693036 GGGTCTGGGCTCGGCTGCCCAGG - Intronic
960868541 3:122227239-122227261 GGGACTGGGCTCCATGGAGCAGG + Intronic
963066542 3:141268950-141268972 GGGGCTGGACTCCACTGGCCAGG + Intronic
965924426 3:173959237-173959259 GGCTGTGGGCTCCACAGAGCAGG - Intronic
966180173 3:177181020-177181042 GGGTCTGGGGTCCAGTGCCATGG - Intronic
968659265 4:1792529-1792551 GGTTCTGGGCTCCACGGGGTGGG - Intergenic
969593152 4:8133272-8133294 GGGTCAGGGCTTCACTTAGCGGG + Intronic
969969211 4:11028587-11028609 GGGTCTGGGCTTGACTAGGCAGG - Intergenic
976221924 4:82762937-82762959 GGGGCTGTGCTCCACCGCTCAGG - Intronic
977416708 4:96742853-96742875 GGGACTGGGCGCCACGGAGCAGG - Intergenic
978997991 4:115179457-115179479 GGGACTGGGCGCCACGGAGCAGG + Intergenic
983425759 4:167581890-167581912 GGGACTGGGCACCACGGAGCAGG - Intergenic
984918158 4:184741538-184741560 GGGACTGGGCGCCACAGAGCAGG - Intergenic
985660715 5:1155533-1155555 GGGGCGGGGCTCCGCTGGGCTGG + Intergenic
985761634 5:1752009-1752031 GGGTAGGGGCCCCACTGCCCTGG - Intergenic
988497368 5:31756702-31756724 TGGTCTGGGCGACACTGTGCTGG + Intronic
992038892 5:72808970-72808992 GGGGGTGGGATCCACTGAGCTGG + Intergenic
995140339 5:108728323-108728345 GGGGCTGGGCCGCCCTGCGCCGG + Intergenic
998601868 5:143592758-143592780 GGGCCAGGGCTCAACTGCGCAGG + Intergenic
999829168 5:155302821-155302843 GGGTCTTGGCTCTATTGCCCAGG - Intergenic
1001571290 5:172732300-172732322 GGGTCTGGGGTCCAGAGCTCGGG - Intergenic
1003489672 6:6610425-6610447 GAGTCTGGGCTCCACTGCCCTGG + Intronic
1004196532 6:13511061-13511083 GGGACTGGGCGCCACGGAGCAGG + Intergenic
1006790521 6:36698299-36698321 GGGTCTGCTCTCCACTTGGCTGG - Intronic
1007784048 6:44270391-44270413 GGGGCGGGGCTCGGCTGCGCTGG + Intergenic
1008760437 6:54846834-54846856 GGGTTTGGGCTCCCTTGCCCCGG + Intronic
1010269399 6:73903488-73903510 GGGACTGGGCTCCATGGAGCAGG - Intergenic
1012598908 6:101070595-101070617 GGGACTGGGCACCACGGAGCAGG - Intergenic
1013957296 6:115855534-115855556 GGGACTGGGCACCACAGAGCAGG - Intergenic
1014613146 6:123568731-123568753 GGCTCAGGGCCCCACTGCCCTGG - Intronic
1015863586 6:137705527-137705549 GGCTCTGGGCTCCACTTGTCTGG + Intergenic
1016433010 6:144007935-144007957 GGGTCCGGGCTCCGCGGGGCCGG - Intronic
1017034571 6:150255796-150255818 GGGCCTGGGCTCCAAGGCTCTGG - Intergenic
1017073758 6:150599942-150599964 GGGTGCGGGCTGCGCTGCGCCGG - Exonic
1018108701 6:160513887-160513909 GGGGGTGGGATCCACTGAGCTGG - Intergenic
1019442849 7:1056131-1056153 GGCTCTGGGCTCCACTCGCCGGG - Intronic
1019468615 7:1204930-1204952 GCGTCTGGGCTCAGCTGTGCTGG + Intergenic
1019476147 7:1245379-1245401 GGGCCTGGGCTCCCCAGCTCAGG + Intergenic
1019562052 7:1664260-1664282 AGGTCTGGGCGCCCCCGCGCAGG + Intergenic
1020002770 7:4765153-4765175 GGGTCCTGGATCCACTGCTCTGG + Exonic
1020096401 7:5371717-5371739 TGGTCTGGTCTCCACTCCCCAGG + Intronic
1025854339 7:65264737-65264759 GGGTCTGGGGTCCTCAGTGCTGG + Intergenic
1026937821 7:74269113-74269135 GGTTCAGGGATGCACTGCGCAGG + Intergenic
1028083114 7:86601223-86601245 GGGTTTGGAGTCCACTGTGCTGG - Intergenic
1028336764 7:89667686-89667708 AGGTTTGGAGTCCACTGCGCTGG - Intergenic
1030102989 7:105962546-105962568 GGGTCTAGTCTCCACTGAGAAGG - Intronic
1034522732 7:151632614-151632636 AGGTGTGGGCTCCGCGGCGCGGG + Intronic
1034995893 7:155577233-155577255 GGGTAGGTGCTCCACAGCGCTGG - Intergenic
1035571839 8:677543-677565 GCTTTTGGGGTCCACTGCGCAGG + Intronic
1038721553 8:30041275-30041297 GGGACTGGGCTCCACTGGGATGG + Intergenic
1040701838 8:50075198-50075220 GGGACTGGGCACCACAGAGCAGG - Intronic
1043640212 8:82441712-82441734 GGGACTGGGCGCCACGGAGCAGG - Intergenic
1045933785 8:107655933-107655955 GGGACTGGGCGCCACGGAGCAGG - Intergenic
1048956620 8:139542855-139542877 GGGTCTGGGTCCCACTGCCCTGG - Intergenic
1049463832 8:142742126-142742148 GGGTCACGGCTCCACTCTGCAGG - Intronic
1049774575 8:144398472-144398494 GGGGCTGGGGTCCCCTGCGGGGG - Intronic
1051419673 9:16877115-16877137 GGGACTGGGCTCCATGGAGCTGG + Intergenic
1053240119 9:36487967-36487989 GCGCTTGGGCTCCGCTGCGCAGG + Intergenic
1055100287 9:72457008-72457030 GAGACTGGGTTTCACTGCGCTGG - Intergenic
1057885279 9:98824923-98824945 GGTTCTGGGCCACACTGCACGGG + Intronic
1061716476 9:132521468-132521490 GGCTCTGAGCTCCACGGAGCAGG - Intronic
1062378144 9:136274204-136274226 GGGTCTCAGCTCCTCTGAGCTGG - Intergenic
1203786687 EBV:132227-132249 GTGGCTGGGCTCCCCTGGGCAGG + Intergenic
1188743725 X:33816876-33816898 AGGTTTGGAGTCCACTGCGCTGG + Intergenic
1190594642 X:52040997-52041019 GGGTCTGGGATCCCCTGAGAGGG + Intergenic
1192440676 X:71171313-71171335 GAGTCTGGGCTGCACTGTGCGGG + Intergenic
1193228439 X:79013371-79013393 GGGGGTGGGATCCACTGAGCTGG + Intergenic
1194663964 X:96656469-96656491 AGGTTTGGAGTCCACTGCGCTGG - Intergenic
1196602964 X:117623029-117623051 GGGGTTGGGATCCACTGAGCAGG + Intergenic
1196791401 X:119468344-119468366 GGGTCTGGGCCCCGGCGCGCTGG - Intergenic
1199793833 X:151177464-151177486 GGGTCTGTGCTCCGCCGCCCGGG - Intronic