ID: 914893633

View in Genome Browser
Species Human (GRCh38)
Location 1:151650628-151650650
Sequence AATTCTTGGGTGTTTCTCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 1, 2: 10, 3: 20, 4: 149}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914893633 Original CRISPR AATTCTTGGGTGTTTCTCAC AGG Intronic
900975973 1:6016532-6016554 AATTTTTAAGTGTTTCACACAGG - Intronic
906479360 1:46190030-46190052 ACTTCATGGGTGTGTCCCACAGG + Intronic
907840895 1:58156516-58156538 AACTCTTCTGTCTTTCTCACTGG - Intronic
909417281 1:75421051-75421073 AATAGTTGTGTCTTTCTCACAGG + Intronic
910602352 1:89045277-89045299 TCTTCTTGGTGGTTTCTCACAGG + Intergenic
911454176 1:98102570-98102592 AAATATTGGGTCCTTCTCACTGG + Intergenic
911497900 1:98653182-98653204 AATAATTGGGTGTTAATCACAGG + Intergenic
912828252 1:112925984-112926006 TATTCTTGTCTGTTTCTCAGAGG + Intronic
914394767 1:147254807-147254829 ACTTCATGGTTGTTTCTCATGGG + Intronic
914893633 1:151650628-151650650 AATTCTTGGGTGTTTCTCACAGG + Intronic
917882587 1:179352693-179352715 ATTTCCTGGGTATTTCTCATAGG + Intronic
918655555 1:187021669-187021691 AGTCCTTGGGTTTTTCTCATTGG - Intergenic
918726265 1:187928432-187928454 AATTCTTCTGTGTTTCTCAGAGG + Intergenic
918796548 1:188905511-188905533 TATTCTTGGGTGTGTCTGAGAGG + Intergenic
920249288 1:204612392-204612414 AACTCTTGTGTGTTCTTCACAGG - Intergenic
920724295 1:208419419-208419441 ACTTCTTGGGTGTTTTCCATGGG - Intergenic
922437042 1:225616295-225616317 CATTCTTGGGTGTTTCTCGGAGG - Intronic
1064552222 10:16514707-16514729 AATTCTTGTCTGTTTCACATAGG - Exonic
1064741974 10:18443258-18443280 GACACTAGGGTGTTTCTCACTGG - Intronic
1066546689 10:36507794-36507816 AATTCTTTGGAGTTTCTGTCTGG + Intergenic
1066782090 10:38962225-38962247 AATTCATGGGTATTTCTGAAGGG - Intergenic
1067117292 10:43445706-43445728 CATTCTTGGGTGTTTCTCCGAGG + Intronic
1070012124 10:72485970-72485992 ATTTATTGGGTTTTTCTCCCTGG - Intronic
1071537168 10:86443283-86443305 ACTTCTTGGGTGTCTCTGCCAGG - Exonic
1072317029 10:94213197-94213219 AATTCTAGGGTGTTCAGCACAGG - Intronic
1076432231 10:130412451-130412473 GATTCTTGGGTGTTTCCCACAGG + Intergenic
1079782128 11:24620701-24620723 TACTTATGGGTGTTTCTCACAGG - Intronic
1085869948 11:80337811-80337833 TATTTTTGGGTGTATATCACAGG - Intergenic
1088829717 11:113524768-113524790 CATTCTTGGGTGTTTCTCAGAGG - Intergenic
1089180852 11:116581852-116581874 CATTCATGGTTGTTTTTCACTGG - Intergenic
1090730706 11:129571296-129571318 AGTTCTTCAGTGTTTCCCACAGG - Intergenic
1092978571 12:13770272-13770294 AATCATTGGGTGTTTCACACTGG + Intronic
1095881595 12:47142459-47142481 AATTCTTGGGGGTTGGTTACTGG - Intronic
1097762431 12:63482991-63483013 ATCTCATGGGTGTTTCTCACAGG - Intergenic
1098188035 12:67919353-67919375 AATTCTTGGGTGATGCTACCAGG + Intergenic
1098375068 12:69806606-69806628 CATTCTTGGGTGTTTCTTGGAGG + Intronic
1101058018 12:100939713-100939735 CATTCTTGAGTGTCTCCCACTGG + Intronic
1101872942 12:108580745-108580767 AATTCAAGAGTGTTTCTAACTGG + Intergenic
1104304583 12:127597947-127597969 AATTCATAGGTGCTTCTCTCAGG - Intergenic
1107766171 13:43737145-43737167 AATTCTGGGGTGTTTTTTAGAGG - Intronic
1108497022 13:51035334-51035356 AATAAGAGGGTGTTTCTCACAGG - Intergenic
1109071691 13:57777606-57777628 AACTCTTGAGCATTTCTCACAGG + Intergenic
1109633241 13:65080592-65080614 AATCCTGGATTGTTTCTCACTGG - Intergenic
1110922317 13:81102957-81102979 CATTCTTGGGTGTTTCTCGCAGG - Intergenic
1113174551 13:107547466-107547488 AATTATTGAATGTTTCTCATTGG + Intronic
1114859517 14:26497604-26497626 AGTCCTTGGGTGTTTCTAAAAGG - Intronic
1116939920 14:50781153-50781175 AGTTCTGGGGTGTTTCCAACTGG - Intronic
1119150054 14:72350571-72350593 AATTCTGGAGAGTTTCTCACTGG - Intronic
1119659491 14:76440022-76440044 AAACCCTGGGTGCTTCTCACTGG + Intronic
1124112615 15:26806167-26806189 ATCTCTTTGGTTTTTCTCACTGG + Intronic
1125740849 15:41963261-41963283 CATTCTTGGGTGTTTCTCCGAGG - Intronic
1130148739 15:81294850-81294872 CATTCCTGGGGATTTCTCACTGG + Intronic
1130210360 15:81916679-81916701 TATTCCTGGGTGTGTCTCAAGGG - Intergenic
1132617664 16:850122-850144 ATTTCTTGGGTCATTCTCATCGG + Intergenic
1139141699 16:64271396-64271418 TATTTTTGAGTGTTTCTTACAGG - Intergenic
1140171901 16:72613814-72613836 AACTCTTGGTTGTATCTCAGTGG - Intergenic
1141838085 16:86555706-86555728 AATCCACGGGTGTTTCTCAAAGG - Intergenic
1144528668 17:16014149-16014171 ACTTCTTTGATGTTTCTCATAGG + Intronic
1145281707 17:21472751-21472773 AATTATTGTGTGTTTCTCCTTGG + Intergenic
1147500119 17:40955044-40955066 ACTCCTTGGATGATTCTCACTGG + Intergenic
1149668118 17:58380633-58380655 ATTTCTTTGGTGTTTTTCACAGG - Intronic
1150486119 17:65545073-65545095 GATTTTTTGGTGTTTCACACAGG - Intronic
1203190715 17_KI270729v1_random:185003-185025 AATTCATGGGTATTTCTGAAGGG - Intergenic
1155107468 18:22681832-22681854 AATTCTTGGGTCCTACTGACTGG - Intergenic
1155794349 18:30016129-30016151 AATTTTTGAGTATTTTTCACAGG - Intergenic
1157973561 18:52299383-52299405 AATGCTGGGGTGGTTGTCACTGG - Intergenic
1158235395 18:55307227-55307249 AAAACTTGGGTGTTTATGACTGG + Intronic
1158342405 18:56480764-56480786 AACTGTGTGGTGTTTCTCACTGG + Intergenic
1162603929 19:11692825-11692847 AATTAGTGCCTGTTTCTCACTGG + Intergenic
1167751605 19:51383961-51383983 AATTCCTGGCTGTTTCTCCATGG + Intronic
925650591 2:6085439-6085461 GATTCTGGTGTTTTTCTCACAGG - Intergenic
925859175 2:8158461-8158483 AATTCTTGGATTTTTATCGCAGG + Intergenic
928991277 2:37234970-37234992 AATTCTTGAGTGTTTCTTGAAGG + Intronic
932218113 2:69979681-69979703 GATTCTTGGGTGACCCTCACTGG + Intergenic
933821429 2:86115714-86115736 AATTCTGGGGCATTTCTCAGTGG + Intronic
936063779 2:109315265-109315287 AATTGCTGGGTGTTTCCCAGTGG - Intronic
936153539 2:110034201-110034223 AATTCCTGAGTGTTTCCCAGAGG - Intergenic
936191142 2:110337214-110337236 AATTCCTGAGTGTTTCCCAGAGG + Intergenic
936344819 2:111667382-111667404 AATTCTTTTCTATTTCTCACTGG + Intergenic
936683308 2:114799747-114799769 ACTTCTTAGGTATTTCTCAGGGG - Intronic
943125545 2:183791250-183791272 CATTCTTGGGTGTTTCTTGGAGG + Intergenic
945826788 2:214730506-214730528 AATTCTTGTGTTTTTGTCAGGGG - Exonic
945840784 2:214885589-214885611 TAGTCTGTGGTGTTTCTCACTGG - Intergenic
946108571 2:217393726-217393748 AATTCTTGGCTCTTTCCCATGGG - Intronic
1169402867 20:5298021-5298043 GATTCTGGGGTGATTCTCTCTGG + Intergenic
1171463788 20:25313549-25313571 CATTCTTGGGTGTTCCTCTGAGG - Intronic
1172717421 20:36975773-36975795 CATTCTTGGGTGTTTCTCGCAGG + Intergenic
1174218447 20:48935119-48935141 CATTCTTGGGTGTTTCTCGCAGG + Intronic
1175051808 20:56162412-56162434 AATTAGTGGGGGTTTCTTACTGG - Intergenic
1175646749 20:60680697-60680719 ATTTCTTGAGTGTCTCTCAGAGG - Intergenic
1178605269 21:34030806-34030828 TATTCTTGATTGTTTCTTACAGG - Intergenic
1180112401 21:45667317-45667339 TATTCTTGGTGGTTTCCCACAGG + Intronic
1182345567 22:29661556-29661578 TATTCTTTGGGGTTTCTCCCTGG - Intronic
1182991669 22:34773837-34773859 CATTCCTGGGTGTATATCACAGG - Intergenic
1184980477 22:48091902-48091924 AAATGTTGGGTGTTTCACATCGG + Intergenic
950917709 3:16662900-16662922 AATTTTTGGCTGATTCTAACTGG + Intronic
951610697 3:24489949-24489971 GATTCTTGAGTGAATCTCACTGG + Intronic
952626716 3:35414602-35414624 ATATCTTTGGTGTTTCACACTGG + Intergenic
953082121 3:39630573-39630595 TACTCATGGGTGATTCTCACTGG + Intergenic
953955541 3:47228968-47228990 CATTCTTGGGAGTTTCTGATAGG + Intronic
955783822 3:62514935-62514957 AATTCTTAAGTGTTTCTCCCTGG + Intronic
956086356 3:65615307-65615329 AATCTTTGGGTGGGTCTCACGGG - Intronic
956187870 3:66579664-66579686 AATGCTGGGGTGTTCTTCACAGG - Intergenic
958899398 3:99868207-99868229 AGTTCTTGTGGGTTTCTCACAGG + Intronic
959803848 3:110527682-110527704 AATTCTTGCAAGGTTCTCACAGG + Intergenic
960364500 3:116754354-116754376 ACTTCTTGGTTGGTTCTCACTGG + Intronic
961709439 3:128816253-128816275 CATTCTTGGGTGTTTCTCAGAGG + Intergenic
964435443 3:156646813-156646835 AAATATTTGGTGTTTCTCCCTGG + Intergenic
965137070 3:164785262-164785284 CATTCTTGGGTGTTTCTCAGAGG - Intergenic
969171646 4:5368746-5368768 ATTTCTGGGGTGTTTTTCAGAGG - Intronic
969874714 4:10127542-10127564 CATTTTTGGGTGTTTCTCAGGGG + Intergenic
971739270 4:30499819-30499841 TACTCTTGGGTGCTTCTCATTGG - Intergenic
972764511 4:42140027-42140049 GATTCTTGGGTGTCACTCACAGG + Intronic
976294781 4:83459207-83459229 AATTCTTGGTTCTTCCTCAAAGG - Intronic
976485592 4:85599637-85599659 AATTCATGTGTATTTCTCAGGGG - Intronic
976841373 4:89436509-89436531 AAGTGTGGGGTTTTTCTCACAGG - Intergenic
976903840 4:90211435-90211457 GATTCTTGAGTGTTGCTCACAGG + Intronic
978623919 4:110663188-110663210 ATTTCTTGTTTCTTTCTCACTGG + Intergenic
979278300 4:118836847-118836869 ATTTCTGAGCTGTTTCTCACAGG - Intronic
980634578 4:135483790-135483812 ATTTCTTGGTAGTTTCTCAAAGG + Intergenic
981733588 4:147925581-147925603 AATTTTGGGGTATTTCTTACAGG + Intronic
982897547 4:160951949-160951971 AATTTTTGGGTATTTCCCTCAGG - Intergenic
983480182 4:168263913-168263935 GATTCTTTGGGATTTCTCACTGG + Intronic
995742886 5:115373645-115373667 TTTTCTTGGGTGTTTTTCAGAGG + Intergenic
998923224 5:147094265-147094287 TATTCTTGGGTGTTTGCCAGAGG - Intergenic
1003793410 6:9573325-9573347 AAAAATTGGGTGTTTCTCATTGG + Intergenic
1004336115 6:14765766-14765788 GATTCTTGGGACTTTGTCACAGG - Intergenic
1004637548 6:17483587-17483609 AGTACTTGGTTCTTTCTCACAGG - Intronic
1007365569 6:41389490-41389512 TATTCTTGGGTATTTCTCATTGG - Intergenic
1007544856 6:42686105-42686127 CATTCTTGGGTGTTTCTCGGAGG + Intronic
1008824754 6:55680517-55680539 AAATATTGTGTGTATCTCACAGG + Intergenic
1010881146 6:81173949-81173971 CATTCCTGGGTGTTCATCACAGG - Intergenic
1011451863 6:87501480-87501502 ACTTATTGGTTGTTTCTCAGAGG + Intronic
1015878174 6:137845146-137845168 CATTCATGGGTGTTTCTCCGAGG - Intergenic
1019687484 7:2389587-2389609 CATTTTTGGGTGTTTCTCAGAGG + Intergenic
1020617827 7:10481861-10481883 AATTCTTTAATGTATCTCACAGG + Intergenic
1021682114 7:23144115-23144137 AAATCTTGAATGTTTCTCCCTGG - Intronic
1023412925 7:39905286-39905308 AGTTCTTGGGTGTTCTGCACTGG - Intergenic
1023579482 7:41666049-41666071 TGTTCTTGGGTTTTTCTCAAGGG + Intergenic
1024121063 7:46240964-46240986 TATTCTTGGGTATTTATCCCAGG + Intergenic
1024168632 7:46761098-46761120 ATTTCTTGGTTGCTTCTCACTGG + Intergenic
1026783070 7:73283316-73283338 AATTCTTGGGTGTTTCTCAGAGG + Intergenic
1028462039 7:91104871-91104893 AATTTTTAGGTCTTTCTCCCTGG - Intronic
1030099055 7:105928987-105929009 ATTTCTTCTGTGTTGCTCACAGG - Intronic
1031605070 7:123759246-123759268 AATTCATGTGTATTTCTCCCAGG + Intergenic
1032678412 7:134155482-134155504 AATTCTTGGGTTTTCCTCAATGG - Intronic
1037299387 8:17435089-17435111 CACCCTTGGGGGTTTCTCACTGG + Intergenic
1038355596 8:26826249-26826271 GATAGTTGGGTGTTTCTGACTGG + Intronic
1039530700 8:38259196-38259218 AATTCTTGGTTATTTCTTACTGG + Intronic
1039697043 8:39924132-39924154 AATACTTGATTGTTTCTCTCTGG + Intronic
1039738387 8:40356765-40356787 AATGCTTGGCTGCATCTCACTGG - Intergenic
1041005184 8:53491302-53491324 AATTGATGGGTATTTCTCTCTGG - Intergenic
1041527727 8:58826306-58826328 AACTCTTGGGTATTTATAACAGG + Intronic
1044918629 8:97144367-97144389 AATTCTTGGATGATTCACTCTGG - Intronic
1045825066 8:106387486-106387508 GATTGTTGGGTGTTTCTCTGAGG + Intronic
1046196787 8:110874517-110874539 AATTCTTGACTCTTTCACACTGG + Intergenic
1046734409 8:117761679-117761701 AACTCTTGGGTGTCACCCACAGG - Intergenic
1046839183 8:118838550-118838572 AATTCCTGGGTTTTTCAAACAGG - Intergenic
1048448006 8:134506917-134506939 AATTCTTGCTTTTTTCTCTCCGG + Intronic
1049960681 9:735175-735197 AATTCTTGGATGCTGCTCCCTGG - Intronic
1050291494 9:4159944-4159966 CATTCTTGGTTGTCTCTTACTGG - Intronic
1051049884 9:12919150-12919172 TATTCTTCGTAGTTTCTCACCGG - Intergenic
1051090935 9:13407379-13407401 AATTCTTGGGTGTTCCAGAAAGG + Intergenic
1052938722 9:34115027-34115049 AATTCAAGGGTGTTTCAGACTGG + Intronic
1053150563 9:35740362-35740384 AATTCTCTTGTGTTTCTCTCAGG - Exonic
1053199449 9:36142729-36142751 TATTCTTGGGTTTTTCTCGGTGG + Intronic
1054707140 9:68474069-68474091 ACTCCTTGGGTGATTTTCACAGG - Intronic
1055621297 9:78127543-78127565 AAATAGAGGGTGTTTCTCACTGG + Intergenic
1056228931 9:84525787-84525809 CATTCTTGGGTGTTTCTCAGAGG + Intergenic
1056336537 9:85574438-85574460 CATTCTTGGGTGTTTCTCGCAGG - Intronic
1056569990 9:87806537-87806559 TATTTCTCGGTGTTTCTCACTGG - Intergenic
1061292903 9:129662279-129662301 CATTCTTGGGTGTTTCTCGCAGG - Intergenic
1062246130 9:135567239-135567261 TTTTCCTGGGTGTTTCTGACAGG - Intergenic
1188341358 X:29006136-29006158 AATTTTCTGGTGTTCCTCACTGG - Intronic
1188937988 X:36200913-36200935 AGTTCTTGGGAGTTTTTGACAGG + Intergenic
1189101381 X:38193571-38193593 AATTTTTGGGTGTTCATCAAGGG - Intronic
1191925477 X:66304956-66304978 TCCTCTTTGGTGTTTCTCACAGG + Intergenic
1191969979 X:66802777-66802799 AATTATGTGGTGTTTGTCACTGG - Intergenic
1195727283 X:107931636-107931658 AATTCTTTGTTGTCTCTCGCTGG + Intergenic
1197907110 X:131437336-131437358 AATTCTTTGTTCTTTTTCACTGG - Intergenic
1200379444 X:155819544-155819566 AAAACTTGGGTTTTTATCACTGG - Intergenic