ID: 914894348

View in Genome Browser
Species Human (GRCh38)
Location 1:151655220-151655242
Sequence CTTTAGGAATGGAGCTAAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 150}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914894348_914894354 21 Left 914894348 1:151655220-151655242 CCAATTTAGCTCCATTCCTAAAG 0: 1
1: 0
2: 2
3: 10
4: 150
Right 914894354 1:151655264-151655286 TCTAAATTCCATGCAGATTTAGG 0: 1
1: 0
2: 0
3: 54
4: 676
914894348_914894356 25 Left 914894348 1:151655220-151655242 CCAATTTAGCTCCATTCCTAAAG 0: 1
1: 0
2: 2
3: 10
4: 150
Right 914894356 1:151655268-151655290 AATTCCATGCAGATTTAGGGAGG 0: 1
1: 1
2: 1
3: 14
4: 187
914894348_914894355 22 Left 914894348 1:151655220-151655242 CCAATTTAGCTCCATTCCTAAAG 0: 1
1: 0
2: 2
3: 10
4: 150
Right 914894355 1:151655265-151655287 CTAAATTCCATGCAGATTTAGGG 0: 1
1: 0
2: 1
3: 15
4: 258

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914894348 Original CRISPR CTTTAGGAATGGAGCTAAAT TGG (reversed) Intronic
900267769 1:1767875-1767897 CTCTAAGAAAGGAGTTAAATGGG + Intronic
900924779 1:5697936-5697958 CTTTAGGAATGGAATGGAATTGG - Intergenic
904355827 1:29939120-29939142 ATTTAGAAATGGAGCTAATGTGG + Intergenic
904760819 1:32803430-32803452 CTTTAAGAATTATGCTAAATAGG - Intronic
904963858 1:34356402-34356424 CTTTAAGAATGGAGCAAAATGGG - Intergenic
908243084 1:62204354-62204376 CTTGGGGAATGTAGCTAAAGTGG - Intronic
909239736 1:73196904-73196926 ATTTAGGAATGGGACTAAATGGG - Intergenic
909939480 1:81593839-81593861 CTTTAGTAATGAATCTAAAGAGG + Intronic
910763052 1:90754062-90754084 CTCTAGGAATGGATATAGATAGG + Intergenic
914254960 1:145954409-145954431 CTGTAAGACTGGAGTTAAATGGG - Intronic
914894348 1:151655220-151655242 CTTTAGGAATGGAGCTAAATTGG - Intronic
917898822 1:179520102-179520124 CCTTAGGAATATAGCTAACTAGG - Intronic
918293058 1:183127982-183128004 GGTTAGGAATGGGGCTTAATGGG + Intronic
918762960 1:188437542-188437564 CTTTAGAAACTGAGGTAAATAGG - Intergenic
921560713 1:216654899-216654921 CTTTATAATTGGAGCTACATTGG + Intronic
1063502380 10:6566858-6566880 CTTTAGATATGGACCCAAATCGG + Intronic
1067012677 10:42729108-42729130 CTTTGGGAAAGGAGCTAAGATGG + Intergenic
1067310912 10:45112760-45112782 CTTTGGGAAAGGAGCTAAGATGG - Intergenic
1072235145 10:93447296-93447318 CTTAAGGAAGGGAGGTAAAGGGG - Intronic
1075341933 10:121653839-121653861 CTTGAGGGAGGGAGCTAAAGTGG + Intergenic
1080266192 11:30404488-30404510 CTTCAGGAATGAAGCTACTTGGG + Intronic
1081323721 11:41720689-41720711 ATTTAGGAATGGAGCTCCATGGG + Intergenic
1085253201 11:75157038-75157060 CTTTGGGAATGCAGCTCAGTAGG + Intronic
1091021229 11:132101971-132101993 CTGTAGGAATGGTGGGAAATGGG - Intronic
1092708445 12:11308934-11308956 TTACAGTAATGGAGCTAAATGGG + Intronic
1093021647 12:14209392-14209414 CTTGAGGGATGGTGCTATATTGG + Intergenic
1093327495 12:17795616-17795638 CTTTAGTAATGGAGAGAACTAGG + Intergenic
1093658378 12:21724118-21724140 CTTTAAGAATTATGCTAAATGGG + Intronic
1094070835 12:26411514-26411536 CTTTAGGAACACAGCTAAGTTGG - Intronic
1094531015 12:31274935-31274957 CTTTAGGAATGAAGTCTAATTGG - Intergenic
1100078540 12:90819976-90819998 CAATATAAATGGAGCTAAATAGG - Intergenic
1101388660 12:104280101-104280123 CAATAGGAAAGGAGCTAAAGAGG - Intronic
1102007404 12:109597334-109597356 CTTCAGCAATGGAGGGAAATAGG + Exonic
1102094158 12:110222253-110222275 ATTTAGTAATGCAGCTTAATGGG + Intergenic
1104596016 12:130120383-130120405 TTTAAGGAATGCAGCTAAACAGG + Intergenic
1105649750 13:22363035-22363057 ACCTAGGAATGCAGCTAAATAGG + Intergenic
1106929002 13:34643484-34643506 CCTAAGGAATGGAGCTGGATAGG - Intergenic
1111186123 13:84738086-84738108 GTTTAGGAATGAATCTGAATGGG + Intergenic
1111229311 13:85321500-85321522 CTTTAAAAATGGAGCTAGACAGG - Intergenic
1111598033 13:90435682-90435704 CTGTAGGTAAGGAGCTGAATTGG - Intergenic
1112149876 13:96746797-96746819 TTTTAGGAATAGACCTATATGGG + Intronic
1112214898 13:97420021-97420043 CTTGAGGAATGGAGGCAAGTTGG + Intergenic
1112310738 13:98315509-98315531 CTTTAGGAGTGGAGACAAACGGG - Intronic
1115146972 14:30237442-30237464 CTTTGGGAAAGGAGCTTGATTGG - Intergenic
1115568411 14:34645021-34645043 CTTTAAGAATTATGCTAAATCGG - Intergenic
1117034791 14:51716907-51716929 GTTTAGGAATGAAGCTGACTTGG - Intronic
1117679858 14:58192855-58192877 CAGTAGGAATGGAGTAAAATAGG + Intronic
1118362388 14:65067345-65067367 CTTTAGTAATGTATCAAAATTGG - Intronic
1119084539 14:71727793-71727815 CTTTAAGACTGGAGTTAAAGAGG + Intronic
1120428708 14:84386418-84386440 CTTTATGTATGCAGCTGAATTGG - Intergenic
1120452371 14:84684483-84684505 ATTTAGGAATACAGCTAACTAGG + Intergenic
1120610070 14:86628673-86628695 CTTTAGAAATTTAGATAAATAGG - Intergenic
1124118956 15:26872100-26872122 CTATAGGAAGGGAAATAAATAGG - Intronic
1127087532 15:55438479-55438501 CTTTAGAAATGGATTTGAATAGG + Intronic
1127559394 15:60120710-60120732 CTGAAGGCATGGAGCTGAATGGG - Intergenic
1140701286 16:77583768-77583790 CTTTAGGAATGAGTCTATATTGG - Intergenic
1144609654 17:16699027-16699049 CTTTAGGAATGGAATTCAAAAGG - Intronic
1144903116 17:18616524-18616546 CTTTAGGAATGGAATTCAAAAGG + Intergenic
1144927949 17:18829456-18829478 CTTTAGGAATGGAATTCAAAAGG - Intergenic
1145129454 17:20330226-20330248 CTTTAGGAATGGAATTCAAAAGG - Intergenic
1145918642 17:28592904-28592926 TTTTAGGAGTAGAGCTAATTTGG + Exonic
1151031839 17:70749680-70749702 CTTTAAAAATAGAACTAAATTGG + Intergenic
1152638630 17:81440375-81440397 TTTTGGAAATGGAGCTAATTAGG + Intronic
1153576130 18:6523714-6523736 CTCGAGGAAGGGAGCTACATGGG + Intronic
1153786606 18:8540750-8540772 GTTTAGGAATGAATGTAAATAGG - Intergenic
1159694024 18:71530488-71530510 ATCTAGGAATGCAGCTAACTAGG + Intergenic
1162883177 19:13675656-13675678 CTTTAAGAAAGGAGCCAAATTGG - Intergenic
926467604 2:13210691-13210713 CTTGAGGAAAGGAGTGAAATGGG - Intergenic
926494983 2:13575202-13575224 CTAAAGGAATGGAGCCATATTGG + Intergenic
931865705 2:66408739-66408761 TTATAGAAATGGAGCTAAGTTGG - Intergenic
933336145 2:80962378-80962400 AATTAGGAATAGAGCTAACTAGG - Intergenic
935518513 2:104076239-104076261 GTTTAGGAATGGAAATATATGGG - Intergenic
937323489 2:120974750-120974772 GTTGAGGAAAGGAGCTAAAAAGG + Intronic
942346552 2:175008846-175008868 CAATGGGAATGAAGCTAAATGGG - Intergenic
944894156 2:204146793-204146815 CTTTAGGAAGGAAGGGAAATTGG + Intergenic
1169861524 20:10158033-10158055 CTTAAGCAAAGGAGCTAAATCGG - Intergenic
1171820192 20:29828870-29828892 CTTAAGGAAGGGAGGTAAAGGGG + Intergenic
1174763076 20:53225735-53225757 CTTTTGGAATTGAGATAACTGGG - Intronic
1179262135 21:39766981-39767003 TTTTAGAAATTTAGCTAAATTGG + Intronic
1180324190 22:11353565-11353587 CTTAAGGAAGGGAGGTAAAGGGG + Intergenic
1183281767 22:36936113-36936135 CTTCAGGAAGGGAGCTGAAGGGG + Intronic
1185007662 22:48291927-48291949 TGATAGGAATGGAGGTAAATTGG - Intergenic
949357031 3:3191971-3191993 CTTCAGAAATGGAACTATATAGG + Intergenic
950769290 3:15298382-15298404 CTTTAGGAAAGGAGATGAGTGGG - Intronic
952014757 3:28943101-28943123 CTTTAGGAATGAAAAAAAATTGG + Intergenic
955311231 3:57888804-57888826 TTTTAGGAATGGAGTGAAGTAGG + Intronic
955924322 3:63990646-63990668 CTTCAGGAAAGGAGCTAATCAGG - Intronic
956308066 3:67848504-67848526 CTGTAGGAGTGGAGCCAATTTGG - Intergenic
957891775 3:86368265-86368287 CTTTAAAAATATAGCTAAATAGG - Intergenic
957958223 3:87217156-87217178 TTTTAGGACTGAAGCAAAATTGG - Intergenic
960981828 3:123236037-123236059 CTAGAGGAATGGAGGGAAATAGG + Intronic
962297877 3:134209432-134209454 CATTAGGAATAGTGCTAAAATGG - Intronic
963254502 3:143131300-143131322 CTTAAGTAATGCAGATAAATGGG + Intergenic
963703503 3:148656341-148656363 ATCTGGGAATAGAGCTAAATAGG - Intergenic
968254938 3:197261174-197261196 CATTAGGACTGGAGCTAGATAGG + Intronic
969938044 4:10702445-10702467 ATTTAGGACTGGAGCTACTTAGG + Intergenic
971202615 4:24525371-24525393 CTTTTGGATTCTAGCTAAATTGG + Intronic
972616488 4:40703466-40703488 CTTTTGGACTGGAGCTAACCAGG + Intergenic
972827338 4:42774966-42774988 CTTGAGCGATGGAGATAAATGGG + Intergenic
973934465 4:55828925-55828947 GTTTAGGAATGGAGATACTTGGG - Intergenic
974074788 4:57158562-57158584 CCTCAGGCATGGAACTAAATTGG - Intergenic
974232920 4:59139602-59139624 CTTTAGGAAAGTAACTAAAAGGG + Intergenic
975787768 4:77910766-77910788 CTTTAGAAATGGAGCAAAGCAGG + Intronic
976270440 4:83225121-83225143 CTTTGGGAAGGGAGCTTAATTGG - Intergenic
976421402 4:84848695-84848717 CTTTAGGAATGGAGAACAATGGG + Intronic
980549965 4:134321757-134321779 ATTTAGGAATGGAACACAATGGG - Intergenic
981303662 4:143221681-143221703 CTTTAGGAAGGGGGATAACTGGG - Exonic
984893236 4:184512244-184512266 CTGTAGGTAGGGAGCTTAATTGG - Intergenic
987884470 5:23795742-23795764 CATTAGAAATTGAGATAAATTGG + Intergenic
988659880 5:33253859-33253881 CATTTGGAATGGACTTAAATAGG - Intergenic
988932253 5:36047927-36047949 TTTTAGGAATGGAGCTGAGAGGG - Intronic
989590541 5:43108817-43108839 TTTTAGAAATGGAGATAATTCGG - Intronic
990994283 5:61715798-61715820 CTTTTGGAATAGTGCTAACTTGG + Intronic
993078109 5:83261282-83261304 CTTCAGGAAGGGAGGAAAATAGG - Intronic
994585680 5:101706285-101706307 ATTTAGAAATGCAGCTAACTAGG - Intergenic
997488563 5:134253041-134253063 CTTTGTGAATGGCACTAAATAGG - Intergenic
998771603 5:145552053-145552075 CTTTGGGAAGGGAGCTCAATTGG - Intronic
1000806984 5:165807297-165807319 TTTTAAGAAAGGTGCTAAATCGG + Intergenic
1001044291 5:168359959-168359981 CTTTGGGAATGTTGCTAAACAGG + Intronic
1001084199 5:168688438-168688460 CTTTAGGAATGGATAGAAGTGGG + Intronic
1001435408 5:171695755-171695777 CTTCAGAAATGGGGCTCAATAGG - Intergenic
1003146134 6:3512104-3512126 CTCTAGGAATGGAGGCAAAGTGG - Intergenic
1004827395 6:19437879-19437901 CTTTAGACATTGAGTTAAATGGG + Intergenic
1005700982 6:28399819-28399841 CTCTAGGAAGGGAGCGAAAGGGG + Intergenic
1008142720 6:47850532-47850554 ATTTAGGAATGGAGATGAAAAGG - Intergenic
1013388631 6:109659764-109659786 GTTTACGAATGGAGCAAAATGGG + Intronic
1015689057 6:135900393-135900415 CTTTAGGAATGTAGCTAAAAAGG - Intronic
1016862504 6:148734965-148734987 CTTAAGGAATAGAAATAAATCGG - Intergenic
1016946275 6:149537405-149537427 CGTTAAGAATGATGCTAAATCGG + Intronic
1017533795 6:155325777-155325799 CTTTGGGAATCTAGCTAAAGGGG - Intergenic
1023956245 7:44889200-44889222 CTTTAGGGATGGATCTCAACAGG + Intergenic
1024449887 7:49527648-49527670 TTTTTGGAATTGAGCAAAATCGG - Intergenic
1032693452 7:134312743-134312765 CTTTAGAAATGGAATGAAATGGG - Intronic
1033734893 7:144212343-144212365 CCTTAGGACTGGAGCAAGATTGG + Intergenic
1033748162 7:144338626-144338648 CCTTAGGACTGGAGCAAGATTGG - Intergenic
1034676269 7:152894705-152894727 CTGAAGGAATGGAGCAAAAGCGG + Intergenic
1037435554 8:18859320-18859342 CTCTAGGAATGGAACTACAAAGG - Intronic
1038171194 8:25134440-25134462 CAAAAGGAATGGAGCTATATGGG + Intergenic
1038852000 8:31288121-31288143 ATTAAGTAATGGAGCTAAAGAGG + Intergenic
1041367023 8:57117280-57117302 CTTTAGGAATAGAGCAAGGTAGG + Intergenic
1041489813 8:58421248-58421270 CTTTTGAAATGTGGCTAAATGGG - Intronic
1043935951 8:86142464-86142486 CTTTGAGCATGGAGCTATATGGG - Intronic
1044337807 8:91008260-91008282 ATTTAGGAATAGAGAGAAATAGG + Intronic
1045811920 8:106231719-106231741 CTTCAGAAATGCAGCAAAATAGG - Intergenic
1046025366 8:108716400-108716422 GTTTAGAAATGGTGCTAAAGGGG + Intronic
1046375555 8:113375612-113375634 CCTTAGGAATGAAGCTAAGAGGG + Intronic
1047637814 8:126784169-126784191 CCTTAGGAATGGAAATAAAATGG - Intergenic
1051816413 9:21111929-21111951 CTTTAGGAATGAAGCTATGAAGG - Intergenic
1051927626 9:22348219-22348241 CTTTTGGAATGGAACTATAAAGG - Intergenic
1054867589 9:70018397-70018419 ATTTAGTAATAAAGCTAAATAGG + Intergenic
1055229049 9:74039508-74039530 CTTTAGAAATGCAGATAATTTGG - Intergenic
1058311417 9:103508163-103508185 CCTTAGTAATGGAACCAAATAGG + Intergenic
1060143418 9:121230327-121230349 TTTTAGGAAAGTAGCTAAACTGG + Intronic
1203371850 Un_KI270442v1:314136-314158 CTTAAGGAAGGGAGGTAAAGGGG + Intergenic
1187018557 X:15355417-15355439 CATTAAGAATGGAACTAAACAGG + Intronic
1188135251 X:26486699-26486721 CTTTAGGCCAGGGGCTAAATAGG + Intergenic
1188467382 X:30497396-30497418 CCTTTGGAATGGAGATAAATGGG + Intergenic
1189384381 X:40525333-40525355 CTTGAGGAATGGCGCCATATTGG + Intergenic
1190105793 X:47560638-47560660 CTTTAGGAATGGGGTTGATTAGG - Intergenic
1192625026 X:72717822-72717844 CTTTGGGAAGGGAGATAAAGGGG - Intergenic
1194432282 X:93823834-93823856 CTTTAGAAATAGAACTAAAATGG - Intergenic
1198502291 X:137263305-137263327 CTGTAGGAATGGAAAGAAATTGG + Intergenic
1198750069 X:139931133-139931155 CATTAAGAATGGAGCGAAACAGG - Intronic