ID: 914895430

View in Genome Browser
Species Human (GRCh38)
Location 1:151667436-151667458
Sequence CTTTTATTGTTAAGGCCAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 266
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 241}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914895430_914895433 27 Left 914895430 1:151667436-151667458 CCTTTTGGCCTTAACAATAAAAG 0: 1
1: 0
2: 0
3: 24
4: 241
Right 914895433 1:151667486-151667508 GACTCTGAATGTACCATAGCTGG 0: 1
1: 0
2: 0
3: 2
4: 68
914895430_914895434 28 Left 914895430 1:151667436-151667458 CCTTTTGGCCTTAACAATAAAAG 0: 1
1: 0
2: 0
3: 24
4: 241
Right 914895434 1:151667487-151667509 ACTCTGAATGTACCATAGCTGGG 0: 1
1: 0
2: 0
3: 7
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914895430 Original CRISPR CTTTTATTGTTAAGGCCAAA AGG (reversed) Intronic
901190583 1:7407625-7407647 CTTTCATTCTTAAAGCCAGAGGG - Intronic
906418076 1:45638294-45638316 CTTTTACTGTCAAGGTTAAAAGG + Intronic
906715068 1:47962525-47962547 ATATTATTATTAAGGGCAAAGGG - Intronic
907124126 1:52034036-52034058 ATTTTATTAATAAGGCCTAAGGG + Intronic
910152453 1:84167280-84167302 CTTTTATTTTAAAGGCAATAGGG - Intronic
910353309 1:86324712-86324734 CTTTTATTTGTAAGGCAAACTGG + Intergenic
910522076 1:88134446-88134468 CTTTTATAGAAAAGACCAAAAGG - Intergenic
910722767 1:90304976-90304998 CTTTTGTTGCTCATGCCAAATGG - Intergenic
911226393 1:95310058-95310080 CTTTTATTGAAAAGGCTAATGGG - Intergenic
912648007 1:111413558-111413580 ATTTTTTTGTCAAGGCAAAAGGG + Intergenic
914895430 1:151667436-151667458 CTTTTATTGTTAAGGCCAAAAGG - Intronic
916296228 1:163223220-163223242 CTTTTATTGTAATGGGCAACAGG - Intronic
917221600 1:172735700-172735722 CTTTTGGTGTTAGGGCCATATGG + Intergenic
919291247 1:195634362-195634384 CTGTTATAGATAATGCCAAATGG + Intergenic
919944559 1:202309804-202309826 CTTTTATATTTAAGGCCACATGG - Intronic
920736745 1:208539738-208539760 CTTTTTCTTTTAATGCCAAATGG - Intergenic
921549422 1:216515515-216515537 CTGTTGTTCTTAAGGACAAATGG - Intronic
921668358 1:217899566-217899588 CTTTTTTAGTGAAGGCTAAAGGG - Intergenic
923837083 1:237624001-237624023 CATTTATTATTATGGCAAAATGG + Intronic
924048791 1:240059806-240059828 CTTTTACAGTTCAGGACAAAAGG - Intronic
924051075 1:240080191-240080213 AGTTTATTGATAAGGGCAAATGG - Intronic
924078762 1:240370082-240370104 CTTTAGTTTTTAAGGCCATATGG - Intronic
924492622 1:244554003-244554025 TTGTTATTTTTATGGCCAAATGG + Intronic
924838454 1:247679954-247679976 CTTTTTCTGTGAAGACCAAAAGG + Intergenic
1063603499 10:7503055-7503077 CTTTTCTTGAAGAGGCCAAAGGG + Intergenic
1063843249 10:10095586-10095608 ATTTTATTGTTAGGACTAAATGG - Intergenic
1064857216 10:19782755-19782777 TTTTTACTGTTAAGTACAAAAGG - Intronic
1065006305 10:21383540-21383562 CATGTAATGTTAAGGCCAATGGG - Intergenic
1066650065 10:37646293-37646315 TTTTTATATTTAAGGCCAGAAGG - Intergenic
1067032962 10:42891786-42891808 TTTTTATATTTAAGGCCAGAAGG - Intergenic
1068446146 10:57126169-57126191 CTTTTATCCTGAAGGCCTAAGGG + Intergenic
1069205428 10:65676925-65676947 CTCTTAGTGTCAATGCCAAATGG + Intergenic
1071805666 10:89117986-89118008 CTTTGATAGTTAACACCAAAGGG - Intergenic
1071836350 10:89421953-89421975 TTCTAATTGTCAAGGCCAAATGG - Intergenic
1072856560 10:98953372-98953394 CTGGCATTGATAAGGCCAAAGGG - Intronic
1073604493 10:104880234-104880256 CTTTTATTGTTAAATCCTAAAGG - Intronic
1074300652 10:112230682-112230704 CCTTGTTTGTTAAGACCAAAAGG + Intergenic
1074597162 10:114878159-114878181 CTTATAATGTTAAGGTAAAAAGG - Intronic
1078249098 11:9602478-9602500 CTTTTCTTATTATGCCCAAAGGG - Intergenic
1079767932 11:24417272-24417294 GTTTTATAGTCAAGGACAAAGGG + Intergenic
1080271524 11:30455590-30455612 CTTTGTTTTTTAATGCCAAAAGG + Intronic
1080549948 11:33364674-33364696 CTTTTACATTTAAGACCAAAAGG + Intergenic
1081306588 11:41519206-41519228 CTATTATTGTTGAGGCTTAAGGG - Intergenic
1086521290 11:87671026-87671048 TTTTTAGAGTTAAGGACAAATGG + Intergenic
1087163991 11:94980387-94980409 ATTTTATAGTAAAGTCCAAAGGG - Intronic
1092524980 12:9304367-9304389 CTTTTAGAGTGAAGGCCACAGGG + Intergenic
1092542288 12:9427451-9427473 CTTTTAGAGTGAAGGCCACAGGG - Intergenic
1092972839 12:13714607-13714629 CTCTTAATCTTAAGCCCAAAGGG + Intronic
1093273256 12:17092647-17092669 CTTTTATTCTTATGAACAAAAGG - Intergenic
1093550211 12:20400933-20400955 TATTTATTTTTAAGGCAAAAGGG + Intronic
1094469264 12:30788330-30788352 CCTTTATTGTTAAGGGAAGAGGG + Intergenic
1094510726 12:31094982-31095004 CTTTTAGAGTGAAGGCCACAGGG + Intronic
1096442170 12:51652481-51652503 CTTTTATTCTGAAGGCAATAAGG - Intronic
1097054410 12:56241169-56241191 TTTTTATTTTCAAAGCCAAAGGG - Exonic
1097098263 12:56567496-56567518 ATTTTGGTGATAAGGCCAAAGGG - Intronic
1099344801 12:81485065-81485087 AAATTATTTTTAAGGCCAAAAGG + Intronic
1099641460 12:85291758-85291780 CTGTTATTGTGAAGACTAAATGG + Intronic
1099653055 12:85454215-85454237 CTTTCACTGTTAAAGCCAAGTGG - Intergenic
1100012165 12:89966741-89966763 CTTTTACTGATAAGGTCAAAGGG - Intergenic
1100258068 12:92904285-92904307 ATCTTTTTGTCAAGGCCAAATGG - Intronic
1102964979 12:117118893-117118915 ATCCTATTGTTAAGGCCAGATGG + Intergenic
1105435606 13:20375595-20375617 TTCTCATTGTTCAGGCCAAAAGG - Intergenic
1107147926 13:37079463-37079485 CTTTGATTCTTAAGGCCATATGG + Intergenic
1107455607 13:40551938-40551960 CTTTTTATGTTAAGGGCAGAAGG - Intergenic
1108073590 13:46655446-46655468 CTTTTGTTGTGAACGCCAAGAGG - Intronic
1108311442 13:49195510-49195532 CTGTTATTTTTAGGGCCTAATGG + Intronic
1109423824 13:62147049-62147071 CTTTTATGGTGGAGGGCAAAAGG + Intergenic
1110216547 13:73030462-73030484 AGTTTATTGTGAAGGCCAAATGG - Intergenic
1110889618 13:80682128-80682150 CTTGTATTGTGAAGGGCAATTGG - Intergenic
1112588212 13:100738505-100738527 CTTTTCCTCTTTAGGCCAAAGGG + Intergenic
1115730745 14:36266816-36266838 CTTTTAATGTAATGGCAAAATGG + Intergenic
1120113218 14:80582605-80582627 CTTTCATTGTTAATCCCAAAAGG + Intronic
1123816335 15:23983210-23983232 ATTAGATTGTTAAGGCCCAATGG + Intergenic
1127658858 15:61081285-61081307 CTCTTATTTTTAAGGCAATAAGG - Intronic
1127714485 15:61635970-61635992 GTGTTATTGTTACCGCCAAATGG - Intergenic
1130445759 15:84000050-84000072 CTTTTTTTTTTTTGGCCAAAGGG - Intronic
1135233703 16:20735013-20735035 CCTTTATTTTCAAGGCCAAGTGG + Exonic
1140102211 16:71927538-71927560 ATTTTATTTTTACTGCCAAAGGG + Intronic
1140732616 16:77870426-77870448 CTTTTCTTGGCAAGGTCAAAGGG + Intronic
1141260046 16:82444463-82444485 TTGTTACTGTTAAGCCCAAAAGG - Intergenic
1142547151 17:712949-712971 CTTTTAGTGTTCCGGCCACACGG - Intronic
1143315789 17:6032560-6032582 ATTTGCCTGTTAAGGCCAAAGGG + Intronic
1146386073 17:32374547-32374569 CATTGAATGTTAAGGCTAAAAGG + Exonic
1147477902 17:40730976-40730998 CTTTTGTTTTTAATGACAAATGG + Intergenic
1149192482 17:54080855-54080877 CATCTATTGTTAAGGCCAGCTGG + Intergenic
1149513260 17:57259428-57259450 CATTCAATGTTAAAGCCAAAAGG - Intronic
1151018351 17:70583740-70583762 CTTTTACTGTTAATTGCAAATGG + Intergenic
1152326453 17:79642585-79642607 TTTTTATTGTTAATGTCATATGG + Intergenic
1152977278 18:233866-233888 GTTTTATTATAAAGACCAAATGG - Intronic
1153083899 18:1260981-1261003 AATTTATTGTTAAGTCCCAAAGG + Intergenic
1153696068 18:7643292-7643314 CTATGTTTCTTAAGGCCAAAAGG + Intronic
1155391722 18:25345527-25345549 TTTTTGTTTTTAAGGCCAAGTGG + Intronic
1156389253 18:36635344-36635366 ATTTTATCCTTAAGGCCAAGTGG + Intronic
1156721842 18:40079727-40079749 CTTATATTTTTAATGCAAAATGG + Intergenic
1157032542 18:43929744-43929766 CTTTTCTTGTCAAGGCCTAATGG + Intergenic
1157856526 18:51110157-51110179 CGTTTATTGTGAAGGCCCACAGG + Intergenic
1158804626 18:60955377-60955399 CTTTCCTTTTTAAGGCCAAATGG - Intergenic
1159000003 18:62965166-62965188 CTTTTATTGGCAAAACCAAAGGG - Intronic
1160087409 18:75789636-75789658 CTTTTATTATCAAGGCCGTAGGG + Intergenic
1163967394 19:20759854-20759876 CATTATTTGTTATGGCCAAAAGG + Intronic
1164894905 19:31866449-31866471 TTTTAATTTTTAAGGCCAGAAGG - Intergenic
1165531656 19:36407671-36407693 CCTTCATTATTAAGGCCCAAGGG + Intronic
1168128886 19:54304542-54304564 CTCTTATTGTGAAGGACAAGTGG - Intergenic
925503989 2:4539924-4539946 CTTTTTTTGGATAGGCCAAAAGG - Intergenic
926078849 2:9967060-9967082 CTTTTATTCTTAAAGCAAACTGG + Intronic
926677481 2:15638404-15638426 CTTAAATGGTAAAGGCCAAATGG - Intergenic
926704233 2:15825533-15825555 GCTTTATTGTGAAGACCAAAAGG + Intergenic
928104910 2:28463520-28463542 CTTTGATTCTTTAGGCCAGAAGG + Intronic
929901473 2:46007448-46007470 CTTTTATTTCTAGGGCCAAGGGG - Exonic
929971064 2:46577310-46577332 CCAATAATGTTAAGGCCAAATGG - Intronic
931705232 2:64941510-64941532 CCTTTGTTGTGAGGGCCAAATGG - Intergenic
933072291 2:77874188-77874210 CTTTTTTTTTTAAGGGCATATGG + Intergenic
935202510 2:100870326-100870348 TCTGTATTGTTAAGGCCAAGGGG + Intronic
936895316 2:117421188-117421210 TTTTGATTATTATGGCCAAAAGG + Intergenic
937649298 2:124302174-124302196 CTTCTATTGTTTAAGCCACATGG + Intronic
939261674 2:139818682-139818704 TTTTTATTAGTAAGGACAAATGG - Intergenic
941153468 2:161944152-161944174 CTTTTATTGTTCAGTTTAAATGG - Intronic
942526031 2:176853873-176853895 CTATTATTCTAAAGGGCAAAAGG + Intergenic
942636051 2:178007138-178007160 TTTTTATTGATAAGGCAAGAAGG + Intronic
943919527 2:193686032-193686054 GTTTTATTTTTAAGGACAAATGG + Intergenic
945592534 2:211752118-211752140 GTTATATTGTTCAGGCCAGATGG - Intronic
945601921 2:211878284-211878306 CTTTAGTTGTTTAGGCCTAAAGG - Intronic
946473835 2:219988694-219988716 CTTTAATTGTTAAACCTAAAAGG - Intergenic
1170124458 20:12948030-12948052 ATTTTTTTGTGAGGGCCAAAGGG + Intergenic
1170693005 20:18631906-18631928 CTCTTCTTGTTTAGGTCAAAGGG + Intronic
1172380704 20:34488178-34488200 TTTTTTTTTTTAAAGCCAAAGGG - Intronic
1173923346 20:46762233-46762255 CTTTGAGTGTTGAGGCCAGAAGG + Intergenic
1174748346 20:53086608-53086630 ATTTTATGGTTAAGGCCACCAGG - Intronic
1175137616 20:56836636-56836658 CTTTTGATGTTAAGGGCTAATGG + Intergenic
1176023553 20:62974644-62974666 TTTGTATTGCAAAGGCCAAAGGG - Intergenic
1177225948 21:18256495-18256517 TTTTTTTTTTTCAGGCCAAAAGG + Exonic
1177325198 21:19578102-19578124 ATTTTATAGTCAAGGCCAAGAGG + Intergenic
1178985774 21:37301644-37301666 CTTTTATTGTTGGACCCAAAGGG - Intergenic
1179417562 21:41210332-41210354 CTTTTATGGTTTAGGCACAACGG + Intronic
1182171009 22:28229296-28229318 TTTGTATTATTAAAGCCAAATGG - Intronic
949528208 3:4927365-4927387 CTTTCATTTTTAATGACAAAAGG + Intergenic
949953087 3:9245549-9245571 CTTATTTTGTGAAGTCCAAAGGG + Intronic
951500624 3:23382734-23382756 CTTGTATTGATAAGCCTAAATGG - Intronic
951897620 3:27625467-27625489 CTTTATTTGTTAAGACAAAAAGG - Intergenic
951898302 3:27632521-27632543 TATTTATGGTCAAGGCCAAATGG - Intergenic
952686920 3:36160623-36160645 CATTTAGTGTTAATGTCAAATGG - Intergenic
955006661 3:54974939-54974961 CTTTTATTGGACAGGCCATATGG + Intronic
955088614 3:55727573-55727595 CTTTTATTGTTAAGCACAATTGG + Intronic
958542473 3:95496779-95496801 CATTTATTGTTAATCTCAAATGG - Intergenic
958914921 3:100038835-100038857 GATGTATTGTTAAGTCCAAAAGG + Intronic
959340434 3:105122685-105122707 CTTTTCTTGAAAATGCCAAATGG + Intergenic
959500451 3:107100699-107100721 ATTTTATTGTTAATGCCTCAAGG + Intergenic
959645673 3:108697428-108697450 TTTTTTTTTTTAAGGCAAAATGG - Intergenic
960807321 3:121596763-121596785 CTTTTTTTTTTAAGGTGAAAAGG - Intronic
960854563 3:122089939-122089961 TTTTTATTTTTAAGCACAAATGG - Intronic
961137863 3:124528558-124528580 CTTTTAAAGTTGAAGCCAAATGG + Intronic
961472832 3:127127268-127127290 CTTGTATTGTTTAAGCCACAGGG - Intergenic
963560511 3:146858639-146858661 ATTTTATTTTTAAAGCCAAGTGG - Intergenic
964291143 3:155181907-155181929 CTTTTTTTTTTAAAGGCAAATGG - Exonic
964394907 3:156235233-156235255 CTTTTGTTGTGTAGGCCAAGTGG - Intronic
964725698 3:159812443-159812465 ATTTCTATGTTAAGGCCAAATGG + Intronic
965984793 3:174737429-174737451 CATTTGTTGTTAAGGTAAAATGG + Intronic
967141186 3:186562031-186562053 CTTTCTTTTTTAAGGCCAAATGG - Intronic
967986073 3:195096154-195096176 CTTTTCTGCTTAAGGTCAAAGGG - Intronic
968265740 3:197361716-197361738 TTTTTAATGTTAGGGCCAATTGG - Intergenic
969994338 4:11296074-11296096 CTTTTAATGTTAAGGTCAGGGGG - Intergenic
970122499 4:12772278-12772300 CTTTTATTGTACAGTCTAAATGG - Intergenic
970670510 4:18391468-18391490 CTTTTAATGAAAAGACCAAAAGG - Intergenic
972548575 4:40106140-40106162 ATTTTATAGTTAAGGATAAAAGG + Intronic
973122300 4:46537021-46537043 CTTTATTTGTTAATTCCAAAGGG + Intergenic
975265278 4:72357199-72357221 CTTCCATTGCTAATGCCAAATGG - Intronic
976019417 4:80602804-80602826 CATGTATTTATAAGGCCAAAGGG - Intronic
976032395 4:80771945-80771967 TTTTTATTGTTATAGCGAAAAGG + Intronic
976420314 4:84835089-84835111 CATTGAATATTAAGGCCAAAAGG - Intronic
977455351 4:97252740-97252762 CTTTTGTTGTTGATGACAAAAGG - Intronic
978212162 4:106150105-106150127 TTTTTATTTTTACTGCCAAAGGG - Intronic
979699632 4:123653570-123653592 CTTTTATTTTTAAAGCTTAATGG + Intergenic
984130976 4:175875832-175875854 CTTTTGTTATTAAGTGCAAACGG + Intronic
984962029 4:185107031-185107053 CTTTTATTCTTAATGCCAACAGG + Intergenic
985329289 4:188810712-188810734 CTTTTAATGTTAACCACAAAAGG + Intergenic
985910423 5:2875308-2875330 ATTTTATTGTTACAGCAAAAAGG + Intergenic
986178869 5:5375035-5375057 CTTTAATTTTTAAGCTCAAAAGG - Intergenic
988118772 5:26932387-26932409 CTTTTATTGTTAATGCATACTGG - Intronic
988382834 5:30520383-30520405 GTTTTAATGTTATAGCCAAATGG - Intergenic
988424324 5:31045676-31045698 CTTTTAATTTTAAGCACAAATGG + Intergenic
989666763 5:43863533-43863555 CTTATGTGGATAAGGCCAAATGG + Intergenic
992975761 5:82117865-82117887 GCTTTATTCTTCAGGCCAAATGG + Intronic
995195925 5:109368320-109368342 CTTTTCTTATTAAAGCCAAGTGG + Intronic
995662089 5:114496241-114496263 CTTTTATTGTAAAGCCCCTATGG + Exonic
996772567 5:127100448-127100470 TTTTTTTTTTTAAGGCCAGACGG + Intergenic
997615391 5:135242748-135242770 CTTTTATTTTTAATGCCAAGTGG + Intronic
997669082 5:135655723-135655745 CTTGTAGTGCTCAGGCCAAAAGG - Intergenic
997931811 5:138078602-138078624 CTTTCAATGTTAAGGCCAGGAGG - Intergenic
998323098 5:141251142-141251164 CTTTTATGTGTAAAGCCAAAAGG + Intergenic
998328018 5:141299275-141299297 GGTCTATTGTCAAGGCCAAAGGG - Intergenic
998563916 5:143199042-143199064 CTATTATTGTTAAGACCTTAAGG + Intronic
1002370183 5:178745879-178745901 CTTGTTTTGTGAAGGCCAAATGG - Intergenic
1003949525 6:11104918-11104940 CTATTTGTGTTATGGCCAAAAGG - Exonic
1005699669 6:28387851-28387873 CTTTTTATGTTAAGGGCAAAGGG - Intronic
1008254887 6:49285579-49285601 CTTTCTTTTTTAAGGCTAAATGG + Intergenic
1008352404 6:50507424-50507446 CTTTCATCGTTAAGGGCAGATGG + Intergenic
1010076846 6:71808625-71808647 ATTTGATTGTTATGGCCAATGGG + Intergenic
1010404771 6:75491612-75491634 CTTTTATGGTAAAGGGGAAAGGG + Intronic
1010501863 6:76610711-76610733 CTCTGATTGTTCCGGCCAAATGG + Intergenic
1011071500 6:83390405-83390427 ATTTTATTTTTAAGCCAAAATGG - Intronic
1011272920 6:85597782-85597804 CTTTTATTTTTATGGCCATGAGG + Intronic
1014266071 6:119279151-119279173 CTTTTAAAGTTAAGGCTATATGG - Intronic
1015452271 6:133384274-133384296 ATTATATTTTTAAGGCCACATGG - Intronic
1015588615 6:134801596-134801618 CATTTGGTTTTAAGGCCAAATGG + Intergenic
1016072984 6:139762824-139762846 GTTTTTTTGTTAAGGACACATGG - Intergenic
1016188791 6:141234137-141234159 CTTATAATATTAAGGCAAAATGG - Intergenic
1016328005 6:142925166-142925188 ATTTTATTGTGAAGGAAAAAAGG + Intronic
1016453816 6:144210554-144210576 CTTTTTATGTTAAGGGCAAAGGG - Intergenic
1017285435 6:152670046-152670068 TTATAATTGCTAAGGCCAAAAGG - Intergenic
1018375925 6:163212574-163212596 CATTTATTTTGAAGGTCAAAGGG - Intronic
1018690971 6:166343748-166343770 CTTTTAAAGTTAAGGACATAAGG - Intergenic
1018753659 6:166829799-166829821 CTTTTCTTCTTAAGGCTGAACGG - Intronic
1020600113 7:10264069-10264091 CTTTTATTGTTAAAGTCTAATGG + Intergenic
1020734946 7:11936505-11936527 ATTTTCTTTTTATGGCCAAATGG + Intergenic
1021091748 7:16491310-16491332 ATTTTACTGCTAAGGACAAAGGG + Intronic
1021916157 7:25434417-25434439 CTCTTATTGAGAAAGCCAAAAGG - Intergenic
1022182419 7:27934337-27934359 CTCTGATTTTTAAAGCCAAAAGG + Intronic
1022624022 7:32015385-32015407 CTGACATTGTTAACGCCAAATGG + Intronic
1023173692 7:37414709-37414731 CTTTTATTGTTTAAGCCAGTCGG + Intronic
1023488639 7:40713629-40713651 CTGTTGTGGTTAAGGCCCAAAGG - Intronic
1027525910 7:79268380-79268402 TTTTTATTGTAAAGGGCCAAAGG + Intronic
1028932838 7:96432145-96432167 ATGTTAGTGTTAAGGCCAGAAGG - Intergenic
1029905145 7:104084803-104084825 CTTTTATTGTTGAGTCGTAAGGG + Intergenic
1031093848 7:117394924-117394946 CTTTTATTGTTCAGGAATAAAGG + Intronic
1031291819 7:119947698-119947720 CTTTCTTTGTGAAGGCCAAGTGG + Intergenic
1032109669 7:129065096-129065118 CTGCTATAGTAAAGGCCAAATGG + Intergenic
1032643113 7:133791915-133791937 CTTTTATTCTTACGTCTAAAGGG + Intronic
1034012512 7:147545217-147545239 CTTGTATTGTTGAGCACAAAAGG - Intronic
1035191063 7:157169034-157169056 CTTTTATTGTTTAGGAAGAAAGG + Exonic
1037360964 8:18073224-18073246 CTTTTATTCTTATGGGGAAATGG - Intronic
1039271647 8:35887828-35887850 CTTTTGGTGTTAAGGGAAAAAGG + Intergenic
1040751808 8:50718574-50718596 CTTTTCTTGTAAAGGGCAAAGGG + Intronic
1042959418 8:74287462-74287484 CTTGTAATGTTAAGGAAAAAAGG + Intronic
1043029883 8:75120962-75120984 CTTTTATCCTTAAGGATAAAAGG + Intergenic
1043512717 8:80965586-80965608 CTTTAAATGTTTAGGCCCAAAGG - Intergenic
1045367777 8:101492998-101493020 CTTTTACTATCAAGGCCCAAAGG - Intronic
1047142755 8:122160410-122160432 CATTTATTTTTAAAGGCAAAAGG - Intergenic
1047583533 8:126243511-126243533 CTTTTCTTGGTAATGCCAATAGG - Intergenic
1048755049 8:137728975-137728997 CTTGTATTGTGAAGCCCACATGG + Intergenic
1049581656 8:143414344-143414366 CTTTTTTTTTTAAGGATAAAGGG + Intergenic
1050075308 9:1856646-1856668 TTTTTATTGTCAAGGTCAAATGG + Intergenic
1051773684 9:20610197-20610219 CTCTTATTTTTAAAGCTAAAAGG + Intronic
1052748447 9:32464333-32464355 CTTATATTCTTAAGACTAAAGGG - Intronic
1055329837 9:75172351-75172373 ATTTTATTTTTAAGTTCAAAGGG + Intergenic
1055416865 9:76092828-76092850 TTTTTAATGTTATGGCCAAAAGG - Intronic
1055909768 9:81335575-81335597 CCTCTATTGTTAAGCCCCAATGG - Intergenic
1057398785 9:94704065-94704087 CTTTTAATGTTAAGGGCAGAGGG - Intergenic
1057595450 9:96412129-96412151 TTCTCATTGTTAAGGCCAAAAGG - Intronic
1057729596 9:97597143-97597165 CTTTTATTGTGAATGCCAGAAGG - Intronic
1057980827 9:99661212-99661234 CTTTTATTGTTATTGCTTAAAGG + Intergenic
1194000425 X:88421984-88422006 ATTTTAATGTTAAGGAGAAAAGG - Intergenic
1194157359 X:90407669-90407691 TTTTTATTGTTAATGCAAATAGG + Intergenic
1194252467 X:91593421-91593443 CTTTTATTTTTGATACCAAATGG + Intergenic
1194791660 X:98158790-98158812 CTTTTATTTTTAAGAACACATGG + Intergenic
1195380442 X:104265800-104265822 TTTTTGTTTTTAAAGCCAAAGGG - Intergenic
1195788033 X:108548325-108548347 ATTCTATTGTTAAGCCCATAAGG - Intronic
1196300943 X:114049280-114049302 CTTGTATTGTACATGCCAAATGG - Intergenic
1197250644 X:124212994-124213016 ATTTTATTCTTCAGGGCAAAGGG - Intronic
1197797965 X:130318286-130318308 CTTTTATTGGTTAGGCCAGAGGG - Intergenic
1200392034 X:155954569-155954591 CTTTTAATGTTAAAGGCAAGAGG - Intergenic
1200424483 Y:3006288-3006310 CTTTTATTCATGAGACCAAAGGG - Intergenic
1200503691 Y:3984661-3984683 TTTTTATTGTTAATGCAAATAGG + Intergenic
1200571398 Y:4834666-4834688 CTTTTATTTTTGATACCAAATGG + Intergenic
1200822056 Y:7596289-7596311 ATTTTATTTTTAGAGCCAAATGG + Intergenic
1202104078 Y:21343554-21343576 ATTTTATTTTTAGAGCCAAATGG + Intergenic
1202238245 Y:22737728-22737750 ATTTTATTTTTAGAGCCAAATGG - Intergenic