ID: 914901198

View in Genome Browser
Species Human (GRCh38)
Location 1:151712054-151712076
Sequence CAGGCCACGAAGAAGGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 349
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 320}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914901198_914901206 0 Left 914901198 1:151712054-151712076 CCAGCCTCCTTCTTCGTGGCCTG 0: 1
1: 0
2: 1
3: 27
4: 320
Right 914901206 1:151712077-151712099 GCACTTCCTGTGGGGAGCTCAGG 0: 1
1: 0
2: 2
3: 22
4: 216
914901198_914901204 -8 Left 914901198 1:151712054-151712076 CCAGCCTCCTTCTTCGTGGCCTG 0: 1
1: 0
2: 1
3: 27
4: 320
Right 914901204 1:151712069-151712091 GTGGCCTGGCACTTCCTGTGGGG 0: 1
1: 0
2: 2
3: 16
4: 216
914901198_914901202 -10 Left 914901198 1:151712054-151712076 CCAGCCTCCTTCTTCGTGGCCTG 0: 1
1: 0
2: 1
3: 27
4: 320
Right 914901202 1:151712067-151712089 TCGTGGCCTGGCACTTCCTGTGG 0: 1
1: 0
2: 0
3: 9
4: 152
914901198_914901203 -9 Left 914901198 1:151712054-151712076 CCAGCCTCCTTCTTCGTGGCCTG 0: 1
1: 0
2: 1
3: 27
4: 320
Right 914901203 1:151712068-151712090 CGTGGCCTGGCACTTCCTGTGGG 0: 1
1: 0
2: 1
3: 13
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914901198 Original CRISPR CAGGCCACGAAGAAGGAGGC TGG (reversed) Intronic
900363326 1:2300343-2300365 CAGGCCACGAGGCAGGAGCACGG - Intronic
900439124 1:2644599-2644621 CAGCCCAGGAAGAAGGAGCTGGG + Intronic
900966230 1:5960632-5960654 CATGACAGGTAGAAGGAGGCTGG + Intronic
901057044 1:6453414-6453436 CAGCCCACGTATAAGGTGGCCGG - Intronic
901232545 1:7649312-7649334 CAGGCCCCGCAGATGCAGGCAGG - Intronic
901577560 1:10212503-10212525 AAGGCCACAAAGAAGAAAGCAGG - Intronic
901741560 1:11345299-11345321 GAGGCCACGGGGAAGGAGGTGGG + Intergenic
902394783 1:16126678-16126700 CAGACCACGGTGAAGGAGACAGG + Intronic
902477330 1:16695079-16695101 CAGCCCACGTATAAGGTGGCCGG + Intergenic
902811857 1:18892539-18892561 CATCCCAGGTAGAAGGAGGCGGG + Intronic
902960615 1:19960685-19960707 AAGGGCAAGAAGAAGGCGGCAGG - Intergenic
903376595 1:22870311-22870333 ATGGCCCCGAGGAAGGAGGCTGG + Intronic
903590320 1:24450744-24450766 CAGGCCACGGGGAAGGAAGATGG - Intronic
903701972 1:25255933-25255955 CAGGCCGCACAGCAGGAGGCAGG - Intronic
903886198 1:26542506-26542528 GAGGCCACGTAGAAAGGGGCTGG + Intronic
903959445 1:27047468-27047490 CAGGCCAAGGGGAAGGAGGTGGG + Intergenic
904601145 1:31673176-31673198 CAAGCCACGAGGAGTGAGGCTGG + Intronic
904925914 1:34048150-34048172 TTGGCCACGAAGTGGGAGGCAGG - Intronic
906119418 1:43378678-43378700 CATGACAATAAGAAGGAGGCAGG + Intergenic
906610474 1:47198440-47198462 AAGGCCCTGAGGAAGGAGGCTGG + Intergenic
907926053 1:58956145-58956167 CAGGCCACACAGCAGGAGGTAGG + Intergenic
910051624 1:82981128-82981150 CAGGACACAAATAAGAAGGCAGG - Intergenic
910386757 1:86692563-86692585 TAGGCCAGGAAGAAGGAAGAAGG + Intergenic
910744864 1:90562358-90562380 CTGACAACTAAGAAGGAGGCTGG + Intergenic
910849424 1:91636086-91636108 CAGGCCTCGCACTAGGAGGCAGG + Intergenic
912386144 1:109272205-109272227 CAGGCTGGGAAGAAGGAGGGTGG - Intronic
913177098 1:116284953-116284975 CAGGGCATGAAGTAAGAGGCAGG - Intergenic
913203507 1:116515332-116515354 CAGACCACGGGGGAGGAGGCCGG - Intronic
913584374 1:120259155-120259177 CAGGCCTGGAAGAAGCAGCCAGG + Intergenic
913623807 1:120639183-120639205 CAGGCCTGGAAGAAGCAGCCAGG - Intergenic
914566371 1:148871032-148871054 CAGGCCTGGAAGAAGCAGCCAGG + Intronic
914606448 1:149259208-149259230 CAGGCCTGGAAGAAGCAGCCAGG - Intergenic
914901198 1:151712054-151712076 CAGGCCACGAAGAAGGAGGCTGG - Intronic
915076214 1:153309793-153309815 CAGGGCAGGAACCAGGAGGCAGG + Intronic
917608723 1:176664368-176664390 CAGGCTTTGAAGAAGGAGGAAGG - Intronic
917656284 1:177129413-177129435 CAAGCAAGGAAGCAGGAGGCTGG + Intronic
918002679 1:180512476-180512498 AAGGGCAAGAAGAAGGGGGCAGG + Intergenic
919766754 1:201132331-201132353 AAGGCCACGAGGAAGCAGGCTGG + Intergenic
919924971 1:202187472-202187494 CAGGCCATCAAGGACGAGGCTGG + Intergenic
920508415 1:206533248-206533270 CAGGCCTGGTAGAAGTAGGCAGG + Intronic
920696049 1:208182017-208182039 CAGGCCACGGTGAAAGAGACAGG - Intronic
922167829 1:223130444-223130466 AGGGCCACGAAGAGGGAGGGAGG - Intronic
924931903 1:248739620-248739642 CAGTCCCCGAAGAAGGAGGCTGG + Exonic
1062903105 10:1160549-1160571 CAGGACACGCAGAACGAAGCTGG - Intergenic
1064140969 10:12790032-12790054 CAGGCCAGGAACAGGGAGTCAGG + Intronic
1064454500 10:15474062-15474084 GAGGCCGCCAAGAAGAAGGCTGG + Intergenic
1065495914 10:26328070-26328092 CAGGCAAGGAAGCAAGAGGCAGG + Intergenic
1065861994 10:29879583-29879605 CAGGCCTAGTAGAAGGAAGCAGG - Intergenic
1066460445 10:35608241-35608263 CAGGCCACGCGGAGGGACGCCGG + Exonic
1067029016 10:42868015-42868037 CAGGCCACGGAGAGGGCAGCTGG + Intergenic
1069606140 10:69739960-69739982 CAGGGCAGGAAGAACGGGGCAGG - Intergenic
1070704706 10:78629231-78629253 CAGGCCAGCAAGCAGAAGGCAGG - Intergenic
1072688680 10:97555045-97555067 CTGGCAAAGAGGAAGGAGGCAGG + Intronic
1073498289 10:103913899-103913921 CAGGCCCCCAAGAAGGAGGAGGG + Intronic
1074813880 10:117130575-117130597 CAGGCCTTGGAGGAGGAGGCAGG - Intronic
1075578120 10:123595754-123595776 CAGGCTACCAGGTAGGAGGCTGG + Intergenic
1076273167 10:129174488-129174510 CAGAGCAGAAAGAAGGAGGCAGG - Intergenic
1077251572 11:1563130-1563152 GAGGCCAGGCAGAAGGAGCCTGG + Intronic
1077860822 11:6178272-6178294 CAGGCCACACAGAAGGAGTTGGG + Intergenic
1079104151 11:17559687-17559709 CAGGCCAGGAAGATGGTGCCAGG - Intronic
1079345133 11:19645219-19645241 CTGGCCTCGAAGATGGAGGAAGG - Intronic
1079616718 11:22503490-22503512 CAGGCCACTAATAACCAGGCAGG - Intergenic
1081880488 11:46446368-46446390 CTGGCCACTAAGATGAAGGCAGG + Intronic
1083048419 11:59755984-59756006 CAGGAAAGGGAGAAGGAGGCTGG - Intronic
1083300106 11:61735679-61735701 GAGGACAGGAAGAGGGAGGCAGG - Intronic
1083611661 11:64007323-64007345 CTGGCCCCGAGGAAGGAGGGAGG + Intronic
1083882471 11:65555357-65555379 GAGGCCAGGAGGCAGGAGGCAGG - Intronic
1084266456 11:68007891-68007913 CAGCCCAGCAAGGAGGAGGCAGG + Intergenic
1084343759 11:68528727-68528749 CATGCCACTAAGAAGGGGCCAGG - Intronic
1084930150 11:72548853-72548875 GAGGCCTCTAAGAAGGAGCCGGG - Intergenic
1085258063 11:75188169-75188191 GAGTCCACGAAGAAGCAGGATGG + Exonic
1085532341 11:77199375-77199397 CAGGCAAAGGAGAAGTAGGCCGG + Intronic
1087583989 11:100094734-100094756 CAGGGAAAGAAGAAGGAGGGAGG + Intronic
1088828691 11:113517005-113517027 CAGGCCAGGAATCAGGAGGCAGG - Intergenic
1089111736 11:116062704-116062726 CAGCTCACGCAGAGGGAGGCAGG + Intergenic
1089295441 11:117464610-117464632 CGTGCCAGGAAGAAGGAGGAAGG + Intronic
1093778012 12:23099878-23099900 CAGACCAAGAAGCAGGAAGCAGG + Intergenic
1095404187 12:41849511-41849533 TAGGCAAAGAAGAAGGAGGTGGG - Intergenic
1095691390 12:45093307-45093329 CAGACAACGAAGGAGGAGCCAGG - Intergenic
1096795978 12:54077804-54077826 CAGGCCTCAGAGAAGGAGGGCGG + Intergenic
1096964273 12:55612623-55612645 CAGGCCAAGAGGCAGGAGTCAGG + Intergenic
1097679362 12:62634146-62634168 CAGGTCACGGAGGAGGAGGGAGG - Intergenic
1099334205 12:81332764-81332786 CAGACCAGGAAGTAGGAGCCAGG + Intronic
1100001044 12:89835544-89835566 CAGAGCTTGAAGAAGGAGGCAGG + Intergenic
1100461148 12:94800532-94800554 AAGGCCAAGAAGAAGAAAGCTGG + Intergenic
1102370843 12:112381743-112381765 CAGGCCCCGAGGAGGGAGGGAGG + Intronic
1103909948 12:124346658-124346680 GTGGCCACGGTGAAGGAGGCGGG - Exonic
1104111818 12:125711335-125711357 GAGGCCACCCAGAAGGAGGTGGG + Intergenic
1104677063 12:130718379-130718401 CAGGCCACACAGATGGAGTCAGG - Intergenic
1105909123 13:24844413-24844435 CAGGCCCCAAAGAAGGAAGGAGG + Intronic
1108274018 13:48789764-48789786 GAGGGCAGGAAGAAGGAGGAAGG + Intergenic
1111932427 13:94525546-94525568 TAGGCCGCAATGAAGGAGGCAGG - Intergenic
1112895877 13:104299074-104299096 GAGGTCACGAAGCAAGAGGCAGG - Intergenic
1112962738 13:105147565-105147587 CATACCACCAAGGAGGAGGCTGG + Intergenic
1113857290 13:113454396-113454418 CAGGCCCCGAGGAAGGAGACGGG - Intergenic
1115630036 14:35235604-35235626 CAGGCCAAGAAGAAAGCTGCTGG - Intronic
1116868367 14:50049514-50049536 GAGGCCAGGAAGAGGGAGGCTGG - Intergenic
1117408169 14:55425341-55425363 CAGGCCAAGAAAATGAAGGCTGG + Intronic
1117911511 14:60642164-60642186 CAGGAAGCGAAGAAGGAGACAGG + Intergenic
1118951081 14:70437321-70437343 CAGCCCCCGAAGAGGGAGTCTGG + Intergenic
1119236884 14:73027036-73027058 GAGGCAACGAAGGAGGAGGGTGG - Exonic
1121705797 14:95992722-95992744 CAGGACAGGAAGGAGTAGGCAGG + Intergenic
1121757427 14:96414712-96414734 CAGGCCAAGAAGACGGATGGAGG + Intronic
1122033149 14:98928235-98928257 CTGCCCACAAAAAAGGAGGCAGG + Intergenic
1122126596 14:99581730-99581752 AAGGCCACGAAGCAGGATGGGGG + Intronic
1122221243 14:100240090-100240112 CGGGCCGCGAAGATGGCGGCAGG + Intronic
1122231364 14:100307602-100307624 CAGGCCCTAAAGAAGGAAGCTGG - Intergenic
1122635571 14:103128117-103128139 CAGGCCAGGAGGCAGGAGGAGGG + Intronic
1122646258 14:103196420-103196442 CAGCACATGAAGACGGAGGCAGG - Intergenic
1122879584 14:104684210-104684232 GAGGCAACCGAGAAGGAGGCTGG + Intergenic
1122917549 14:104865847-104865869 CAGGCCAGGAGGGAGGCGGCCGG - Intronic
1124334423 15:28846304-28846326 CAGGCCAGGAAGCGGTAGGCAGG + Intergenic
1124625696 15:31306433-31306455 CTGGCCTGGAAGAAGGAGACTGG - Intergenic
1126560373 15:50036397-50036419 CAAGCCATGAAGAAAGCGGCAGG + Intronic
1127500519 15:59550107-59550129 CAGGCCACGATGGAAGAGGGGGG - Intergenic
1127735105 15:61832183-61832205 CAGGCCCCGAAGAATGACACAGG + Intergenic
1127774838 15:62256473-62256495 CAGGCCATGAAGCAGTAGGCAGG + Intergenic
1127775431 15:62260699-62260721 CAGGCCATGAAGCAGTAGGCAGG + Intergenic
1130957408 15:88637467-88637489 CAGGGCATGAAGATGGAGGTGGG + Intronic
1133000532 16:2849160-2849182 CAGGACTAGAAGAAGGAGGAAGG + Intergenic
1133126852 16:3652742-3652764 CTGGCCATGAAGCAGAAGGCAGG - Intronic
1133128489 16:3662217-3662239 CAGACCACGAGGTAGCAGGCGGG + Exonic
1133147275 16:3798123-3798145 CAGCCCAGGCAGAAGGATGCAGG + Intronic
1134303563 16:13012648-13012670 CAGGTCACAGAGAAGGAGGTGGG + Intronic
1134829710 16:17313249-17313271 GAGGCCAGGAAGCAGGAAGCTGG + Intronic
1138200252 16:55083063-55083085 GATGCCACGAAGAAGGATTCAGG + Intergenic
1138420072 16:56893114-56893136 CAGGCCAGGAAGGAGAAGGAAGG - Intronic
1138554387 16:57763331-57763353 CAGGCCAGGCAGGAGGAGGAAGG - Intronic
1138672954 16:58630056-58630078 AAGTCCGCGAAGTAGGAGGCCGG - Intergenic
1139150090 16:64371489-64371511 AAGGTCACGTAGAAGGAGGGAGG + Intergenic
1141563764 16:84887420-84887442 CAGGGCACGAAGACGGACTCCGG - Intronic
1141645914 16:85367511-85367533 AGGGCCACGAAGAAACAGGCAGG + Intergenic
1142030126 16:87834452-87834474 CAGACCCCGAAGAAGTAGACGGG + Exonic
1142194801 16:88734455-88734477 CAGGCCAGGAGGAAGAAGCCGGG + Exonic
1143085496 17:4413079-4413101 CAGGGCAGGAGGAAGGAGGACGG - Intergenic
1143266230 17:5640024-5640046 CAGGTCATGAAGCAGGTGGCAGG - Intergenic
1143756284 17:9070040-9070062 CAACCTACGAAGAAGAAGGCGGG - Intronic
1143948590 17:10615701-10615723 CAGCCTAGGAAGGAGGAGGCAGG + Intergenic
1144025762 17:11274544-11274566 AAGGCCACTCAGATGGAGGCTGG - Intronic
1145755887 17:27389846-27389868 CAGGCCAGGAGGCTGGAGGCTGG - Intergenic
1146059525 17:29597072-29597094 CAGCCCACGAGGAGGAAGGCAGG - Intronic
1146888321 17:36487022-36487044 CACGCCCCCAAGACGGAGGCTGG - Intronic
1146955001 17:36932308-36932330 CCTGCCACGAAGAAGGCCGCGGG - Intergenic
1149571437 17:57675152-57675174 CTGGTCAGGAAGGAGGAGGCAGG - Intronic
1149996966 17:61410635-61410657 CAGGCCACGCCGAATGCGGCTGG + Intergenic
1150298296 17:64027058-64027080 CAGCCCCGGAAGAAGGAGGTGGG + Intergenic
1152224830 17:79087869-79087891 CAGGCAAGGAAGATGGAGACAGG - Intronic
1152238347 17:79149856-79149878 CAGGCCCCAGAGGAGGAGGCTGG - Intronic
1152529192 17:80907065-80907087 AAGTCCACGGAGATGGAGGCGGG - Intronic
1152645224 17:81465611-81465633 CAGGCCTCGAAGCAGGGTGCTGG + Exonic
1153660670 18:7323065-7323087 CAGACCACGAAGTAGGCAGCTGG - Intergenic
1154073469 18:11176946-11176968 CAGGAGAGGAGGAAGGAGGCAGG - Intergenic
1154489910 18:14913352-14913374 CAAGCTACCCAGAAGGAGGCTGG + Intergenic
1155053118 18:22165194-22165216 CAGGCCGCGGGGAGGGAGGCCGG + Intergenic
1156727573 18:40148009-40148031 CAGGCCACGCAGCCGGAGGTGGG - Intergenic
1157289231 18:46398310-46398332 CAGGGCAGGAAGAAGGAAGCAGG + Intronic
1157545430 18:48543181-48543203 CAGGTCATGAAGGAGGAGGCAGG + Intronic
1159607445 18:70489773-70489795 GAGGCCACTAAGAAGGGGGAAGG - Intergenic
1160261193 18:77295763-77295785 CAGGCAAGGGAGAAGGTGGCTGG + Intergenic
1160503422 18:79413715-79413737 CAGGAGACGAAGAAGGAACCAGG - Intronic
1160585480 18:79911314-79911336 CAGGCCAGGAGGCAGGCGGCTGG + Intronic
1160843840 19:1158071-1158093 CAGGCTCAGAAGAAAGAGGCGGG - Intronic
1160878397 19:1308499-1308521 CAGCCCAGGGAGAATGAGGCTGG + Intergenic
1160941519 19:1622312-1622334 CCTGCCACGTAGAAGGGGGCGGG + Exonic
1161016137 19:1984626-1984648 CAGGCAATGGAGATGGAGGCTGG - Intergenic
1161534953 19:4813261-4813283 CAGGCCACATGGAAGCAGGCTGG - Intergenic
1162237784 19:9321872-9321894 GAGCCCACGGAGGAGGAGGCGGG - Intergenic
1162345539 19:10116038-10116060 CAGGCCACGCAGAACAAGACAGG - Exonic
1163300379 19:16441773-16441795 CAGGCCACTACCCAGGAGGCCGG + Intronic
1163649323 19:18508023-18508045 CAGGTCACAAATAAAGAGGCCGG + Intronic
1164648648 19:29876377-29876399 CAGGAGACACAGAAGGAGGCTGG - Intergenic
1165347423 19:35257641-35257663 CAGGCTAGGAGGAAAGAGGCCGG + Intronic
1166718524 19:44984494-44984516 CAGGCCACGAAGATTGTGTCAGG + Intronic
1166736001 19:45085251-45085273 CAGGTCACAAAGAGGGAGGAAGG - Intronic
1202711346 1_KI270714v1_random:20905-20927 CAGCCCACGTATAAGGTGGCCGG + Intergenic
925030557 2:647437-647459 CAGGCCAGGAACAAGGGTGCAGG + Intergenic
925189813 2:1874000-1874022 CAGGGCACGAAGAAAGTGACAGG + Intronic
925901724 2:8513825-8513847 CTGGGCACGAAGCAGGGGGCCGG + Intergenic
926145681 2:10395996-10396018 CAGGCAGAGAAGAGGGAGGCGGG + Intronic
926228402 2:10984437-10984459 CTGGGCACTGAGAAGGAGGCAGG - Intergenic
928669386 2:33585256-33585278 GAGGTCATGAACAAGGAGGCGGG - Exonic
929938821 2:46314961-46314983 GATGCCAGGGAGAAGGAGGCAGG + Intronic
929941220 2:46335567-46335589 AAGGCAACCAAGAAGGGGGCTGG - Intronic
931285766 2:60830338-60830360 CATGCCAGGCAGAAGGAGGAAGG + Intergenic
931757218 2:65384843-65384865 CAGGCAATGAACAAGGAGCCTGG - Intronic
932219839 2:69991000-69991022 CAGGCCACGTTTGAGGAGGCTGG - Intergenic
932441700 2:71741392-71741414 CAAGCCAGGAGGAAGGAAGCTGG + Intergenic
933895373 2:86806437-86806459 CAGGCCAAGGACAAGGAGGAAGG - Intronic
934709131 2:96503729-96503751 CAGGCCTCGTGGGAGGAGGCAGG - Intronic
937990491 2:127659449-127659471 CAGGCCACCAAGGTGGAGCCTGG + Intronic
938099708 2:128490439-128490461 CAGGCAAAGGAGAAGGAGGAAGG + Intergenic
938107390 2:128542659-128542681 CAGCCCAGAAAGAAGGAGGCTGG - Intergenic
940255619 2:151725162-151725184 AAGGCCAAGAAGCAGCAGGCTGG - Intronic
944676347 2:202036088-202036110 CAGGCCAGGACGATGGTGGCGGG - Exonic
946178440 2:217936113-217936135 CAGGCCACGTAGAGCCAGGCTGG + Intronic
948598876 2:239096940-239096962 CAGGGCAGGAGGCAGGAGGCAGG + Intronic
1171339920 20:24419817-24419839 CAGACCTAGTAGAAGGAGGCAGG + Intergenic
1173827898 20:46058852-46058874 CAGAGCACGGAGAAGGCGGCTGG - Intronic
1173898930 20:46572535-46572557 CTGGCCTAGAGGAAGGAGGCTGG - Intronic
1175665230 20:60852946-60852968 TAGGCCAAGAAGAGGGAGGAGGG + Intergenic
1175764141 20:61581458-61581480 CTGGCCATGAAGATGGAGGAGGG - Intronic
1177661927 21:24095842-24095864 TAGGTCTAGAAGAAGGAGGCTGG - Intergenic
1178781192 21:35604553-35604575 CAGGAAACGAAAAAGGAGCCTGG - Intronic
1179125073 21:38583265-38583287 TGGGGCAGGAAGAAGGAGGCAGG + Intronic
1179540617 21:42081245-42081267 GAGGCCCCGAGGAAGGAGGAGGG + Intronic
1180949241 22:19713929-19713951 CAGCCCAGGAAGAGAGAGGCCGG + Intergenic
1182082255 22:27537754-27537776 CAGGTCACGAACAACGGGGCTGG + Intergenic
1182142753 22:27976045-27976067 CAAGCGACGAAGAAGGACACTGG - Intergenic
1182285888 22:29246703-29246725 CAGGCCAGGCTGAAGGAGACTGG + Intronic
1182960202 22:34465021-34465043 CAGGCCAGGCTGAAGGTGGCAGG + Intergenic
1183361990 22:37387633-37387655 CAGCCCAGGAAGAAGGTGGCAGG - Intronic
1184215982 22:43067535-43067557 CAGGCCATGAAGAAGGGTGTAGG - Intronic
1184235093 22:43179092-43179114 CAGGCCCCATACAAGGAGGCTGG - Intronic
1184244924 22:43231073-43231095 GAGGCCATGAGGAAGGAGACAGG - Intronic
1185004556 22:48268061-48268083 CCGGCCATGAGGAAGGAGGAGGG + Intergenic
1185277323 22:49955394-49955416 CAGGACAGGAAGAATGAGGTGGG + Intergenic
951153182 3:19317019-19317041 CAAGCCACCAAGAAGTAGTCAGG - Intronic
951881178 3:27483380-27483402 CAGGCCAAGTAGAAGGAGGAGGG - Intronic
952796125 3:37241026-37241048 CAGGACACAAAAAAGGAGACAGG - Intergenic
953013889 3:39053850-39053872 CAGTGCACGTAGAATGAGGCAGG + Intronic
954691852 3:52399899-52399921 CAGGCCAGCAAGCAGCAGGCAGG + Intronic
954763774 3:52896749-52896771 AGGGCCACGGAGAGGGAGGCGGG + Intronic
954800200 3:53182933-53182955 CAGCCCTCGAAGGAGGAGCCTGG - Intronic
955387490 3:58491616-58491638 GCGGCCACCAAGACGGAGGCGGG - Intergenic
955399422 3:58581066-58581088 AAAGCCACACAGAAGGAGGCAGG - Intronic
955643864 3:61115402-61115424 AAGGCCAAGCACAAGGAGGCTGG + Intronic
956249313 3:67219095-67219117 CAGACCACCAAGCAGCAGGCTGG - Intergenic
957232315 3:77536220-77536242 CAGGCCACAAAGAAGCAGGTGGG + Intronic
958455478 3:94325913-94325935 CAAGGCAGGAAGAAGGAGGAAGG + Intergenic
959117016 3:102190504-102190526 CAGGCCGGTAAGAAGGAGGTAGG + Intronic
960753565 3:120983133-120983155 CAGGCCAGAAAGAAGCAGGCAGG - Intronic
961322114 3:126083675-126083697 CAGGCCAGGAAGGAGGAGACAGG + Intronic
961473563 3:127133620-127133642 CTGGCTTTGAAGAAGGAGGCAGG - Intergenic
965819029 3:172666216-172666238 CGGGACAGGAAGAAGAAGGCAGG - Intronic
968199534 3:196740208-196740230 CAGGCCACGGAGAAGGAAGGAGG - Intronic
968737710 4:2305959-2305981 CAGGACACGAGGAAGAAGGCAGG + Intronic
969461308 4:7330562-7330584 CATGCCAAGCAGAAGGAGCCAGG - Intronic
969480398 4:7443889-7443911 CAGGCCAGGGAGGTGGAGGCTGG - Intronic
969489334 4:7490318-7490340 CAGGCCTGGCAGAGGGAGGCAGG - Intronic
970482030 4:16485800-16485822 CAGGCCACCCAGCAGGTGGCTGG - Intergenic
971199065 4:24495452-24495474 CAGGAAAGGAAGAAGGAAGCAGG + Intergenic
971488623 4:27188010-27188032 GAGGCTAGGAAAAAGGAGGCTGG - Intergenic
975661124 4:76689720-76689742 CTGGGCACGGAGAGGGAGGCGGG + Intronic
975695416 4:77008074-77008096 CAGGCTAGCTAGAAGGAGGCAGG + Intronic
977787590 4:101056702-101056724 CAGGCAACAAATAAGGAGCCTGG + Intronic
978572786 4:110157121-110157143 AAGGCCAAGAAGAAGGAGGAGGG + Intronic
978835616 4:113146012-113146034 TAGGCCACAAAGGAGGAGGAAGG + Intronic
980726456 4:136767820-136767842 CAGGCTTTGAAGATGGAGGCAGG - Intergenic
981784497 4:148462162-148462184 CAGGCCACACAGCAGGAGGTAGG + Intergenic
982174048 4:152688740-152688762 CAGGGCACGGAGGAGGAGGAGGG + Intronic
985534340 5:455178-455200 CAGCCCATGAGGCAGGAGGCAGG + Intronic
985663159 5:1167405-1167427 CTGGCCAGGAAGCTGGAGGCAGG - Intergenic
986016440 5:3761525-3761547 AAGGCCACGGAGATGGAGGGAGG - Intergenic
986056862 5:4146738-4146760 CAGGTCATGAAGAGTGAGGCTGG - Intergenic
986393281 5:7304316-7304338 CAGGCCAGGAAGCAGTAGGCAGG + Intergenic
987075727 5:14380267-14380289 CGGGGCGCGAAGGAGGAGGCGGG - Intronic
987075733 5:14380286-14380308 CGGGGCGCGAAGGAGGAGGCGGG - Intronic
987075739 5:14380305-14380327 CGGGGCGCGAAGGAGGAGGCGGG - Intronic
992228376 5:74640584-74640606 CAGGCGCCGCGGAAGGAGGCGGG + Exonic
992627469 5:78648602-78648624 CGCGCCTGGAAGAAGGAGGCGGG + Exonic
993464356 5:88226877-88226899 GAGGCCAGGAAGATCGAGGCAGG + Intronic
996945783 5:129065939-129065961 TTGGCCATGAAGATGGAGGCAGG + Intergenic
997439234 5:133897566-133897588 CAAGCCAAGGATAAGGAGGCAGG + Intergenic
997681096 5:135751232-135751254 CAGGCCCAGGAGAAGGAGGAGGG - Intergenic
999592472 5:153163503-153163525 CAGGCCACATATAAGGAGGCAGG - Intergenic
999696554 5:154192126-154192148 CTGGCCTCGACGAAAGAGGCTGG + Intronic
999877992 5:155829577-155829599 CAGGCCTCGAAGGAGGCTGCTGG + Intergenic
1001109435 5:168883588-168883610 CAGGCCACGAGCCAAGAGGCTGG + Intronic
1001491219 5:172156769-172156791 CAGGCCAAGAATAAGGAGACGGG - Exonic
1001637964 5:173226270-173226292 CAGGCCAAGAAGAAAGCTGCTGG - Intergenic
1002065678 5:176650556-176650578 CAGGCCAAGTGGGAGGAGGCAGG + Intronic
1003141755 6:3477698-3477720 CAGGCCACACAGCAGGAGGTGGG - Intergenic
1003445491 6:6179903-6179925 CAGTCCACGAAACAGGAGTCAGG - Intronic
1003850780 6:10220450-10220472 CGGGCCACACAGCAGGAGGCGGG - Intergenic
1005083454 6:21980596-21980618 CAGAGCAGGAAGAAGGAGGCAGG - Intergenic
1005083485 6:21980766-21980788 CAGAGCAGGAAGGAGGAGGCTGG - Intergenic
1005083585 6:21981319-21981341 CAGCTCAGGAAGGAGGAGGCAGG - Intergenic
1005083640 6:21981642-21981664 CAGCACAGGAAGGAGGAGGCAGG - Intergenic
1005083678 6:21981824-21981846 CAGTGCAGGAAGGAGGAGGCAGG - Intergenic
1005083684 6:21981850-21981872 CAGATCAGGAAGGAGGAGGCAGG - Intergenic
1005396942 6:25392566-25392588 CAGTCCAGGAAGAAGCAAGCAGG - Intronic
1010198737 6:73264434-73264456 CAGTACAGGAACAAGGAGGCAGG + Intronic
1010832838 6:80552158-80552180 CAGGCCACAAAGCAGGAAACAGG + Intergenic
1013226153 6:108120447-108120469 CTGGCCACTAACAAGGAGGTAGG - Intronic
1013551679 6:111213794-111213816 CAGGCCACACAGCAGGTGGCTGG - Intronic
1014592962 6:123295019-123295041 CAGGAAATGAGGAAGGAGGCAGG + Intronic
1015889513 6:137955486-137955508 CAGGGCAAGAAGAAGAGGGCGGG + Intergenic
1015894936 6:138007999-138008021 CAGGCGACGAAGTAGGAGTGGGG + Intergenic
1016680624 6:146825039-146825061 CAGTCCCCAAACAAGGAGGCGGG + Intergenic
1017037627 6:150280624-150280646 CAGCTCATTAAGAAGGAGGCAGG + Intergenic
1018873393 6:167799846-167799868 GGGGCCACGAGGAAGGAGGGAGG + Intergenic
1019355535 7:576909-576931 CAGGCCGAAAAGCAGGAGGCTGG - Intronic
1019404927 7:877960-877982 AAGGCCAGGAGGAGGGAGGCAGG - Intronic
1019488240 7:1299253-1299275 CAGGCCACGGAGGGGGACGCAGG - Intergenic
1019539474 7:1545340-1545362 CAGCCCAGGAAGCAAGAGGCTGG + Exonic
1019993484 7:4708358-4708380 CAGCCCTGGATGAAGGAGGCCGG - Intronic
1021566060 7:22017581-22017603 CAGGTCAGGAAGAAGAAGGGAGG - Intergenic
1022555855 7:31295186-31295208 CAGACCAAGAGAAAGGAGGCAGG + Intergenic
1022605724 7:31811924-31811946 CACTCCACAAAGAAGGGGGCTGG + Intronic
1022944627 7:35270022-35270044 CAGGTCACTCAGAAGGAGCCAGG - Intergenic
1024073813 7:45808448-45808470 CATGCCACCAGGAAGAAGGCAGG - Intergenic
1026878473 7:73893523-73893545 CAGCCCCCGCAGGAGGAGGCTGG + Intergenic
1028994629 7:97086162-97086184 CAGGGCAGGTAGAGGGAGGCAGG + Intergenic
1029686466 7:102151787-102151809 CAGACCAGGACCAAGGAGGCGGG - Intronic
1030303014 7:107993011-107993033 CATGCCAAGAAGGAGCAGGCAGG + Intronic
1033460315 7:141541608-141541630 GAGCCCAGGGAGAAGGAGGCAGG - Intergenic
1035118000 7:156540921-156540943 CAGGCCAGGAAGCAGGTGGCAGG + Intergenic
1035998990 8:4580613-4580635 GATGCCACGAAGAAGAAGGAGGG - Intronic
1036597590 8:10228066-10228088 CAGGCCACCAAGATGGTGTCTGG + Intronic
1036685234 8:10905053-10905075 CAAGCCAGGAAGAAGGAGCTGGG - Intronic
1037953992 8:23039231-23039253 CAGGCCACACAGCAGGAGGTGGG - Intronic
1038275506 8:26117667-26117689 CTGGCCCCAAAGAAGAAGGCTGG - Intergenic
1038780047 8:30562404-30562426 CAGGCTCCGAGGAAGGAGTCTGG - Intronic
1039774080 8:40718645-40718667 GAGGGAAAGAAGAAGGAGGCTGG - Intronic
1041215529 8:55596382-55596404 CAGGGCAGGAGGAAGGAGGCAGG - Intergenic
1041567274 8:59293115-59293137 CAGGCCAAGAAGAAGGGGGAAGG + Intergenic
1044543286 8:93431369-93431391 CAGGCAAGGAAAAAGGAGGCAGG + Intergenic
1048865294 8:138756356-138756378 GAGGCCAAGGAGGAGGAGGCAGG - Intronic
1049158902 8:141084783-141084805 CAGGCCACGCTGAAGGTGGGCGG + Intergenic
1049494613 8:142923917-142923939 CAGCCCACCCACAAGGAGGCTGG + Intergenic
1050106355 9:2170342-2170364 CAGCCTAGGAAGAAGGAGCCGGG + Intronic
1053785591 9:41650480-41650502 CAGGCCTCAGAGAAGGAGGGCGG + Intergenic
1054174310 9:61864446-61864468 CAGGCCTCAGAGAAGGAGGGCGG + Intergenic
1054449168 9:65393491-65393513 CAGGCCTCAGAGAAGGAGGGCGG + Intergenic
1054663228 9:67716345-67716367 CAGGCCTCAGAGAAGGAGGGCGG - Intergenic
1055398018 9:75893378-75893400 CATGCCATGATGAAGGAGGAAGG + Intronic
1055791660 9:79929067-79929089 CTGGGCATGAAGAAGGAGGTGGG - Intergenic
1055805527 9:80088869-80088891 CAGGCCACAGAGATGGAAGCGGG + Intergenic
1056691327 9:88811004-88811026 AAGGCCACGTATAAGGAGGAGGG - Intergenic
1056769576 9:89467145-89467167 GTGGCCACCAGGAAGGAGGCAGG - Intronic
1057707619 9:97407984-97408006 CTGGCCACTAAGCAGAAGGCTGG - Intergenic
1060879967 9:127111195-127111217 CAAACAACGAAGAAGGGGGCAGG - Intronic
1060985160 9:127815529-127815551 CAGGCCTCTGAGAGGGAGGCGGG + Exonic
1061927786 9:133814553-133814575 CAGGCCAGGTGGAAGGAGGGGGG + Intronic
1061958087 9:133973981-133974003 CAGGCCAGGAAGGTGGGGGCTGG + Intronic
1062366907 9:136214553-136214575 CAAGCCACGTGCAAGGAGGCAGG + Intronic
1187467552 X:19540569-19540591 CAAGCCACGTAGAGGGAGGCAGG + Intronic
1187492556 X:19765435-19765457 CTGGCCTCGAAGATGGAGGAAGG - Intronic
1188620745 X:32220105-32220127 CAGGCCCACAAGAGGGAGGCAGG + Intronic
1189454803 X:41176260-41176282 CAGACCATGAAGGAGGAGGAGGG - Intronic
1189481339 X:41394445-41394467 CAGGCACAGAAGAAGGAGGAGGG + Intergenic
1191824779 X:65353106-65353128 CTGAGCACTAAGAAGGAGGCCGG - Intergenic
1194744347 X:97612040-97612062 CAGGGCACGTGGCAGGAGGCAGG + Intergenic
1195068995 X:101261693-101261715 CAGGCCACAAATCAGGAAGCTGG + Exonic
1195128568 X:101832462-101832484 AGGGCCAAGAAGATGGAGGCGGG - Intronic
1196288486 X:113911219-113911241 CAGTCCTCTAAGAAGGATGCAGG - Intergenic
1198497721 X:137209786-137209808 CAGGTCCAGAAGCAGGAGGCGGG + Intergenic
1199698676 X:150361529-150361551 CAGGCCACGAATAAAGGGGTGGG - Intronic
1200887219 Y:8281671-8281693 CTGGCCAAGAAGGAGGAGGATGG - Intergenic