ID: 914902115

View in Genome Browser
Species Human (GRCh38)
Location 1:151716484-151716506
Sequence AGGGGGGCCCACTCCTGATG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 142}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914902108_914902115 5 Left 914902108 1:151716456-151716478 CCTGCTATGGTTGCCAGCAGCGT 0: 1
1: 0
2: 1
3: 1
4: 55
Right 914902115 1:151716484-151716506 AGGGGGGCCCACTCCTGATGTGG 0: 1
1: 0
2: 0
3: 9
4: 142
914902114_914902115 -8 Left 914902114 1:151716469-151716491 CCAGCAGCGTCAGTAAGGGGGGC 0: 1
1: 0
2: 0
3: 1
4: 76
Right 914902115 1:151716484-151716506 AGGGGGGCCCACTCCTGATGTGG 0: 1
1: 0
2: 0
3: 9
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914902115 Original CRISPR AGGGGGGCCCACTCCTGATG TGG Exonic
901160670 1:7174595-7174617 TGGGGGGACCACTTCTGAGGGGG + Intronic
901217631 1:7563511-7563533 AGCTGGGCCCACTCCACATGAGG - Intronic
901627109 1:10630589-10630611 ATGGGGGCTCACTCCGGAGGAGG + Exonic
902764513 1:18605587-18605609 AGGTGGGCCCACAACTGCTGTGG - Intergenic
903614746 1:24643536-24643558 AGGGGGGACCATTCCGGAGGAGG - Intronic
904301178 1:29555919-29555941 AGGGGTCCCCACTGATGATGGGG + Intergenic
913237271 1:116795768-116795790 AGGGGGGAACACTCCTTAGGAGG + Intergenic
914902115 1:151716484-151716506 AGGGGGGCCCACTCCTGATGTGG + Exonic
915102314 1:153509266-153509288 ATGAGGGCTCAGTCCTGATGAGG - Intergenic
915296522 1:154925335-154925357 GGGAGGGCCCACTCCAGTTGGGG - Intronic
915315968 1:155029480-155029502 AGACGGGCCCACACCTGATTAGG - Intronic
917973058 1:180220662-180220684 AGGTGGGCCCATTGCTCATGTGG + Intergenic
920195454 1:204223413-204223435 AAGGGGCCCCACTCCCGAGGTGG + Intronic
922822589 1:228494401-228494423 AGGGGGGCCGCCTCCTCAGGAGG - Exonic
923219831 1:231883074-231883096 ACAGGCGCCCACTGCTGATGTGG + Intronic
923337113 1:232979927-232979949 ATGGGGTCCCACTCCAGCTGGGG - Exonic
924758321 1:246962268-246962290 ATGAGGGCCCAGTGCTGATGGGG - Intronic
1062768124 10:80682-80704 ATGGGGGCCCAGTCCTCCTGTGG + Intergenic
1062969175 10:1633019-1633041 AGGGAGGCCCACTCCAGCAGAGG - Intronic
1064590335 10:16883719-16883741 ATCTGGGCCCACTCCTGTTGGGG + Intronic
1065857523 10:29842325-29842347 AGTGGGTCCCACCCCTGATGGGG - Intergenic
1068070024 10:52183679-52183701 AGGAGGGCATACTCCAGATGTGG + Intronic
1069882924 10:71604767-71604789 AAAGGGGCCCAGTCCTGCTGAGG - Intronic
1071148846 10:82608892-82608914 AGGGAGGCCCAGTCCTGAGGGGG - Intronic
1074116435 10:110460406-110460428 AGGGATGCCCATTCCTGCTGGGG - Intergenic
1075021593 10:118956428-118956450 AGAGGGGCCCAAGCCTGCTGGGG + Intergenic
1076242195 10:128916941-128916963 AGGGTGGCGCCCTCCTGCTGCGG - Intergenic
1077534929 11:3119489-3119511 AAGGGGGCCCACTTCAGGTGGGG + Intronic
1078448107 11:11420219-11420241 AGGGGAGCCCATACCTGCTGTGG + Intronic
1078565094 11:12407844-12407866 AGGGAGACCTACTCCTTATGAGG - Intronic
1081775298 11:45672005-45672027 AGGGCTGACCACACCTGATGGGG - Intergenic
1084566146 11:69930227-69930249 AGGTGAGGCCACTGCTGATGGGG - Intergenic
1084887268 11:72218898-72218920 AGGGGGGCCCTCCCCGGAGGTGG + Intronic
1088855192 11:113743989-113744011 AGAGTTACCCACTCCTGATGAGG - Exonic
1089151584 11:116368633-116368655 ATGGAAGCCCACTCCTGCTGGGG - Intergenic
1091403943 12:197386-197408 AGGGGTGCCCATTTCTGAAGTGG - Exonic
1095692917 12:45110917-45110939 AGGAGGGCCCACTCTTAATCTGG + Intergenic
1095966010 12:47867597-47867619 AGTGGGGCCTACTCCTGCTGGGG - Intronic
1096746152 12:53728174-53728196 GGGGGAGCCCAGTCCAGATGTGG - Intergenic
1098699448 12:73606144-73606166 AGGGGCGCCCACTATTGCTGAGG + Intergenic
1099795464 12:87394380-87394402 AGGGGGGCCCACAATTGCTGAGG + Intergenic
1101380203 12:104207781-104207803 AGGGTGGCCCACAGGTGATGTGG + Intergenic
1103727401 12:123004945-123004967 AGGGGCCACCCCTCCTGATGGGG - Intronic
1104439760 12:128785236-128785258 AGGGTGGCACCCTCGTGATGGGG + Intergenic
1105255816 13:18743565-18743587 AGGGAGTCCCACTTCAGATGTGG - Intergenic
1111457505 13:88504237-88504259 ATGGGAGCCCATTCCTGATTTGG + Intergenic
1111850329 13:93565281-93565303 AGTGGGGCCAACACCTGCTGAGG - Intronic
1112692944 13:101916787-101916809 AGGGGGGCTCAGTCCTGACCGGG + Intronic
1118094514 14:62521529-62521551 AGGGGTGCCCACCATTGATGAGG + Intergenic
1121150266 14:91626687-91626709 TGGGGGGCCCACATCTGGTGAGG - Intronic
1122278653 14:100608887-100608909 GGGGGGTCCCACTGCTGGTGAGG - Intergenic
1122631244 14:103108726-103108748 AGGCGTGCCCACCCCTGGTGGGG - Intronic
1125553967 15:40569249-40569271 AGGGAGGCCCAGTCCCGAGGCGG - Intergenic
1126824942 15:52539648-52539670 ATGGGGTCCCTCTCATGATGTGG + Intergenic
1128304309 15:66588083-66588105 AGGGGAGCTCATTCCTGCTGGGG + Intronic
1129724175 15:77893306-77893328 AGAGGGGCCCACCCCTGAGTAGG + Intergenic
1131818133 15:96244151-96244173 AGGGCGCCCCAGTCCTGAAGGGG + Intergenic
1132997291 16:2829922-2829944 CGTGGGGCCCACTCCTGCCGTGG - Intergenic
1134841440 16:17405148-17405170 AAGGGAGCCAACTCCTGCTGAGG + Intronic
1135436074 16:22427607-22427629 AGGAGGGCCCTCACCTGCTGCGG + Intronic
1136595202 16:31244123-31244145 AGGGAGGCCCACTCCTCAATGGG + Intergenic
1137503429 16:49029119-49029141 AGGGGGGCCCACCATTGCTGTGG + Intergenic
1137680889 16:50343754-50343776 AGGGGCGCCCACCACTGCTGAGG + Intronic
1139598336 16:67970668-67970690 AGGGCAGCCCAGTCCAGATGAGG - Intergenic
1141164114 16:81648917-81648939 ATGAGGGCTCACTCCTGCTGGGG - Intronic
1141523307 16:84595594-84595616 AGGGCTCCCCACTGCTGATGTGG - Intronic
1142045282 16:87921419-87921441 AGGAGGGCCCTCACCTGCTGCGG + Intronic
1142265382 16:89061996-89062018 AGGGGTTCCCACTCCTCGTGGGG - Intergenic
1142266757 16:89067507-89067529 AGGCTGGCCCTGTCCTGATGCGG + Intergenic
1148159292 17:45441070-45441092 CAGGGGGCCCCATCCTGATGGGG + Intronic
1148744004 17:49908398-49908420 AGGGAGGCCCTCCCCTGAAGGGG + Intergenic
1149562786 17:57620721-57620743 AGGAGGGCCCAGGGCTGATGAGG - Intronic
1152142950 17:78549222-78549244 AGTAGGGCCCACCCCTGATGAGG + Intronic
1160293658 18:77618044-77618066 AGGGAGGAGCACTTCTGATGTGG + Intergenic
1160877300 19:1302682-1302704 ACGGGGGCCGCCTCCTAATGAGG + Intergenic
1161153441 19:2721058-2721080 AGGGGGGCGCCCTCCGGGTGGGG + Intronic
1162567626 19:11453066-11453088 GGGGAGGCCCAGTCCTGGTGGGG + Exonic
1163664339 19:18596013-18596035 AGGGGAGACCACTGCTGGTGGGG + Intronic
1166985798 19:46659583-46659605 GGGGGGTCCCACTCCTGAGAGGG + Intronic
1167605367 19:50479050-50479072 AGCGGGGCCGACTCCGGGTGAGG + Exonic
925982914 2:9191540-9191562 AGGGGGGCCCACTCTTGTCGGGG + Intergenic
928921133 2:36529204-36529226 AGGTGGGCCCTCTTGTGATGGGG - Intronic
929829617 2:45336320-45336342 AAGGGGGCCCAGTCCTGACTTGG + Intergenic
931463215 2:62466062-62466084 AGTGGGGACCCCTCCTGATTTGG - Intergenic
934530394 2:95083528-95083550 AGAGGGACCCAGTCCTGGTGGGG + Intergenic
935763673 2:106343746-106343768 GGAGGGGCCCACTCAGGATGTGG - Intergenic
945576748 2:211540433-211540455 AGGGGGAACGACACCTGATGGGG + Intronic
947966157 2:234283166-234283188 AGGGAGGCCCATGCCTGAGGAGG - Intergenic
948025886 2:234775900-234775922 AGGGGGGCCCACCATTGCTGAGG + Intergenic
948940184 2:241191440-241191462 AAGGGGGCTCCCTACTGATGGGG + Intronic
1169500783 20:6158380-6158402 AGGGCAGCCCACTCTTGCTGTGG - Intergenic
1170473463 20:16691044-16691066 ACTGGGGCTCACTCCTGTTGGGG + Intergenic
1172899225 20:38321546-38321568 AGTGGGACCCACTCTTGCTGGGG - Intronic
1181167973 22:20993424-20993446 AGGGGAGCCCTTTCCTGCTGTGG + Intronic
1182979090 22:34651293-34651315 AGTGGAGCACACTCCAGATGAGG - Intergenic
1183861465 22:40673420-40673442 AGGGGGGCCCTCAGCTGCTGGGG - Intergenic
1184424761 22:44402956-44402978 TGGGGGCCCCACACCTGAGGAGG + Intergenic
1184753570 22:46503084-46503106 GGGGAGGCTCTCTCCTGATGAGG + Intronic
949511452 3:4770554-4770576 AGTGGGGGCCCCTCCAGATGAGG + Intronic
951147866 3:19251135-19251157 AGGGGGGCACCCTCCTACTGGGG - Intronic
952931828 3:38366364-38366386 AGGGTTGTCCAGTCCTGATGTGG + Intronic
953634850 3:44654152-44654174 AAGGGAGCCCATTCCTGATGAGG - Intronic
954751594 3:52817171-52817193 AAGGGGCACCCCTCCTGATGAGG - Intronic
955673796 3:61429166-61429188 AGCGGTGCCCACTCCGGAAGTGG + Intergenic
956404317 3:68912147-68912169 AGAGGAGCCCACTCCTAAAGGGG + Intronic
956795596 3:72716037-72716059 AGGGGCGCCCACTATTGCTGAGG - Intergenic
961480619 3:127177498-127177520 AGGGTGGCCATCTCCTGTTGAGG - Intergenic
963107046 3:141656345-141656367 GGGGTGACCCACTCCTGATGTGG - Intergenic
964588112 3:158329922-158329944 AGGGGTGCCCACCGCTGCTGAGG - Intronic
968490863 4:889908-889930 ACAGGTGCCCACTCCTCATGCGG + Intronic
981925213 4:150131819-150131841 AGGGAGGCTCACTTCTGCTGAGG - Intronic
982167485 4:152627925-152627947 AGGGGTCCACAGTCCTGATGAGG - Exonic
983709333 4:170694648-170694670 ATGGGGGCCAAATCCTGGTGAGG - Intergenic
984869677 4:184315165-184315187 ACGAGGGCCCACTCTTGCTGTGG - Intergenic
985651076 5:1107880-1107902 AGGGGCTCCCTCTCCTGGTGTGG - Intronic
987740381 5:21900636-21900658 AGGGTGGCCCATTTCTGATTTGG + Intronic
990194930 5:53303894-53303916 GGAGGGGCCCACGTCTGATGAGG - Intergenic
993857411 5:93093651-93093673 AGAAGGGCTCATTCCTGATGTGG - Intergenic
997464485 5:134078269-134078291 AGGGAGACCCACTCCAGCTGTGG + Intergenic
999864324 5:155684327-155684349 TGGGGGACCCACCCCTGATCTGG - Intergenic
1001656957 5:173358423-173358445 AGAGGTGCCTACTCCTGCTGGGG - Intergenic
1002182223 5:177436534-177436556 AGTGCAGCCCACTCCTGCTGAGG + Intronic
1006454189 6:34122649-34122671 AGGGGGGTCCACCCCTGCTGCGG + Intronic
1007617131 6:43186770-43186792 GGCAGGGCCCACTCCTGATAAGG + Intronic
1008537519 6:52518149-52518171 AGTGGGGCCCTCGCCTGCTGTGG - Intronic
1009851576 6:69206321-69206343 AGGGAGGCCCACTCTTAATCTGG - Intronic
1015044212 6:128759686-128759708 AGGAGGGCACACTCCAGAGGTGG - Intergenic
1022338593 7:29446897-29446919 AGTGTGGCCCACTCCTGAGATGG - Intronic
1022435716 7:30382417-30382439 AGGGGAGTTCACTCATGATGTGG + Intronic
1022660778 7:32364731-32364753 AGGAGGGCACACTCCAGAGGTGG - Intergenic
1025146739 7:56512099-56512121 AGGGGAGCCCACTGCTGCTAAGG - Intergenic
1027339469 7:77190608-77190630 GGGGGGGCCCACTCATGTTTGGG + Intronic
1029803877 7:102976580-102976602 AGGGGGGCTAACTACAGATGGGG - Intronic
1048433247 8:134390346-134390368 AGGAGGCCACACTCCTGAGGTGG - Intergenic
1048895101 8:138985158-138985180 AGGAGGGCCCACTCACAATGTGG + Intergenic
1049675177 8:143886016-143886038 AGGGGCGCCCACTCCTGCGCTGG - Intergenic
1052849559 9:33368667-33368689 AGGGGTGCCTACTCCTGTTCTGG + Intronic
1055660734 9:78501560-78501582 AGGAGTGCCCAATCCTGAGGGGG + Intergenic
1059841930 9:118227120-118227142 AGAGGGGCTCAATCCTGAAGTGG + Intergenic
1062235749 9:135506774-135506796 ATGTGGGCCCTCTGCTGATGTGG + Intergenic
1062235753 9:135506791-135506813 ATGTGGGCCCTCTGCTGATGTGG + Intergenic
1062235757 9:135506808-135506830 ATGTGGGCCCTCTGCTGATGTGG + Intergenic
1062252332 9:135604631-135604653 TGGGGGACACACTCCTCATGAGG + Intergenic
1062527518 9:136984324-136984346 AGGTGGGGACACTCCTGCTGGGG - Intronic
1203428974 Un_GL000195v1:71457-71479 AGGGAGGCCCACTCTTAATTGGG + Intergenic
1186854290 X:13611012-13611034 AGTGGGGCTCAGTCCTGCTGGGG - Intronic
1187610636 X:20939325-20939347 ACTGGGGCCCTATCCTGATGTGG + Intergenic
1189745352 X:44162863-44162885 TGAGGGGCCCACTACTGATGGGG - Intronic
1192988801 X:76428491-76428513 CGTGGTGCCCACCCCTGATGAGG + Exonic
1198399070 X:136251873-136251895 AGGGAAGCCTACTCATGATGGGG - Intronic
1199996716 X:153030634-153030656 GGGGGGCCCCGATCCTGATGTGG - Intergenic
1201522237 Y:14888221-14888243 AGGGGCGCCCACCACTGCTGAGG - Intergenic