ID: 914904167

View in Genome Browser
Species Human (GRCh38)
Location 1:151730240-151730262
Sequence ACAGAAGCCCAGACCAAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 277
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 245}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914904164_914904167 16 Left 914904164 1:151730201-151730223 CCTCTCACCTGTGCGTTATTTGT 0: 1
1: 0
2: 1
3: 7
4: 109
Right 914904167 1:151730240-151730262 ACAGAAGCCCAGACCAAAGCAGG 0: 1
1: 0
2: 1
3: 30
4: 245
914904165_914904167 9 Left 914904165 1:151730208-151730230 CCTGTGCGTTATTTGTCAACATC 0: 1
1: 0
2: 0
3: 3
4: 56
Right 914904167 1:151730240-151730262 ACAGAAGCCCAGACCAAAGCAGG 0: 1
1: 0
2: 1
3: 30
4: 245

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914904167 Original CRISPR ACAGAAGCCCAGACCAAAGC AGG Intergenic
900288890 1:1915499-1915521 GGGGAAGCCCAGGCCAAAGCGGG + Intronic
900502374 1:3012708-3012730 CCAGGAGCCCAGACCCAGGCGGG - Intergenic
900942658 1:5811000-5811022 TCAGAAGCCCAGGACAAAGCTGG - Intergenic
903170444 1:21549171-21549193 ACAGAAGCCCTCAGCAAACCAGG - Intronic
905020347 1:34806570-34806592 ACAGAATCCAAGAACAGAGCAGG + Intronic
905042766 1:34973884-34973906 ACAGAAGTCCAGACTCAAGAAGG + Intergenic
905212367 1:36383431-36383453 AGAGAAGCCCAGGCCAATGCAGG + Intronic
906517387 1:46447825-46447847 ACAGACACCCAGACCTGAGCAGG - Intergenic
909294887 1:73935001-73935023 AGAGAAGTGCAGACCAAAGCGGG - Intergenic
909605247 1:77501260-77501282 ACTGAAGACCAGTCCAGAGCTGG + Intronic
911843367 1:102714431-102714453 ACACAAGCCCAATCAAAAGCTGG + Intergenic
911924614 1:103813960-103813982 AAAGAAGCCCTGACCACATCAGG + Intergenic
912301858 1:108526086-108526108 ACAGAAGCCCAGGGCTGAGCTGG + Intergenic
914333874 1:146697866-146697888 CCAGAAGCACAGAGCAAATCTGG - Intergenic
914904167 1:151730240-151730262 ACAGAAGCCCAGACCAAAGCAGG + Intergenic
916257656 1:162806304-162806326 ACAGAGGCCAAGATCAATGCCGG - Intronic
917121528 1:171648523-171648545 ACAGGAGACCAGTCCAAAGCAGG + Intronic
918463758 1:184801240-184801262 ACTGTAGCCCAGATCACAGCGGG + Intronic
921541582 1:216422978-216423000 ACAGATGCCCAAAATAAAGCTGG + Intronic
922752138 1:228075235-228075257 AAAGATGCCCTGAACAAAGCAGG - Exonic
923437052 1:233977182-233977204 ACACAAGCCCAGAGAGAAGCAGG - Intronic
1063484845 10:6410209-6410231 ACAGATCATCAGACCAAAGCAGG - Intergenic
1064012238 10:11743732-11743754 ACAGGAGCACAGGCCAGAGCAGG + Intronic
1067684321 10:48457820-48457842 ACAGAAGCCAACACCCCAGCAGG + Intronic
1069036850 10:63654759-63654781 AGAGAAGTGCAGAGCAAAGCGGG - Intergenic
1069062614 10:63910001-63910023 CCAGAAGCACAGACTAGAGCAGG - Intergenic
1069612757 10:69786161-69786183 ACAGAGGGCCTGACCAAACCTGG + Intergenic
1069910141 10:71753973-71753995 ACTGAGGCTCAGTCCAAAGCAGG + Intronic
1069914500 10:71779205-71779227 ACTGAGGCCCAGCACAAAGCTGG + Intronic
1070671482 10:78380540-78380562 ACAGCAGCTGGGACCAAAGCTGG - Intergenic
1074599455 10:114899073-114899095 AGTGAAGCCCAGCCCTAAGCTGG + Intronic
1075453379 10:122568763-122568785 ACCCAAGCCCTGACCAAAGTGGG - Intronic
1078010739 11:7571224-7571246 AAAGAAACCCAGACCCAGGCTGG + Intronic
1078525894 11:12100998-12101020 ACAGGATCCCAGAACAAAGTGGG - Intronic
1078794123 11:14574670-14574692 AAAGAAGTGCTGACCAAAGCAGG - Intronic
1079809995 11:24985739-24985761 ACAGAAACCCAAAACATAGCAGG - Intronic
1080250240 11:30225782-30225804 GCAGAAGCTCAAACCACAGCTGG + Intergenic
1081762113 11:45583966-45583988 GAAGAAGCCGAGTCCAAAGCAGG + Intergenic
1082095890 11:48129064-48129086 ACAGAAGCCCAGTGCTAGGCAGG + Intronic
1083450155 11:62738780-62738802 TCAGAAGCCCAAACCAAAGTGGG + Intronic
1083762388 11:64825745-64825767 ATAGAGGCCCAGTCCACAGCAGG - Intronic
1083789871 11:64977511-64977533 ACAGAAGCCAAGACACAAGGAGG + Intergenic
1084044014 11:66558703-66558725 ACAGAAGACCAGAGCAGGGCTGG - Intronic
1084589478 11:70082118-70082140 ACAGAAGCTGAGACCCAGGCAGG - Intronic
1085736318 11:79042314-79042336 ACAGAAATTCAGACCATAGCAGG - Intronic
1086285852 11:85250065-85250087 ACAGGGGCCCAGCCCAAAGGAGG + Intronic
1088231289 11:107676068-107676090 AGAGGAGGACAGACCAAAGCTGG - Intergenic
1088469915 11:110180360-110180382 AATGAATCCCAGCCCAAAGCTGG - Intronic
1088545701 11:110956612-110956634 ACAGAAGCCCAGAATATTGCAGG + Intergenic
1089296572 11:117472476-117472498 ACAGAAGCACACACAAAAGGAGG - Intronic
1089812560 11:121143865-121143887 CCAGTAGCCCAGGCTAAAGCTGG - Intronic
1089976043 11:122732254-122732276 ACAGGAGAACAGACCAAGGCCGG + Intronic
1091132808 11:133160722-133160744 AAAGAATCCCAGGCCAAATCTGG - Intronic
1092758685 12:11789454-11789476 GCTGAAGCCCAGACCGAAGCAGG - Intronic
1095905239 12:47370416-47370438 ACAGAAACCCTCACAAAAGCTGG - Intergenic
1096626218 12:52897649-52897671 ACAGAAGCCCACCCCATGGCAGG + Intronic
1098269523 12:68756324-68756346 AAAGAAACCAAGACCACAGCAGG + Intronic
1100086542 12:90917709-90917731 AAAGAAGCCCAGACCGAGGTAGG - Intronic
1101239781 12:102826216-102826238 AGAGAAGTGCAGAGCAAAGCGGG + Intergenic
1102650201 12:114436495-114436517 AGCTAAGTCCAGACCAAAGCAGG - Intergenic
1102790371 12:115639494-115639516 CCAGAAACCCAGACCACAGGTGG + Intergenic
1104630771 12:130400191-130400213 ACACCAGCCCAGACCAATGATGG + Intronic
1104831717 12:131757141-131757163 ACAGAAGCAAAGGCCAGAGCAGG + Intronic
1105211832 13:18261555-18261577 ACAGGAGACCAGCACAAAGCAGG + Intergenic
1105284590 13:18993902-18993924 ACAGAAGGCCAGAAAACAGCAGG + Intergenic
1108154460 13:47571548-47571570 AGAGAAGTTCAGAGCAAAGCAGG - Intergenic
1108718939 13:53110291-53110313 ACAGAAGCCCCAAACAAACCAGG - Intergenic
1109437752 13:62328321-62328343 AGAGCAGCCCAGAGCACAGCTGG + Intergenic
1109853600 13:68101242-68101264 GGAGAAGTCCAGAGCAAAGCAGG + Intergenic
1111627508 13:90808185-90808207 AGAGAAGCGCAGAGCAAAGGGGG + Intergenic
1112375320 13:98834638-98834660 ACACAATCCCAAACCAATGCTGG - Intronic
1112433443 13:99373366-99373388 AAATAAGACTAGACCAAAGCTGG + Intronic
1112444843 13:99454600-99454622 CCAGTAGACCAGACCAAACCAGG + Intergenic
1113839188 13:113348992-113349014 ACAGAATGCCAGAGCACAGCTGG - Intronic
1114773501 14:25455540-25455562 ACAGAAACCCAAACCACATCAGG - Intergenic
1115653363 14:35419833-35419855 ACAGAATGCCAGATCAATGCTGG + Intergenic
1116172670 14:41422931-41422953 ACAGAAGTCCTGACCCAGGCTGG - Intergenic
1117013588 14:51495402-51495424 ACAAAAGTTCAGACCATAGCAGG + Intronic
1117605012 14:57419617-57419639 ACAGATGCCCGGTCCAGAGCAGG - Intergenic
1120030526 14:79635866-79635888 ATAGAAGTGCAGACCAAAGGGGG + Intronic
1121235160 14:92386795-92386817 CCAGCAGCCCAGGCCACAGCCGG - Intronic
1121565924 14:94908924-94908946 CCAGAAAACCAGACCCAAGCAGG + Intergenic
1121958210 14:98234124-98234146 AAATAAGACCAGACAAAAGCAGG + Intergenic
1122231457 14:100308049-100308071 AGAGAAGCCCAGACCCAAAAGGG + Intergenic
1122310963 14:100793912-100793934 ACTGCATCCCAGAACAAAGCTGG + Intergenic
1122829412 14:104388452-104388474 ACAGAATCCCAAACCAGAGCCGG - Intergenic
1124187968 15:27546535-27546557 ACAGAATCTCAGGCCAAGGCGGG + Intergenic
1126297232 15:47153883-47153905 CCAGAAGCCCAGACAAATGCTGG + Intergenic
1127880826 15:63157356-63157378 AAAGAAGCCCAAAACAAACCCGG + Intronic
1128951409 15:71887137-71887159 ACAGAATCCAAGTCCAAAGCTGG + Intronic
1129177014 15:73847556-73847578 AGAGAAGTGCAGAGCAAAGCGGG - Intergenic
1129303453 15:74640657-74640679 ACAGAAACCAAGTCCAAACCGGG + Intronic
1129391769 15:75224304-75224326 ACAGAAGCCCGCCCCAAAGAGGG - Intergenic
1129472542 15:75763555-75763577 ACAGAAGCCCGCCCCAAAGAGGG + Intergenic
1130300380 15:82676088-82676110 AAAGAAGCACAGACCACATCTGG + Intronic
1130557554 15:84933399-84933421 AATGAAGCCCAAACCAGAGCAGG - Intronic
1131201668 15:90402500-90402522 ACAGAAGCCAAGCCCTAGGCTGG - Intronic
1132894779 16:2223656-2223678 GCAGAAGCCCAGGCCGAAGCCGG + Exonic
1133528482 16:6630089-6630111 ACAGAAGCTTAGACCAAGGAGGG - Intronic
1134452979 16:14374671-14374693 ACAGGACCCAAGCCCAAAGCGGG + Intergenic
1134773661 16:16832993-16833015 GCAGTAACCCAGACAAAAGCAGG + Intergenic
1135304146 16:21354549-21354571 ACAGAAGCCCCGAGCAGTGCGGG + Intergenic
1135304182 16:21354679-21354701 ACAGAAGCCCCGAGCAGTGCGGG + Intergenic
1137518321 16:49169854-49169876 ACTGAAGACCAGACTAAAGAGGG + Intergenic
1139999744 16:71013383-71013405 CCAGAAGCACAGAGCAAATCTGG + Intronic
1140042099 16:71414908-71414930 ACAGAAGCCCTGGGAAAAGCAGG - Intergenic
1141762599 16:86038642-86038664 AGGGAAGCCCAGGCCAATGCGGG - Intergenic
1142062605 16:88040481-88040503 ACAGAAGCCCCGAGCAGTGCGGG + Intronic
1142062623 16:88040545-88040567 ACAGAAGCCCCGAGCAGTGCGGG + Intronic
1142315217 16:89339875-89339897 ACACAAGCCTACACCAAAGCCGG + Intronic
1143982024 17:10878431-10878453 ACCATAGCCCAGACCCAAGCAGG + Intergenic
1147769611 17:42858429-42858451 CCAGAAGCCCAGGCCAGGGCAGG + Intergenic
1148733764 17:49852941-49852963 AGAAATGCCAAGACCAAAGCAGG - Intergenic
1148854906 17:50573352-50573374 ACAGAGGCCCAGAGCAGTGCTGG - Intronic
1148913652 17:50956830-50956852 ACAGCAGGCCAGACCAAGGAGGG - Intergenic
1151547382 17:74801399-74801421 TCACAACCCCACACCAAAGCTGG - Intronic
1151547398 17:74801488-74801510 TCACAACCCCACACCAAAGCTGG - Intronic
1152503086 17:80726120-80726142 ACAGAGGCCCACATCCAAGCAGG + Intronic
1152928071 17:83096975-83096997 ACAGGTGCCCAGCCCACAGCGGG + Intergenic
1203157249 17_GL000205v2_random:16074-16096 ACGGAAATTCAGACCAAAGCAGG + Intergenic
1203157519 17_GL000205v2_random:18568-18590 ACAAACACCCAGACCACAGCAGG + Intergenic
1203157619 17_GL000205v2_random:19383-19405 ACAAACACCCAGACCACAGCAGG + Intergenic
1203157697 17_GL000205v2_random:20103-20125 ACAAACACCCAGACCACAGCAGG + Intergenic
1203158044 17_GL000205v2_random:23126-23148 ACAAACACCCAGACCACAGCAGG + Intergenic
1203158524 17_GL000205v2_random:27862-27884 ACAAACACCCAGACCACAGCAGG + Intergenic
1203159361 17_GL000205v2_random:35045-35067 ACAAACACCCAGACCACAGCAGG + Intergenic
1155593297 18:27453136-27453158 ACAGAAGCCTGGAACAAAGTTGG - Intergenic
1156742908 18:40354492-40354514 AGAGATGACCAGACCAAAACAGG - Intergenic
1157244004 18:46037712-46037734 ACAGAGGCCCAAAGCCAAGCAGG + Intronic
1157733670 18:50027331-50027353 ACAGAAGCCCACACCCAGGAGGG + Intronic
1160145213 18:76358113-76358135 AAATAACCACAGACCAAAGCGGG + Intergenic
1162358785 19:10204652-10204674 ACAGAAACCCAAACCAGATCAGG + Intronic
1163703450 19:18798782-18798804 ACAGGAGCCCAGGCCAGGGCCGG + Intergenic
1164954266 19:32368148-32368170 CCAGCAGCCCACACCAAATCAGG + Intronic
1165363264 19:35349850-35349872 ACAGAATCACAGAGCAGAGCTGG + Intergenic
1165959582 19:39523013-39523035 ACAGAACCCAAGGCCCAAGCGGG + Intergenic
1166469908 19:43071205-43071227 AGAGGAGCCCAGAGCAGAGCAGG + Intronic
1167137681 19:47627064-47627086 ACAGGGGCCAAGACCACAGCTGG + Intronic
1167526621 19:49988292-49988314 ACAGAAGCCCAGAGCCCAACTGG - Intronic
1167570184 19:50281974-50281996 ACAGAGGCCCAGAGCAAAGAAGG - Intronic
1168078767 19:53994173-53994195 ACAGACGCCCACCCCAAAGCAGG + Intronic
926109596 2:10173512-10173534 GCAGAGGCCCAGCCCAATGCAGG + Intronic
926220350 2:10932030-10932052 ACAGAGGCCCAGATCACAGCAGG + Intergenic
927618440 2:24624556-24624578 CCAGAAGCAAGGACCAAAGCTGG - Intronic
927843011 2:26457263-26457285 ACAGAAACCCAGACACAGGCAGG + Exonic
928073258 2:28239039-28239061 ACAGAAACCCACAACAAAACTGG - Intronic
929095572 2:38260548-38260570 AGAGAAGCCCAGATCAACACGGG - Intergenic
929298134 2:40271328-40271350 ACAGGAGCCGAGACACAAGCTGG - Intronic
930668404 2:54122554-54122576 ACAGAAGCCCTGTCCCAAGAGGG + Intronic
932417343 2:71581462-71581484 CCAGGAGCCCAGGCCAAAGGAGG - Intronic
932618275 2:73249948-73249970 GCAGAAGACCAGACCCAGGCAGG - Intronic
933804991 2:85992135-85992157 ACAGAAACACAGACGAAATCTGG - Intergenic
934301796 2:91780899-91780921 ACAGGAGACCAGCACAAAGCAGG - Intergenic
937923235 2:127146856-127146878 ACAGAAACCCAAGCCAAACCTGG - Intergenic
938850546 2:135255157-135255179 CCAAAAGACCAGACCAAACCAGG + Intronic
940138598 2:150467390-150467412 TCAGAAGCCCAAAGCAAAGGGGG - Intergenic
941827464 2:169916498-169916520 ACAGAAGGGCAGTCCAAAGTGGG - Intronic
943581451 2:189688303-189688325 ACAGACGCCTAGACCAAAGGAGG - Intronic
944542625 2:200767870-200767892 ACAGAATCACAGACCGAAGAAGG - Intergenic
946843798 2:223841399-223841421 ACAGAAGTCAAGACTAAGGCTGG - Intergenic
1171035517 20:21709767-21709789 ACAGAAACCCAGAAAGAAGCAGG - Intronic
1172304502 20:33871493-33871515 ACTGAAAGCCAGACCAACGCAGG - Intergenic
1173436343 20:43035165-43035187 TCAGCAGTCCAGACCAAAGGAGG + Intronic
1173867883 20:46324079-46324101 TCAGAAGCCCAGAGAAGAGCGGG - Intergenic
1174388298 20:50200030-50200052 AAACAAGCCCAGAGCAAAGCAGG - Intergenic
1175622473 20:60460527-60460549 ACAGAATTCCAGAACAATGCTGG - Intergenic
1177841272 21:26236499-26236521 GCAGCAGCCCAGAGCAAAGAGGG + Intergenic
1179191258 21:39123998-39124020 ACAGAAACCCAAAACCAAGCAGG + Intergenic
1179304263 21:40140780-40140802 ACAGAACCACAGACCCAAGAAGG - Intronic
1181200825 22:21216156-21216178 ACAGGAGACCAGCACAAAGCAGG + Intronic
1183033022 22:35119618-35119640 GCAGAGGCACAGACCAAGGCTGG + Intergenic
1183480029 22:38058591-38058613 ACAGCAACCCAGTCCATAGCAGG - Intronic
1183587406 22:38760864-38760886 AAAAAAGCCAAGACCAGAGCAGG - Intronic
1185024104 22:48397666-48397688 ACAGGAGCCCAGAAAACAGCTGG - Intergenic
1185270143 22:49926039-49926061 TCAGAGGCCCAGACGCAAGCAGG + Intronic
1203226094 22_KI270731v1_random:79279-79301 ACAGGAGACCAGCACAAAGCAGG - Intergenic
1203264733 22_KI270734v1_random:7507-7529 ACAGGAGACCAGCACAAAGCAGG + Intergenic
951607186 3:24448901-24448923 AGAGAAGCCCATGCAAAAGCAGG + Intronic
953129341 3:40123527-40123549 ACAGCAGCCCAGGCTGAAGCAGG + Intronic
954698994 3:52441959-52441981 CCAGCAGCCCACACCCAAGCAGG + Intronic
956738350 3:72256061-72256083 GCAGAGGCCCAGACCAAGCCTGG + Intergenic
958665083 3:97127260-97127282 ACAGAAATACAGAGCAAAGCAGG - Intronic
958982330 3:100736683-100736705 ACAGGAGCTCAGACTCAAGCAGG + Exonic
960575270 3:119222983-119223005 ACAGAAGCCCAGAACAAATGAGG + Intronic
962318538 3:134373576-134373598 GCAGGAGCCCAGGCCAAGGCTGG - Intronic
963222220 3:142825291-142825313 ACAGCAGGCCCCACCAAAGCAGG - Intronic
963901242 3:150735407-150735429 ACAGAAGCCCAGAGGAGAGCAGG - Intergenic
964804744 3:160596373-160596395 AGAGAAGCCCAGACTAAAGTGGG + Intergenic
964845735 3:161042489-161042511 ACACAAGGCCAGACCAACTCAGG + Intronic
967218197 3:187227767-187227789 CCAGAGCCCCAGACCAAGGCAGG - Intronic
968744196 4:2351070-2351092 ACAGAAGCACAGACCACACCTGG + Intronic
968744317 4:2351765-2351787 ACAGAAGCACAGACCATGCCTGG - Intronic
969484149 4:7462472-7462494 GCAGAAGCCCAGATAAAAGCAGG + Intronic
969875470 4:10132853-10132875 ACAGAAGGCAGGAACAAAGCTGG + Intergenic
970543871 4:17106959-17106981 ACAGAAGCTCAGACTAAAGCTGG - Intergenic
972282722 4:37618800-37618822 ACATTATCCCACACCAAAGCAGG - Intronic
973024921 4:45256286-45256308 AGAGAAGTGCAGAACAAAGCAGG + Intergenic
981066195 4:140488897-140488919 ACAGAAGGCTAGGCCAGAGCAGG - Intronic
981104778 4:140867796-140867818 ACAGAAACCTATACAAAAGCTGG + Exonic
983524246 4:168744269-168744291 ACAGAAGCAGAGAACAAAGGGGG - Intronic
983528160 4:168781770-168781792 ACAGAAGCCCGGAACAAGACTGG + Intronic
983815887 4:172126736-172126758 ACACAATCTCAGCCCAAAGCAGG + Intronic
983817434 4:172149548-172149570 ACAGAGGCCCAGAGATAAGCAGG - Intronic
985618459 5:938580-938602 ACCGAATGCCAGACCAAAGCTGG + Intergenic
986780884 5:11064612-11064634 GCAGAAGACAAGACCAAAGTTGG + Intronic
987050651 5:14144427-14144449 ACAGAAGTGTAGACCAAGGCCGG - Intronic
991956076 5:71997140-71997162 AAATGAGCCCAGAGCAAAGCTGG - Intergenic
994866208 5:105274541-105274563 AAAGAAGCCTAGTCCAAATCAGG + Intergenic
995738213 5:115326247-115326269 ATAGCAGCCCAGACCACTGCTGG + Intergenic
998897455 5:146814901-146814923 ACAGAAGGAGAGACCAAGGCAGG - Intronic
999718277 5:154379588-154379610 CAAGAAGCCCTGACCACAGCTGG - Intronic
1001250595 5:170143957-170143979 AGGTAAGCCCAGACCAAGGCTGG + Intergenic
1002334406 5:178468147-178468169 ACACAAGCACACCCCAAAGCCGG - Intronic
1002495333 5:179607730-179607752 CCAGAAGCCCATATCAGAGCAGG + Intronic
1002497481 5:179624937-179624959 ACAGGAGCCCAGAGCTAAGCAGG + Intronic
1003722442 6:8718719-8718741 ACAGAAACCCAGACATCAGCTGG - Intergenic
1004496581 6:16169074-16169096 AGAGAAGCACAGAGCAAAGGGGG - Intergenic
1005346253 6:24893699-24893721 ACAGAAGCCCCAACCAAACTGGG + Intronic
1005818998 6:29581376-29581398 ACTGAAGCCCAGAGCAGACCTGG - Intronic
1005881602 6:30066791-30066813 AGAGAAACCCAGACCAAACAAGG + Intronic
1005969779 6:30751884-30751906 AAAGAAACCAAGACCAAAGGAGG - Intergenic
1006332015 6:33398369-33398391 ACACAAGGCCAGACCACAGGTGG + Exonic
1006738479 6:36291728-36291750 ACAGAAGCCCAGGACGAACCAGG + Intronic
1007697441 6:43742879-43742901 AAAGAAGCCCAGACCACAGGAGG - Intergenic
1008744354 6:54651189-54651211 AGAGAAGAGAAGACCAAAGCTGG - Intergenic
1009475834 6:64091405-64091427 ACAGCAGCCCAGACCCTTGCTGG - Intronic
1010924538 6:81727953-81727975 ACAGAAGCTGAGGCCAAAGGTGG - Intronic
1011216547 6:85011983-85012005 AGAGAAGTGCAGAGCAAAGCAGG + Intergenic
1012682931 6:102205829-102205851 ACAGGAGCAAAGACAAAAGCAGG - Intergenic
1015228220 6:130882941-130882963 GCAGAATCCAAGACCAAATCAGG + Intronic
1015855168 6:137616548-137616570 AAGGAAGCCCAGATGAAAGCTGG - Intergenic
1016730291 6:147421127-147421149 ACAGAATCCCAGGCAGAAGCAGG - Intergenic
1019594266 7:1851176-1851198 ACCCATGCCCAGACCAGAGCGGG + Intronic
1019594289 7:1851245-1851267 ACCCACGCCCAGACCAGAGCCGG + Intronic
1019777265 7:2919252-2919274 AGAGAAGCCCAGGCCAAAGAAGG - Intronic
1021222345 7:17988708-17988730 AGAGAAGACAAGACCAAAGATGG + Intergenic
1021572235 7:22077868-22077890 AAAGAGGCTCAGAGCAAAGCTGG - Intergenic
1024704132 7:51938786-51938808 AGAGCAGCCCAGAGCAAAGTTGG - Intergenic
1027652258 7:80883327-80883349 ACAGAAGCACACACCTTAGCAGG + Intronic
1028006405 7:85574723-85574745 ACAGAAGCCTTGGCCAAACCTGG + Intergenic
1032400590 7:131621764-131621786 ACAGAAGCCCAGAGCTGGGCTGG + Intergenic
1032660457 7:133978236-133978258 GCAGCAGCCCAGACCAAAAATGG - Intronic
1032831911 7:135636197-135636219 AAAGATGCTCAGACCAAACCAGG - Intronic
1032836658 7:135681446-135681468 ACACAACCCCAGACCCACGCCGG - Exonic
1033226817 7:139569110-139569132 AGAGAAACCCTGAACAAAGCTGG - Exonic
1036635770 8:10548674-10548696 ACAGAAGCCCAGGCACAAGGTGG + Intronic
1037826010 8:22161095-22161117 AGACAAGCCCAGAGCAAAGAAGG + Intronic
1048456725 8:134585002-134585024 CTAGAAACCCAGACCAGAGCTGG - Intronic
1049427523 8:142544049-142544071 ACAAGAGCCCAGAACAGAGCTGG - Intronic
1049776455 8:144408079-144408101 TCAGAAGCTCAGGCCAAAGGAGG - Intronic
1052540088 9:29799893-29799915 ACAGAAGTCCAGATCATAGCAGG + Intergenic
1052550331 9:29939580-29939602 ACACCAGCCCAGATCAAAGTGGG - Intergenic
1053097492 9:35341177-35341199 GCAGAAGTCTAGACCAAAGATGG - Intronic
1053275778 9:36782275-36782297 AGAGATGCCCAGATCAAAGAGGG - Intergenic
1056008297 9:82298275-82298297 AAAGAAGCAGAGACCAAACCAGG - Intergenic
1056414838 9:86366298-86366320 AAAGAATCCCAGAACTAAGCGGG - Intergenic
1056507402 9:87270286-87270308 ACAGAAGCCCAGGCCGGCGCTGG + Intergenic
1056867709 9:90244379-90244401 ACAGAAACACAGACCACACCTGG - Intergenic
1057046922 9:91893198-91893220 ACAGAACCCCAGGCTGAAGCTGG + Intronic
1057452680 9:95178625-95178647 ACAGACGCACAGACACAAGCTGG - Intronic
1058482721 9:105413501-105413523 ACAGAACCACAGACCAAAGATGG + Intronic
1059747704 9:117219190-117219212 ACAGAAGCCTGGACCAGTGCAGG - Intronic
1061505491 9:131029544-131029566 ACAGAAACCAAGAGCAGAGCAGG + Intronic
1062325923 9:136012461-136012483 GCAGGAGCCCAGGCCAAGGCCGG + Intronic
1062464130 9:136673736-136673758 CCAGTAGCCCAGACCACGGCAGG - Exonic
1203495169 Un_GL000224v1:144425-144447 ACAAACACCCAGACCAAAGCAGG - Intergenic
1203495762 Un_GL000224v1:149923-149945 AAAAACACCCAGACCAAAGCAGG + Intergenic
1203495998 Un_GL000224v1:152081-152103 ACAAACACCCAGACCACAGCAGG + Intergenic
1203507795 Un_KI270741v1:86348-86370 ACAAACACCCAGACCAAAGCAGG - Intergenic
1203508386 Un_KI270741v1:91846-91868 AAAAACACCCAGACCAAAGCAGG + Intergenic
1203508621 Un_KI270741v1:94004-94026 ACAAACACCCAGACCACAGCAGG + Intergenic
1186608385 X:11114399-11114421 AGAGAAGCCCAGATCCAATCAGG - Intronic
1186757315 X:12685788-12685810 CTACAAGCCCAGACCTAAGCAGG - Intronic
1187243332 X:17532667-17532689 AAGAAAGCCCAGACCAAGGCAGG + Intronic
1189293146 X:39900124-39900146 GCAGAAGCCCAGACATAAGTGGG - Intergenic
1200087017 X:153611919-153611941 ACAGAAGCCCGGACGGAAGCAGG - Intergenic
1200426046 Y:3021464-3021486 ACAGAAGCGCAGGTCACAGCAGG - Intergenic