ID: 914904610

View in Genome Browser
Species Human (GRCh38)
Location 1:151733583-151733605
Sequence CCTGTTCCTGGTCTCTGTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914904610_914904616 -8 Left 914904610 1:151733583-151733605 CCTCAACAGAGACCAGGAACAGG No data
Right 914904616 1:151733598-151733620 GGAACAGGAGGGAAACTGCTGGG No data
914904610_914904615 -9 Left 914904610 1:151733583-151733605 CCTCAACAGAGACCAGGAACAGG No data
Right 914904615 1:151733597-151733619 AGGAACAGGAGGGAAACTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914904610 Original CRISPR CCTGTTCCTGGTCTCTGTTG AGG (reversed) Intergenic
No off target data available for this crispr