ID: 914908917

View in Genome Browser
Species Human (GRCh38)
Location 1:151769191-151769213
Sequence CGGTGTGGCGGCCGGGCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4094
Summary {0: 2, 1: 199, 2: 1206, 3: 1091, 4: 1596}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914908907_914908917 12 Left 914908907 1:151769156-151769178 CCATTCTCAATGAGCTCTTGGGT 0: 7
1: 1064
2: 712
3: 150
4: 193
Right 914908917 1:151769191-151769213 CGGTGTGGCGGCCGGGCAGAGGG 0: 2
1: 199
2: 1206
3: 1091
4: 1596
914908903_914908917 28 Left 914908903 1:151769140-151769162 CCATCGTCATCATGGCCCATTCT 0: 91
1: 532
2: 969
3: 791
4: 250
Right 914908917 1:151769191-151769213 CGGTGTGGCGGCCGGGCAGAGGG 0: 2
1: 199
2: 1206
3: 1091
4: 1596
914908905_914908917 13 Left 914908905 1:151769155-151769177 CCCATTCTCAATGAGCTCTTGGG 0: 1
1: 139
2: 1488
3: 417
4: 218
Right 914908917 1:151769191-151769213 CGGTGTGGCGGCCGGGCAGAGGG 0: 2
1: 199
2: 1206
3: 1091
4: 1596

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914908917 Original CRISPR CGGTGTGGCGGCCGGGCAGA GGG Intronic
Too many off-targets to display for this crispr