ID: 914909764

View in Genome Browser
Species Human (GRCh38)
Location 1:151775482-151775504
Sequence GACTCACTCATTGTGCTGAC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 82}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914909764_914909766 12 Left 914909764 1:151775482-151775504 CCAGTCAGCACAATGAGTGAGTC 0: 1
1: 0
2: 0
3: 5
4: 82
Right 914909766 1:151775517-151775539 CCAAAGCTTCCTCTTCCCACTGG 0: 1
1: 0
2: 4
3: 47
4: 573
914909764_914909767 20 Left 914909764 1:151775482-151775504 CCAGTCAGCACAATGAGTGAGTC 0: 1
1: 0
2: 0
3: 5
4: 82
Right 914909767 1:151775525-151775547 TCCTCTTCCCACTGGTCACCTGG 0: 1
1: 0
2: 8
3: 29
4: 259

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914909764 Original CRISPR GACTCACTCATTGTGCTGAC TGG (reversed) Exonic
903419806 1:23210517-23210539 GACTCCCTCATGATGCTGACAGG + Intergenic
904206051 1:28855932-28855954 GACTCACTCATTGTCCTCCAGGG - Intronic
906651242 1:47514445-47514467 CACTCTCTCAGTGGGCTGACTGG - Intergenic
907030433 1:51165824-51165846 GACTCAGTTATAGTGCTGGCTGG - Intergenic
907232757 1:53015374-53015396 GAGTCACTAAATGTGCTGATTGG + Intronic
907486673 1:54782688-54782710 TACTCACTCATTGCACAGACAGG - Intronic
911163258 1:94702568-94702590 GAGTCACTCATTGCCCTGGCTGG + Intergenic
912758556 1:112345887-112345909 GACTCAGTCACTGTGCTGCGAGG - Intergenic
914909764 1:151775482-151775504 GACTCACTCATTGTGCTGACTGG - Exonic
922331262 1:224578543-224578565 GAGTCTCTCATTTTGGTGACTGG + Intronic
923013545 1:230108041-230108063 GACTCATTCATAGGGCTCACTGG + Intronic
924186177 1:241493822-241493844 GTCTCACTCATTCTGTTGCCTGG + Intergenic
1073473651 10:103739221-103739243 GCCTCACTCAGAGTGCAGACTGG - Intronic
1078278962 11:9880052-9880074 GTCTCACTCATTGTCCAGGCTGG - Intronic
1081736564 11:45408571-45408593 GACTCACTGATCATGCAGACAGG + Intergenic
1084977360 11:72809436-72809458 GGCTCACTCATTTGGCTGGCAGG - Intergenic
1085741335 11:79080523-79080545 GCCTCTCCCATTGTGTTGACTGG + Intronic
1087520254 11:99224569-99224591 GAATCACTCATTGTGCCAGCTGG + Intronic
1089946631 11:122480446-122480468 GTCTCTCTCTTTGTGCTGTCTGG - Intergenic
1091170470 11:133515888-133515910 GACTCACTCATGGCGCTGTGAGG - Intronic
1092052079 12:5478961-5478983 GAAGCTCTGATTGTGCTGACGGG - Intronic
1092980964 12:13793791-13793813 GACTTACTGATTGTGCTCAGAGG - Intronic
1098234958 12:68409714-68409736 GAATCAATCATTGTCCTGACCGG + Intergenic
1099153078 12:79139824-79139846 GACTCACTCATTCTGCTCAGTGG - Intronic
1101988042 12:109462582-109462604 CACTCATTTATTGTGCTTACTGG - Intronic
1103339459 12:120213762-120213784 GTCTTCCTCATTGTGCTGTCTGG - Intronic
1104531791 12:129578848-129578870 TACTCACCCACTTTGCTGACAGG + Intronic
1112208293 13:97347251-97347273 GATTTACTTATTGTGCTGAAGGG - Intronic
1113798145 13:113070775-113070797 GGCTCACTCATTGTGTTCCCCGG + Intronic
1118981077 14:70717629-70717651 GCCTCACTCATTGACCTGTCTGG + Intergenic
1120038900 14:79729886-79729908 GAGGCACTAATTGGGCTGACTGG + Intronic
1120561581 14:86000703-86000725 GACTCACTCTTTGTCCAGACTGG + Intergenic
1123177900 14:106439177-106439199 CACTCACTGACTGGGCTGACTGG + Intergenic
1127027303 15:54821068-54821090 GACTCACACATTGCGATGGCTGG - Intergenic
1133926143 16:10194124-10194146 GACTCACTCACAGGGCTGGCAGG - Intergenic
1138409234 16:56825008-56825030 TTCTGACTCATTTTGCTGACTGG - Intronic
1141110689 16:81268409-81268431 GACTCACTCCTTTTGCTGCTGGG - Intronic
1142312153 16:89320440-89320462 GACTCACGCCCTGTGCTGAGCGG + Intronic
1153950651 18:10054991-10055013 GACCCCATCACTGTGCTGACTGG + Intergenic
1155576247 18:27250486-27250508 GTCTCACTCAGTGTTCTGATGGG + Intergenic
927118523 2:19928735-19928757 AACTCACTTATTATGCTGCCTGG - Intronic
938695650 2:133833122-133833144 GTCTCATTCATTGTCCTTACTGG - Intergenic
941399808 2:165016832-165016854 GACTCAATCACTGTGCAGATGGG - Intergenic
945312387 2:208329508-208329530 GAGTCCCACCTTGTGCTGACAGG + Intronic
1168846138 20:945915-945937 GGCTCACTCATTGCGCCAACAGG - Intergenic
1169448353 20:5690759-5690781 GCCTCACTCAAGGTGGTGACAGG - Intergenic
1172324388 20:34023274-34023296 GACTGACTCATTGTGGATACAGG + Intronic
1174898048 20:54471448-54471470 GAATCACTCATTGTTGGGACTGG + Intergenic
1174934217 20:54849921-54849943 CACTCTCTCATTGTGCTTCCTGG + Intergenic
950450014 3:13060223-13060245 TACTCTCCCATGGTGCTGACTGG - Intronic
950579367 3:13852506-13852528 GACCCACTCCTTGTTCCGACCGG - Intronic
952762848 3:36930341-36930363 GACTCACTCATGTTGTTGGCAGG - Intronic
959579724 3:107971108-107971130 GTCTCAGTCTTTGTGCTGATTGG + Intergenic
974388812 4:61237496-61237518 GATTCACTCATGGAGCTGTCAGG - Intronic
976141547 4:81998469-81998491 GACTCACTCATTCTGCCCATTGG - Intronic
978665549 4:111177114-111177136 AAGTCACTTATTGTGCTGGCTGG + Intergenic
979484257 4:121252843-121252865 CAATCAGTCATTGTGCTGGCTGG - Intergenic
984054517 4:174910378-174910400 GCCTCCCTCATGGTGCTGGCTGG + Intronic
986529953 5:8726260-8726282 AACTGGGTCATTGTGCTGACCGG + Intergenic
990026319 5:51194854-51194876 GTCTGATCCATTGTGCTGACTGG + Intergenic
992724221 5:79590292-79590314 GACTCACTCATTGCCCAGGCTGG - Intergenic
1002948698 6:1787244-1787266 GTCTCGCTCATTTTTCTGACTGG - Intronic
1008387183 6:50905212-50905234 CAATCAGTCATTGTGCTGTCTGG + Intergenic
1017970439 6:159307835-159307857 CACTCACTAATTATGCTGTCTGG + Intergenic
1021744111 7:23721657-23721679 GACTCCCTCCCTGTGCTGTCAGG - Intronic
1021964073 7:25900318-25900340 CCCTCATTAATTGTGCTGACAGG + Intergenic
1025288802 7:57693515-57693537 GAATCTCTAATTGGGCTGACTGG - Intergenic
1028122458 7:87071448-87071470 GACTTACTTATTGTGCCGGCTGG - Intergenic
1028194711 7:87892782-87892804 GACTTACTCATTGTCCTGTGGGG + Intronic
1034959511 7:155356283-155356305 CACTCACTGATTGTGGGGACTGG + Intergenic
1035455319 7:159005183-159005205 GTCTCACTCTGTGTGCAGACTGG - Intergenic
1036616953 8:10395594-10395616 GACTCATTCATGATGCTGCCTGG - Intronic
1039135782 8:34321336-34321358 AACTCACTCATTGTGATCCCAGG - Intergenic
1039431604 8:37529321-37529343 CACTCACTCATTGTCCTGCTTGG - Intergenic
1041163190 8:55065723-55065745 CACTCCCCTATTGTGCTGACTGG + Intergenic
1050215774 9:3321295-3321317 GACTCAGTCAGTGTGCTTCCGGG - Intronic
1058309892 9:103486519-103486541 GACTCACTCATAGTTCTGCATGG - Intergenic
1059427445 9:114230122-114230144 GACTCACTCATTGTGTGAACTGG - Intronic
1061885393 9:133588719-133588741 GACCCACTCATTGTGCAGTTGGG + Intergenic
1188459189 X:30403748-30403770 CACTCACTCATTTTTCTGTCTGG + Intergenic
1189147473 X:38669904-38669926 GACTCTCCCATTTTGCTGATGGG - Intronic
1192296336 X:69852741-69852763 GTCTCAGTCTTGGTGCTGACTGG + Intronic
1193646638 X:84078419-84078441 GACTCAATCATTCTGCTCATAGG + Intronic
1196538774 X:116880947-116880969 GACGCACTTAATGTGCTGAAGGG - Intergenic
1197128617 X:122977368-122977390 AACTAAATCATTGTCCTGACTGG - Intergenic
1197531633 X:127635421-127635443 GACTCCCTCACTGTGCTCATTGG + Intergenic
1197674465 X:129314542-129314564 GATTCACTTATTATGCTGTCAGG - Intergenic
1200852106 Y:7893890-7893912 GTCCCACTCACTTTGCTGACAGG + Intergenic